ID: 1008182826

View in Genome Browser
Species Human (GRCh38)
Location 6:48354223-48354245
Sequence TTGATGTTTTTGAGGAACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008182823_1008182826 -4 Left 1008182823 6:48354204-48354226 CCCTTGTTTTAGATGAAGCTTGA No data
Right 1008182826 6:48354223-48354245 TTGATGTTTTTGAGGAACAATGG No data
1008182824_1008182826 -5 Left 1008182824 6:48354205-48354227 CCTTGTTTTAGATGAAGCTTGAT No data
Right 1008182826 6:48354223-48354245 TTGATGTTTTTGAGGAACAATGG No data
1008182822_1008182826 28 Left 1008182822 6:48354172-48354194 CCTCTTCTTTACTGTGACAGTTT No data
Right 1008182826 6:48354223-48354245 TTGATGTTTTTGAGGAACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008182826 Original CRISPR TTGATGTTTTTGAGGAACAA TGG Intergenic
No off target data available for this crispr