ID: 1008185773

View in Genome Browser
Species Human (GRCh38)
Location 6:48388765-48388787
Sequence TCTCTTCAATGGTGTACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008185768_1008185773 10 Left 1008185768 6:48388732-48388754 CCACGCTGTGTTTTTGGAGAGAA No data
Right 1008185773 6:48388765-48388787 TCTCTTCAATGGTGTACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008185773 Original CRISPR TCTCTTCAATGGTGTACTGC AGG Intergenic
No off target data available for this crispr