ID: 1008173668

View in Genome Browser
Species Human (GRCh38)
Location 6:48239714-48239736
Sequence CTTTTTAATGGGATTGTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008173668_1008173674 26 Left 1008173668 6:48239714-48239736 CCATTAACAATCCCATTAAAAAG No data
Right 1008173674 6:48239763-48239785 CTCAAAAGGAGACATACATGTGG 0: 10
1: 339
2: 1374
3: 4896
4: 6419
1008173668_1008173673 12 Left 1008173668 6:48239714-48239736 CCATTAACAATCCCATTAAAAAG No data
Right 1008173673 6:48239749-48239771 ATGTACAGACACTTCTCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008173668 Original CRISPR CTTTTTAATGGGATTGTTAA TGG (reversed) Intergenic
No off target data available for this crispr