ID: 1008179816

View in Genome Browser
Species Human (GRCh38)
Location 6:48314599-48314621
Sequence AGGGGTGTTCCAGCTTTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008179808_1008179816 26 Left 1008179808 6:48314550-48314572 CCAGCTTGATCTCTGTGCTCCCT No data
Right 1008179816 6:48314599-48314621 AGGGGTGTTCCAGCTTTTGAGGG No data
1008179810_1008179816 7 Left 1008179810 6:48314569-48314591 CCCTGCTAGGTGATTTAGTGTCT No data
Right 1008179816 6:48314599-48314621 AGGGGTGTTCCAGCTTTTGAGGG No data
1008179811_1008179816 6 Left 1008179811 6:48314570-48314592 CCTGCTAGGTGATTTAGTGTCTA No data
Right 1008179816 6:48314599-48314621 AGGGGTGTTCCAGCTTTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008179816 Original CRISPR AGGGGTGTTCCAGCTTTTGA GGG Intergenic
No off target data available for this crispr