ID: 1008198652

View in Genome Browser
Species Human (GRCh38)
Location 6:48558520-48558542
Sequence TTCTTGGGTCTCAAGCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 889
Summary {0: 6, 1: 28, 2: 95, 3: 248, 4: 512}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008198652_1008198655 10 Left 1008198652 6:48558520-48558542 CCAGCAGGCTTGAGACCCAAGAA 0: 6
1: 28
2: 95
3: 248
4: 512
Right 1008198655 6:48558553-48558575 TTCAGCTCAAGTTCAAAAGCTGG No data
1008198652_1008198656 11 Left 1008198652 6:48558520-48558542 CCAGCAGGCTTGAGACCCAAGAA 0: 6
1: 28
2: 95
3: 248
4: 512
Right 1008198656 6:48558554-48558576 TCAGCTCAAGTTCAAAAGCTGGG No data
1008198652_1008198657 12 Left 1008198652 6:48558520-48558542 CCAGCAGGCTTGAGACCCAAGAA 0: 6
1: 28
2: 95
3: 248
4: 512
Right 1008198657 6:48558555-48558577 CAGCTCAAGTTCAAAAGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008198652 Original CRISPR TTCTTGGGTCTCAAGCCTGC TGG (reversed) Intergenic
900330250 1:2130602-2130624 CTCCTAGGTCTCCAGCCTGCTGG - Intronic
900686673 1:3953162-3953184 ATCTTGGATCTCCAGCCTCCAGG - Intergenic
900761269 1:4472705-4472727 TTCCTGAGTCTCCAGCCTACAGG + Intergenic
900826413 1:4930774-4930796 CTCCTGGGTCTCCAGCTTGCAGG - Intergenic
900907349 1:5568878-5568900 TACCTGGGTCTCATGGCTGCTGG - Intergenic
901152877 1:7115733-7115755 TTTCTGGGTCTCAAGCCTGCTGG - Intronic
901312020 1:8276657-8276679 TTCCTGGGTCTCGAGCCTGCCGG + Intergenic
902150885 1:14442519-14442541 TTCTGGGCACCCAAGCCTGCTGG - Intergenic
902563846 1:17296792-17296814 TTCCCTGGTCTCCAGCCTGCTGG + Intergenic
902807545 1:18870416-18870438 TCCTTGGGCCTCCAGCCTGCTGG - Intronic
905038707 1:34934469-34934491 CTCCTGGTTCTCAAGCCTTCAGG + Intergenic
905664458 1:39754381-39754403 TTCCTGAGTCTCCAGCCTGCTGG - Intronic
905904684 1:41610070-41610092 TTCCTGGATCTCCAGCCTGCTGG + Intronic
906836157 1:49085413-49085435 TTCTTGGTTCTCTAGCTTGCAGG + Intronic
907485189 1:54773056-54773078 TCCCTGGGTCTCCAGCCTGCTGG - Intergenic
907577526 1:55540436-55540458 TTCCTGGGTCTGGAGCCTGCTGG + Intergenic
907712414 1:56896401-56896423 TTCCAGGGTCTCAAGCCTGCTGG - Intronic
907913017 1:58843271-58843293 TTTCTGGTTCTCAAGCCTGAAGG + Intergenic
908335757 1:63121113-63121135 TTCCTGGGTCTTCAGCTTGCAGG + Intergenic
908513091 1:64865123-64865145 TTCTTTGGTCCTAACCCTGCAGG - Intronic
908949358 1:69541005-69541027 TTCCCGGGTCTCAAGCCTACTGG - Intergenic
909228664 1:73058614-73058636 TTCTGGGGTCTGGAGCCTGGTGG + Intergenic
909251507 1:73362721-73362743 CTCCTGGGTCTCCCGCCTGCTGG + Intergenic
910287025 1:85566941-85566963 TTCATAGGTTTCAAGCCTGCTGG - Intronic
910565800 1:88641506-88641528 TTCATGGATCTCAAGCCTACTGG - Intergenic
910896109 1:92071166-92071188 TCCCTGGGTCTACAGCCTGCAGG + Intergenic
911162974 1:94700157-94700179 TTCCTTGGTCTCAAGCCTGTTGG + Intergenic
911192081 1:94958263-94958285 TCCCTGGGTCTTCAGCCTGCTGG - Intergenic
