ID: 1008179810 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:48314569-48314591 |
| Sequence | AGACACTAAATCACCTAGCA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1008179810_1008179815 | 6 | Left | 1008179810 | 6:48314569-48314591 | CCCTGCTAGGTGATTTAGTGTCT | No data | ||
| Right | 1008179815 | 6:48314598-48314620 | AAGGGGTGTTCCAGCTTTTGAGG | No data | ||||
| 1008179810_1008179816 | 7 | Left | 1008179810 | 6:48314569-48314591 | CCCTGCTAGGTGATTTAGTGTCT | No data | ||
| Right | 1008179816 | 6:48314599-48314621 | AGGGGTGTTCCAGCTTTTGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1008179810 | Original CRISPR | AGACACTAAATCACCTAGCA GGG (reversed) | Intergenic | ||