ID: 1008192267

View in Genome Browser
Species Human (GRCh38)
Location 6:48474838-48474860
Sequence AGGAAGAATGCAGTAACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008192259_1008192267 25 Left 1008192259 6:48474790-48474812 CCTGACAGTGGCCAGGTGGCACA No data
Right 1008192267 6:48474838-48474860 AGGAAGAATGCAGTAACTGTGGG No data
1008192260_1008192267 14 Left 1008192260 6:48474801-48474823 CCAGGTGGCACAGAGAAAGAATC No data
Right 1008192267 6:48474838-48474860 AGGAAGAATGCAGTAACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008192267 Original CRISPR AGGAAGAATGCAGTAACTGT GGG Intergenic
No off target data available for this crispr