911333049 1:96547626-96547648 TTCTTGGGTCTCTAGCCTGTTGG - Intergenic
911507858 1:98775785-98775807 TTCCTAGGTCTCAAGCCTGCTGG + Intergenic
911744154 1:101420744-101420766 TTCCTGAGTCCCCAGCCTGCTGG + Intergenic
912185921 1:107275575-107275597 TTCTTGGATCTTGAGCCTGCTGG - Intronic
912555851 1:110515527-110515549 TTCCTGGGGCTTGAGCCTGCTGG + Intergenic
912632286 1:111256060-111256082 TTATTCCGTGTCAAGCCTGCTGG + Intergenic
912701147 1:111879080-111879102 TCCTTAGGTCTTGAGCCTGCTGG + Intronic
912731857 1:112114179-112114201 TCCCTGGGTCTCCAGCCTGCTGG - Intergenic
912864515 1:113245506-113245528 TCCCTGGGTCTCCAGCCTGCTGG + Intergenic
913104229 1:115596796-115596818 TTCTTGGGTCTCAAGCCTTCTGG - Intergenic
913392687 1:118331987-118332009 TCCCTGGATCTCCAGCCTGCTGG - Intergenic
914215806 1:145626843-145626865 TTCTTGTGTCTCCGGCCTCCGGG - Intronic
914467751 1:147947228-147947250 TTCTTGTGTCTCCGGCCTCCGGG - Intronic
915024161 1:152811616-152811638 TTCTTGGGTCTCTAGTCTGAAGG + Intronic
915673816 1:157512705-157512727 TTCTTGGGTCTTGAGCTTGCTGG + Intergenic
915673890 1:157513505-157513527 TTCTTGGGTCTTGAGCTTGCTGG - Exonic
915824998 1:159066213-159066235 TTCTTGGGTCTCAAACGTGAAGG + Exonic
916505753 1:165426873-165426895 TTCCTGGGTCTCAAGCCTGCTGG - Intronic
916979796 1:170121720-170121742 TCGTTGGGTCTCCAGCCTGCTGG + Intergenic
917104525 1:171478886-171478908 TCCCTGGGTCTCCAGCCTGTTGG + Intergenic
917276143 1:173333830-173333852 TTCCTGTGTCTTAAGTCTGCTGG + Intergenic
918479597 1:184964307-184964329 TTCTTGGATTTTAAGCCTTCTGG - Intronic
919150921 1:193697365-193697387 CTCCTGGGTCTCAAGGCTACTGG + Intergenic
919232124 1:194787463-194787485 TTGTTGGGTCTGAAGCTTTCAGG - Intergenic
919276480 1:195424176-195424198 TTCATGGTTCTCAGGCCTTCAGG - Intergenic
920458856 1:206122275-206122297 TCCTTGAGTCTCAAGCCTGCTGG - Intergenic
920536358 1:206739205-206739227 CTTTTGGCTGTCAAGCCTGCAGG + Intergenic
920746592 1:208634890-208634912 TTTTTGGGTTTCAAGGCTGCTGG + Intergenic
920807374 1:209247807-209247829 TTCCTGGGTCTTGAGGCTGCTGG - Intergenic
921371739 1:214430616-214430638 TCCCTGGGTCTCCAGCCTGCTGG + Intronic
921899871 1:220438907-220438929 CTCCTGGGTCTCCAGCCTGCTGG + Intergenic
922342815 1:224671083-224671105 TTCCTAGGTTTCCAGCCTGCTGG + Intronic
922489407 1:226003760-226003782 TTCTTAGTTCTCCAGTCTGCTGG - Intergenic
922956486 1:229605809-229605831 TTCCTGGGTCTCCAGCCTGCTGG + Intronic
923178394 1:231491857-231491879 CTCTTGGTTCTCAAGCCTTCAGG - Intergenic
923257838 1:232236468-232236490 TTCTTGGGTCTTGAGCCTGCTGG + Intergenic
923305557 1:232685140-232685162 TTCATGTGTCTCAGGCCTGCTGG + Intergenic
923398766 1:233595022-233595044 TCCTTGGGTCTCCAGCCTGCTGG - Intergenic
923498065 1:234542041-234542063 TCCCTGGGTCTCCAGCCTGCTGG + Intergenic
1063102827 10:2965319-2965341 TCCCTGGGTCTCCAGCCTGCTGG - Intergenic
