ID: 1008167930

View in Genome Browser
Species Human (GRCh38)
Location 6:48163552-48163574
Sequence TCACCTTTACCAACAACCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008167930_1008167936 23 Left 1008167930 6:48163552-48163574 CCTTGGGTTGTTGGTAAAGGTGA No data
Right 1008167936 6:48163598-48163620 CCTTTGGGATGTGATTTGCTAGG No data
1008167930_1008167932 0 Left 1008167930 6:48163552-48163574 CCTTGGGTTGTTGGTAAAGGTGA No data
Right 1008167932 6:48163575-48163597 TGATGATGTGTTAGATGGTACGG No data
1008167930_1008167933 7 Left 1008167930 6:48163552-48163574 CCTTGGGTTGTTGGTAAAGGTGA No data
Right 1008167933 6:48163582-48163604 GTGTTAGATGGTACGGCCTTTGG No data
1008167930_1008167931 -5 Left 1008167930 6:48163552-48163574 CCTTGGGTTGTTGGTAAAGGTGA No data
Right 1008167931 6:48163570-48163592 GGTGATGATGATGTGTTAGATGG No data
1008167930_1008167934 8 Left 1008167930 6:48163552-48163574 CCTTGGGTTGTTGGTAAAGGTGA No data
Right 1008167934 6:48163583-48163605 TGTTAGATGGTACGGCCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008167930 Original CRISPR TCACCTTTACCAACAACCCA AGG (reversed) Intergenic
No off target data available for this crispr