ID: 1008165974

View in Genome Browser
Species Human (GRCh38)
Location 6:48138847-48138869
Sequence CTCAAGTAGAAGGCAGACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008165972_1008165974 -9 Left 1008165972 6:48138833-48138855 CCTGGACATAAGATCTCAAGTAG No data
Right 1008165974 6:48138847-48138869 CTCAAGTAGAAGGCAGACCATGG No data
1008165971_1008165974 3 Left 1008165971 6:48138821-48138843 CCTTGGTTATCACCTGGACATAA No data
Right 1008165974 6:48138847-48138869 CTCAAGTAGAAGGCAGACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008165974 Original CRISPR CTCAAGTAGAAGGCAGACCA TGG Intergenic
No off target data available for this crispr