1063246560 10:4225770-4225792 TCCATGGGTCTCCAGCCTGCTGG + Intergenic
1063288364 10:4714078-4714100 TTCCTGGGTCTCCAGTCTACTGG + Intergenic
1063539614 10:6919018-6919040 TTCCTGAGTCTCAAGCCTGCTGG - Intergenic
1063581866 10:7315453-7315475 TTCCTGGGTCTCGAGCTTGGAGG + Intronic
1063800547 10:9572625-9572647 CTCCTGGGTCTCCAGCTTGCAGG - Intergenic
1063807928 10:9668813-9668835 TTCCTGGGTCTCAAGCCTGCAGG + Intergenic
1064241923 10:13638493-13638515 TTCCTGGGTCTCCAGCTTGCGGG - Intronic
1064366810 10:14715892-14715914 TCCCTGGTTCTCCAGCCTGCAGG + Intronic
1064493358 10:15883582-15883604 TTCCTGGATCTCCAGCTTGCAGG - Intergenic
1064652494 10:17523609-17523631 TCCTTGGATCTTAAGCCTGCTGG + Intergenic
1064690678 10:17915132-17915154 TCCCTGGGTCTCCAGGCTGCTGG - Intergenic
1064940221 10:20725907-20725929 TTCTTAGGTCTCCAGCATGCTGG - Intergenic
1065155381 10:22864536-22864558 TTCTTGAGTTTCAAGCCAGCTGG - Intergenic
1065200984 10:23312943-23312965 TTCCTGGGTCTCCAGCCTGCTGG + Intronic
1065902070 10:30217199-30217221 TATCAGGGTCTCAAGCCTGCTGG + Intergenic
1066688366 10:38002612-38002634 TTCCTGGGCCTCATGCTTGCAGG + Intergenic
1067005488 10:42656959-42656981 TTCCTGCATCTCAAGCTTGCAGG - Intergenic
1067164537 10:43854908-43854930 TTCTTGATTCTCAGGCCTTCAGG + Intergenic
1067188430 10:44049831-44049853 TTCCTGCCTCTCAAGCCGGCTGG + Intergenic
1067509563 10:46883916-46883938 TCTCTGGGTCTCCAGCCTGCTGG - Intergenic
1067652691 10:48167943-48167965 TCTCTGGGTCTCCAGCCTGCTGG + Intronic
1067774050 10:49148989-49149011 TTCCTGGGTCTCTAGCCTGCTGG - Intergenic
1067962915 10:50876617-50876639 TTCTTGCGTCTCTAACCTGATGG + Intronic
1068195870 10:53715337-53715359 TTCTTGGATCTCCAGCTTGCAGG + Intergenic
1068286767 10:54948227-54948249 TTTTTAGGTCTCAAGCCTTAAGG - Intronic
1068390987 10:56396538-56396560 CTTCTGGGTCTCAAGCCTGATGG - Intergenic
1068522389 10:58092317-58092339 TTCCTGGGTCTCCTGCCTACTGG - Intergenic
1069064330 10:63926723-63926745 TTCCTGGGTCTCCAGTTTGCAGG - Intergenic
1070502791 10:77087232-77087254 TTCCTGGGTCTCCAGCTTGCTGG + Intronic
1071380812 10:85057650-85057672 TTCTTGGGTCTTAAGTCTGCTGG - Intergenic
1071387371 10:85135203-85135225 TCCTTTGGTCTCAAACCTGCTGG + Intergenic
1071473495 10:86004621-86004643 CTCCTGGGTCTCCAACCTGCTGG + Intronic
1071794189 10:88988028-88988050 TTCATGGGTCTCCAGCCTGTTGG + Intronic
1072035476 10:91559304-91559326 GTCTTGGGTTTCAAGCCTGCTGG + Intergenic
1072214968 10:93280404-93280426 TGCTGGGGTATCCAGCCTGCAGG - Intergenic
1072424096 10:95314661-95314683 TTCTTGGGCTTGAAGCCTTCAGG + Exonic
1072503227 10:96039890-96039912 TTCTTGCATCTTGAGCCTGCCGG - Intergenic
1073764431 10:106666361-106666383 TTCCTGGGTCTCAGGTCTGCTGG + Intronic
1073829074 10:107361064-107361086 TTCCGAGGTCTCCAGCCTGCTGG + Intergenic
1074540359 10:114360266-114360288 TTCTTGGGTCTCAAACCTGCAGG + Intronic
1074764351 10:116689704-116689726 CTCCTGGGTCTCCAGCTTGCTGG - Intronic
