ID: 1008173674

View in Genome Browser
Species Human (GRCh38)
Location 6:48239763-48239785
Sequence CTCAAAAGGAGACATACATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 13038
Summary {0: 10, 1: 339, 2: 1374, 3: 4896, 4: 6419}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008173672_1008173674 14 Left 1008173672 6:48239726-48239748 CCATTAAAAAGTGGGCAAAGTAC 0: 34
1: 1486
2: 4947
3: 12957
4: 9885
Right 1008173674 6:48239763-48239785 CTCAAAAGGAGACATACATGTGG 0: 10
1: 339
2: 1374
3: 4896
4: 6419
1008173671_1008173674 15 Left 1008173671 6:48239725-48239747 CCCATTAAAAAGTGGGCAAAGTA 0: 44
1: 1776
2: 10041
3: 12843
4: 10750
Right 1008173674 6:48239763-48239785 CTCAAAAGGAGACATACATGTGG 0: 10
1: 339
2: 1374
3: 4896
4: 6419
1008173668_1008173674 26 Left 1008173668 6:48239714-48239736 CCATTAACAATCCCATTAAAAAG No data
Right 1008173674 6:48239763-48239785 CTCAAAAGGAGACATACATGTGG 0: 10
1: 339
2: 1374
3: 4896
4: 6419
1008173667_1008173674 27 Left 1008173667 6:48239713-48239735 CCCATTAACAATCCCATTAAAAA No data
Right 1008173674 6:48239763-48239785 CTCAAAAGGAGACATACATGTGG 0: 10
1: 339
2: 1374
3: 4896
4: 6419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008173674 Original CRISPR CTCAAAAGGAGACATACATG TGG Intergenic
Too many off-targets to display for this crispr