ID: 1008173673

View in Genome Browser
Species Human (GRCh38)
Location 6:48239749-48239771
Sequence ATGTACAGACACTTCTCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008173671_1008173673 1 Left 1008173671 6:48239725-48239747 CCCATTAAAAAGTGGGCAAAGTA 0: 44
1: 1776
2: 10041
3: 12843
4: 10750
Right 1008173673 6:48239749-48239771 ATGTACAGACACTTCTCAAAAGG No data
1008173668_1008173673 12 Left 1008173668 6:48239714-48239736 CCATTAACAATCCCATTAAAAAG No data
Right 1008173673 6:48239749-48239771 ATGTACAGACACTTCTCAAAAGG No data
1008173667_1008173673 13 Left 1008173667 6:48239713-48239735 CCCATTAACAATCCCATTAAAAA No data
Right 1008173673 6:48239749-48239771 ATGTACAGACACTTCTCAAAAGG No data
1008173672_1008173673 0 Left 1008173672 6:48239726-48239748 CCATTAAAAAGTGGGCAAAGTAC 0: 34
1: 1486
2: 4947
3: 12957
4: 9885
Right 1008173673 6:48239749-48239771 ATGTACAGACACTTCTCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008173673 Original CRISPR ATGTACAGACACTTCTCAAA AGG Intergenic
No off target data available for this crispr