1074821498 10:117182693-117182715 TTCTTGGGTCTAAAGACTGTGGG - Intergenic
1074854896 10:117466316-117466338 TTCTTGGGTCTCAAGACTGCTGG + Intergenic
1075824965 10:125348035-125348057 TTCCTGGTTCTCAGGCCTTCAGG - Intergenic
1076421204 10:130333340-130333362 TCCCTGGGTCTCCAGCCTGTTGG - Intergenic
1076566205 10:131401136-131401158 TTCCTTGGTCTTGAGCCTGCCGG + Intergenic
1076917609 10:133432485-133432507 TTCCTGGACCTCAACCCTGCTGG + Intergenic
1076937607 10:133576560-133576582 TTCCTGGACCTCAACCCTGCTGG + Intergenic
1077359584 11:2134764-2134786 CTCTTGGTTCTCCAGCCTGGGGG - Intronic
1077417428 11:2431247-2431269 TTTTAGGGTCTCAGGCCTGAGGG - Intergenic
1077459791 11:2703265-2703287 TTCTTGGGACTCAAGGCTGCAGG + Intronic
1077610084 11:3638728-3638750 TTCTTGCTTCTCAAGGCTGCTGG + Exonic
1077709431 11:4521081-4521103 TTCCTGGGTCTCAAGCCTGTTGG + Intergenic
1077781635 11:5336408-5336430 TTCCTGGGTCTGAAGCCTGATGG + Intronic
1078077682 11:8176493-8176515 TTCCGGGGTCTCCAGCCTGTTGG + Intergenic
1078747081 11:14125946-14125968 TTCCTGGGTCTTCAGCCTACTGG - Intronic
1078806755 11:14713513-14713535 TTCCTGGGTCCCAAGCTTGCTGG + Intronic
1078893863 11:15580932-15580954 TTCCTGGGTCTCAAGTTTGCTGG - Intergenic
1079777988 11:24558288-24558310 TTCCTGGTTCTCCAGCCTGCAGG + Intronic
1080107121 11:28522358-28522380 TCTTCGGGTCTCCAGCCTGCTGG - Intergenic
1080254931 11:30280134-30280156 TTCTTGGGTCTAAAGCCCGCTGG - Intergenic
1080490751 11:32761852-32761874 TTCCTGAGTCTCTAGCCTGCTGG - Intronic
1081228234 11:40552080-40552102 TCCCTGGGTCTCCAGCCTGCAGG + Intronic
1081748066 11:45486974-45486996 TTCTTTGGTCTTCAGCCTACTGG - Intergenic
1082708382 11:56521409-56521431 TTCCTGGTTTTCCAGCCTGCAGG - Intergenic
1082877189 11:58000306-58000328 TTCCTGGCTCTCAAGCCTACTGG - Intergenic
1083251808 11:61473014-61473036 TTCCTGAGTCTCAAGCCTGCTGG + Intronic
1083980931 11:66168522-66168544 ATCTTGGGTTTCAATCCTGTTGG + Intronic
1084817982 11:71661857-71661879 GTCCTGGGTCTCCAGCTTGCTGG + Intergenic
1084895689 11:72266210-72266232 TTCCTGGGTCCTAAGCCTGGAGG + Intergenic
1084913591 11:72410790-72410812 CTCTTTGGTCTTTAGCCTGCTGG - Intronic
1085079037 11:73618760-73618782 TTCTTGAGTCTCAAACCTGCTGG + Intergenic
1085425350 11:76399795-76399817 TTTTTGGGTCTCAAGATTGCAGG + Intronic
1085631070 11:78117232-78117254 TTAATGGTTCTCAAGCCTGATGG + Intronic
1086123721 11:83328060-83328082 TCCTTCAGTCTCCAGCCTGCTGG + Intergenic
1086127538 11:83364707-83364729 TTCCTGGGTCTCCAGCTTGCAGG + Intergenic
1086242427 11:84711581-84711603 TTTTTGGGTTTTGAGCCTGCTGG - Intronic
1086457597 11:86974708-86974730 TTCCTGGGTCTCATGCCTGCTGG + Intergenic
1086466343 11:87057986-87058008 TTCTTGGGTCTACAGCCTGCTGG - Intronic
1087013054 11:93531305-93531327 TTCCTGGGTCTCAAGCCTGCTGG + Intronic
1087182884 11:95156979-95157001 TTTTTTGGTCTCAGTCCTGCTGG + Intergenic
