ID: 1008179808

View in Genome Browser
Species Human (GRCh38)
Location 6:48314550-48314572
Sequence AGGGAGCACAGAGATCAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008179808_1008179815 25 Left 1008179808 6:48314550-48314572 CCAGCTTGATCTCTGTGCTCCCT No data
Right 1008179815 6:48314598-48314620 AAGGGGTGTTCCAGCTTTTGAGG No data
1008179808_1008179814 8 Left 1008179808 6:48314550-48314572 CCAGCTTGATCTCTGTGCTCCCT No data
Right 1008179814 6:48314581-48314603 ATTTAGTGTCTAGAGTGAAGGGG No data
1008179808_1008179816 26 Left 1008179808 6:48314550-48314572 CCAGCTTGATCTCTGTGCTCCCT No data
Right 1008179816 6:48314599-48314621 AGGGGTGTTCCAGCTTTTGAGGG No data
1008179808_1008179812 6 Left 1008179808 6:48314550-48314572 CCAGCTTGATCTCTGTGCTCCCT No data
Right 1008179812 6:48314579-48314601 TGATTTAGTGTCTAGAGTGAAGG No data
1008179808_1008179813 7 Left 1008179808 6:48314550-48314572 CCAGCTTGATCTCTGTGCTCCCT No data
Right 1008179813 6:48314580-48314602 GATTTAGTGTCTAGAGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008179808 Original CRISPR AGGGAGCACAGAGATCAAGC TGG (reversed) Intergenic
No off target data available for this crispr