ID: 1008176642

View in Genome Browser
Species Human (GRCh38)
Location 6:48276119-48276141
Sequence CTGAAGCATGCATTTACTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008176642_1008176647 27 Left 1008176642 6:48276119-48276141 CCACAAGTAAATGCATGCTTCAG No data
Right 1008176647 6:48276169-48276191 AACAAAAATCTGAGTGAACTTGG No data
1008176642_1008176643 -7 Left 1008176642 6:48276119-48276141 CCACAAGTAAATGCATGCTTCAG No data
Right 1008176643 6:48276135-48276157 GCTTCAGCCCTATACCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008176642 Original CRISPR CTGAAGCATGCATTTACTTG TGG (reversed) Intergenic
No off target data available for this crispr