1087264347 11:96044173-96044195 TTCTTGGGTCTCAGAAGTGCTGG + Intronic
1088100377 11:106147853-106147875 TACTTGGGTCTTGAGCCTGCTGG + Intergenic
1088361073 11:108990575-108990597 TTGTTGAGTCTTGAGCCTGCTGG + Intergenic
1088721336 11:112594723-112594745 TTCTTGGGTCTGAAGCCTACTGG + Intergenic
1088741020 11:112766789-112766811 CTTTTGGCTCTCAAGTCTGCAGG + Intergenic
1088828801 11:113517705-113517727 CTCTTGGGTCTCCAGCCTGCTGG - Intergenic
1088836289 11:113580370-113580392 TTCCTGGGTTTGAATCCTGCGGG - Intergenic
1089490666 11:118881732-118881754 TTCCTGTGTCCCAAGCTTGCTGG - Intergenic
1089766872 11:120774433-120774455 TCCTTGGGTCTCCAGCCTGCTGG - Intronic
1089860640 11:121587294-121587316 TCCCTGGGTCTCCAGCCTGCTGG - Intronic
1090568603 11:128022721-128022743 TTCCAGGGTCTCCAGCCTGCAGG + Intergenic
1090629725 11:128635592-128635614 CTCTTAGGTCTCCAGCCGGCAGG - Intergenic
1090929496 11:131282561-131282583 CTCCTGGGTCTCCAGCTTGCTGG + Intergenic
1091191101 11:133695872-133695894 TTCTTGGGTTTTGAGCCTGCTGG + Intergenic
1091229670 11:133980082-133980104 TGCCTGGGTCTCCAGCCTGTTGG - Intergenic
1091231385 11:133990089-133990111 CTCCTGGGTCTCAAGCCTGCTGG + Intergenic
1091232071 11:133994874-133994896 TCCCTGGGTCTCTAGCCTGCTGG - Intergenic
1092096541 12:5847274-5847296 TTCTTGGGTCTTGAGGCTGCTGG + Intronic
1092424961 12:8367506-8367528 GTCCTGGGTCTCCAGCTTGCTGG - Intergenic
1092651635 12:10641342-10641364 TTCTTTGGTATTCAGCCTGCTGG + Intronic
1092749992 12:11709825-11709847 TCTCTGGGTCTCCAGCCTGCTGG + Intronic
1093017180 12:14166323-14166345 TCCCTGGGTCTCCAGCCTGCTGG + Intergenic
1093330413 12:17830051-17830073 CTCCTGCATCTCAAGCCTGCTGG + Intergenic
1094309973 12:29069512-29069534 TCCCTGGGTCTCCAGCCTGATGG - Intergenic
1094736413 12:33239916-33239938 TCCCTGAGTCTCCAGCCTGCTGG - Intergenic
1095210327 12:39486355-39486377 TGCCTGGGTTTCCAGCCTGCAGG + Intergenic
1096831913 12:54321251-54321273 TTCTTAGCTCTCCAGCCTGTTGG - Intronic
1097056879 12:56255690-56255712 TTCTGGGCCCTCAAGCCTGAAGG - Intronic
1097308757 12:58096250-58096272 TTCCTGGGTCTCCAGCCTGATGG + Intergenic
1097621932 12:61949295-61949317 TTCTTGGGTTTCAAGTTTGCTGG + Intronic
1098092410 12:66918203-66918225 CTCTTGGGTCTTAAGCCTGCAGG - Intergenic
1098143934 12:67479439-67479461 TTCCTGGGTCTCTAGCCTGCTGG + Intergenic
1098290205 12:68950919-68950941 TGCTTGGGTCTGCAGTCTGCAGG - Intronic
1098875920 12:75866546-75866568 TTCCTGGGTCTCAAGGCTGCTGG + Intergenic
1099059559 12:77889385-77889407 TTCCTGAGTCTCTAGCTTGCTGG + Intronic
1099174356 12:79403365-79403387 TTCCTGGGTCTCCAGTCTACTGG - Intronic
1099326826 12:81227098-81227120 TTCCTGGGTCTTCAGCCTGCTGG - Intronic
1099890819 12:88586489-88586511 TTCTTGGGTCTGAAGGATGGTGG + Intergenic
1100037873 12:90275615-90275637 TTCATGGGTCTTGAACCTGCTGG - Intergenic
1100198428 12:92273251-92273273 TCCCTGAGTCTCCAGCCTGCTGG + Intergenic
