ID: 1008179810

View in Genome Browser
Species Human (GRCh38)
Location 6:48314569-48314591
Sequence AGACACTAAATCACCTAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008179810_1008179816 7 Left 1008179810 6:48314569-48314591 CCCTGCTAGGTGATTTAGTGTCT No data
Right 1008179816 6:48314599-48314621 AGGGGTGTTCCAGCTTTTGAGGG No data
1008179810_1008179815 6 Left 1008179810 6:48314569-48314591 CCCTGCTAGGTGATTTAGTGTCT No data
Right 1008179815 6:48314598-48314620 AAGGGGTGTTCCAGCTTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008179810 Original CRISPR AGACACTAAATCACCTAGCA GGG (reversed) Intergenic
No off target data available for this crispr