1100369549 12:93955021-93955043 CCCTTGGGTCTCAAGCCTGCTGG + Intergenic
1100378422 12:94039275-94039297 TCCCTGGGTCTCCAGCCTGCTGG - Intergenic
1100906077 12:99300978-99301000 TTCCTGGTTCTCCAGCTTGCTGG - Intronic
1100957628 12:99926532-99926554 TTCCTGGGTCTCAGGCCTGCTGG + Intronic
1101023203 12:100573909-100573931 TTGTTGGGTCTCCCGGCTGCGGG + Intronic
1101205973 12:102487468-102487490 TCCCTGGTTCTCCAGCCTGCTGG - Intergenic
1101827038 12:108228494-108228516 TTCTTGGCTCTCCAGACTGTGGG - Intronic
1102210919 12:111126462-111126484 TTCCTGGTTCTTGAGCCTGCTGG - Intronic
1102261705 12:111447118-111447140 TTCTGTGCTCTCCAGCCTGCTGG - Exonic
1103220504 12:119240420-119240442 TTCTTGCATCTCAAGCATGCTGG + Intergenic
1103237917 12:119389483-119389505 AACTTGGGGCTCAACCCTGCTGG - Intronic
1103278488 12:119734037-119734059 TTCCTGGGTCACAAGCCTCCTGG - Intronic
1105402866 13:20110993-20111015 TTCCTGGGTTTGAAGCCTACCGG + Intergenic
1106051869 13:26198238-26198260 TTCCTGGGTCTCTATCCTGCTGG - Intronic
1106105305 13:26727958-26727980 CTCATGGGTCTCAAACCTGTTGG - Intergenic
1106551425 13:30774687-30774709 TTCTTGGTTCTCCAGGTTGCAGG - Intergenic
1106864631 13:33949927-33949949 ATCCTGGGTCTCAAGCCTGCTGG + Intronic
1107338743 13:39383614-39383636 TTCTTAGGCCTTAAGCCTGATGG + Intronic
1107658275 13:42613847-42613869 TTCCTGGGCCTCCAGCTTGCAGG - Intergenic
1107807096 13:44163529-44163551 TTCTTGGGTCTCCAGCTTGCAGG + Intergenic
1108258050 13:48629491-48629513 TTCCTGATTCTCCAGCCTGCCGG - Intergenic
1108515928 13:51202589-51202611 TCCTTGGGTCACCAGCCTGTAGG - Intergenic
1108521906 13:51253858-51253880 ATCTTGGGACTCAGGCATGCAGG + Intronic
1108769491 13:53681133-53681155 TTCTTGGGTCTGCAGCCTGTTGG + Intergenic
1109272849 13:60273510-60273532 TTCCTGGGTCTTTAGCTTGCAGG + Intergenic
1109875102 13:68391918-68391940 TTCTTGGGTCTCTAACCTGCAGG + Intergenic
1110233191 13:73188003-73188025 TCTCTGGGTCTCCAGCCTGCTGG + Intergenic
1110898692 13:80792012-80792034 TTCTTGGTTCTCAAGCCTGCTGG + Intergenic
1111179520 13:84644765-84644787 ATATTGGTTCACAAGCCTGCAGG - Intergenic
1112193177 13:97198326-97198348 TTCCTAGGTCTCAAGCCTGTTGG + Intergenic
1112239393 13:97666256-97666278 TTCCTGGGTCTTCAGCTTGCAGG - Intergenic
1112819816 13:103319189-103319211 TTCCTGGGTCCCAAGCTTGTAGG + Intergenic
1112852513 13:103723991-103724013 TTCTTGGATCTCAAGCCCACTGG - Intergenic
1113505805 13:110814912-110814934 TCCTGGGGTCTCCAGCCTGCTGG + Intergenic
1113574659 13:111386537-111386559 TCCCTGGGTTTCCAGCCTGCCGG - Intergenic
1113684789 13:112275411-112275433 TTCCTGGGTCTCCAGCCTGCTGG + Intergenic
1114149449 14:20020537-20020559 CTCCTGGGTCTCCAGCCGGCAGG + Intergenic
1114584438 14:23797216-23797238 TTCCTGGGTCTCCAGCCTCCTGG + Intergenic
1115689178 14:35826203-35826225 TTCGTAGGTCTCAGACCTGCAGG - Intergenic
1115971292 14:38947562-38947584 TTCCTGGCTCTCCAGCCTGCTGG + Intergenic
1116278757 14:42873210-42873232 TTCCTGGTTCTCCAGCTTGCAGG + Intergenic
1117534341 14:56689394-56689416 TTCTGGAGACTCAAGCCTACCGG + Intronic
1117662374 14:58020968-58020990 TTCCTGGGTTTTGAGCCTGCAGG - Intronic
1117756982 14:58985212-58985234 TTCCTGGGTCTTGAGACTGCCGG + Intergenic
1117905161 14:60577167-60577189 TTCTTGGATCTTGAGCATGCTGG + Intergenic
1118273837 14:64367692-64367714 TTCCTGGGTCTTGAGCCTGCTGG - Intergenic
1118885829 14:69865261-69865283 TGCCTGGGTCTCAAACCTGCTGG - Intronic
1119032249 14:71201932-71201954 TTCCTGAGTCTCAGGCCTGCTGG - Intergenic
1119093241 14:71804480-71804502 TTCTGGGTTCTGAAGCCAGCTGG - Intergenic
1119529000 14:75346190-75346212 TTTCTGGGTCTTGAGCCTGCAGG + Intergenic
1119850725 14:77864795-77864817 TTCCTGGGTCTCCAGCCTGCTGG - Intronic
1120056604 14:79931560-79931582 TTTCTGGGGCTCCAGCCTGCTGG - Intergenic
1120086350 14:80278563-80278585 TTCTTGGGTCTTGAGGCTGCTGG - Intronic
1120263597 14:82220161-82220183 TTCCTGAGTCTCAAGACTTCTGG + Intergenic
1120533284 14:85660617-85660639 TTTTTGAGTCTCAAGACTGCTGG - Intergenic
1120628056 14:86854112-86854134 TTCTTGGGTCACAGGCCTACTGG - Intergenic
1120643042 14:87038485-87038507 TTTCTGGGTCTCCAGCTTGCAGG + Intergenic
1121696899 14:95920987-95921009 TTCCTGGGCCTTGAGCCTGCAGG - Intergenic
1121974382 14:98389504-98389526 TTCCTGGGTCTCAAGACTAGTGG + Intergenic
1121990120 14:98549066-98549088 TCCCTGGGTCTCCAGCCTGATGG - Intergenic
1122021114 14:98838835-98838857 CTCTTGGGTCTCAGCCCTGCAGG - Intergenic
1122436207 14:101702007-101702029 TTCTTAGGTCTTGAGGCTGCTGG + Intergenic
1122566840 14:102664615-102664637 TTCTTGGTTCTCAAACTTGTCGG + Intronic
1122751252 14:103935099-103935121 TTCCTGGGTCTCCAGCTAGCTGG + Intronic
1122866493 14:104607264-104607286 TTCCTGGGTCTCCAGCCTGCTGG - Intergenic
1124395394 15:29296093-29296115 TCCCTGGGTCTCCAGTCTGCTGG + Intronic
1124479090 15:30062133-30062155 TCCTTGGGTCTCCAGTCTGCTGG - Intergenic
1124650595 15:31470914-31470936 TTCCTGGGCCTCCAGCTTGCAGG - Intergenic
1124706017 15:31964936-31964958 TTTTTGGATTTCAAACCTGCTGG - Intergenic
1124989587 15:34658333-34658355 TCCCTGGGTCTCCAGCCTGCTGG - Intergenic
1125164071 15:36682245-36682267 TTCCTGTGTCTCAAGCCTGCTGG - Intronic
1125611241 15:40972312-40972334 TTTCTGGATTTCAAGCCTGCTGG - Intergenic
1126565519 15:50094337-50094359 TTCCTGGGTCTCAAGCCTGCTGG + Intronic
1127184183 15:56460977-56460999 TTTCTGGGTCTTGAGCCTGCTGG - Intronic
1127209802 15:56761821-56761843 TCCCTAGGTCTCCAGCCTGCCGG + Intronic
1127375423 15:58380337-58380359 TTTTTGGGTCTCAAGCCTGCTGG - Intronic
1127795125 15:62431190-62431212 GTCCTTGGTCACAAGCCTGCTGG + Intronic
1128100702 15:64997346-64997368 ATCATAGGTCTCGAGCCTGCTGG - Intergenic
1128990424 15:72255195-72255217 TTCTTGGATGTTAAGCCTTCAGG + Intronic
1129876091 15:78976731-78976753 TTGTTGGGTGTCTTGCCTGCAGG - Intronic
1133104480 16:3498024-3498046 TTCCTGGTTCTCCAGCTTGCAGG - Intergenic
1133191258 16:4135270-4135292 TCCCTGAGTCTCCAGCCTGCTGG + Intergenic
1133373276 16:5262524-5262546 GTCCTGGGTCTCCAGCTTGCTGG + Intergenic
1134572989 16:15307478-15307500 TTTCTGGATCTCAAGCCTGCTGG + Intergenic
1134729395 16:16448504-16448526 TTTCTGGATCTCAAGCCTGCTGG - Intergenic
1134938039 16:18263346-18263368 TTTCTGGATCTCAAGCCTGCTGG + Intergenic
1135912751 16:26576560-26576582 TTCTTGGGTCTCCAGTTTGCAGG - Intergenic
1137269715 16:46895188-46895210 CTTTTGTCTCTCAAGCCTGCTGG + Intronic
1137704564 16:50525673-50525695 TTCCTGTGTCTCTAACCTGCAGG - Intergenic
1137888355 16:52131049-52131071 TTCTTGTGTCTCAAGCCTGCCGG + Intergenic
1138223533 16:55273217-55273239 TTCCTGGGTCACAGGCATGCTGG + Intergenic
1138976740 16:62216837-62216859 TTCCTGGGTCTCGAGCCTGCAGG - Intergenic
1141565567 16:84899525-84899547 TTCTTGGTGCCCAAACCTGCGGG + Intronic
1141598167 16:85110035-85110057 TCCTAGGCTCTCAATCCTGCAGG + Intronic
1141940825 16:87274899-87274921 TGCCTGGGTTTCCAGCCTGCCGG - Intronic
1142023530 16:87799768-87799790 TTCCTGGGTCTCAAGCCTGTGGG + Intergenic
1142023545 16:87799869-87799891 GTCCTGGGTCTCAAGCCTGTGGG + Intergenic
1142773068 17:2113746-2113768 GTGTTGGGTCTCAACCCTGTAGG - Intronic
1143443635 17:6995116-6995138 TTCATGGGTCTCAGGTCTCCTGG - Intronic
1143532924 17:7516180-7516202 TTCTTGGGTCTTTAGACTCCAGG - Intergenic
1144289957 17:13816747-13816769 CTCCTGAGTCTCCAGCCTGCTGG - Intergenic
1144477749 17:15603305-15603327 CTCCTGGGTCTCCAGCCTGCTGG + Intronic
1144625329 17:16841465-16841487 CTCTGGGGTCTCTAGCCTGATGG - Intergenic
1144920545 17:18760378-18760400 CTCCTGGGTCTCCAGCCTGCTGG - Intronic
1145125797 17:20299079-20299101 TCCCTGAGTCTCCAGCCTGCTGG - Intronic
1145199326 17:20927836-20927858 TTCCTGGGTCTTCAGCCCGCCGG + Intergenic
1146694654 17:34899251-34899273 TTCCTGGGTCTCAAGCCTGCAGG + Intergenic
1146904859 17:36611754-36611776 TTCCTGGATCTCAAGCGTGCTGG + Intergenic
1150381724 17:64726070-64726092 TTCCTGGGTATCCAGCCTGCTGG - Intergenic
1150774541 17:68068820-68068842 TTCCTGGGTATCCAGCCTGCTGG + Intergenic
1151092834 17:71462357-71462379 TTCCTCAGTCTCGAGCCTGCTGG - Intergenic
1151121095 17:71793854-71793876 TTCCTAGGTCTCGAGCTTGCTGG + Intergenic
1151342677 17:73481829-73481851 TTCTTGGGTTTCCAGCTTGCAGG + Intronic
1152371115 17:79889163-79889185 TCCCTGGGTCTCCAGCTTGCAGG + Intergenic
1152991211 18:365570-365592 TGCTTGTGGCTCAAGCTTGCAGG + Intronic
1153093854 18:1379054-1379076 TTCCTGGGTCTCCAGCCCACTGG - Intergenic
1153277608 18:3383394-3383416 TTCTTGGGTCTAAATCTTCCGGG - Intergenic
1154385412 18:13887782-13887804 CTCTTAGGTCTCACGTCTGCTGG + Intronic
1155711346 18:28884302-28884324 CTCTTGGTTCTCCAGCCTGTTGG + Intergenic
1155889520 18:31249236-31249258 TTCCTTGGTCTCAAGTCTGCTGG - Intergenic
1155981520 18:32185113-32185135 TGCCTGGGTCTTTAGCCTGCTGG + Intronic
1156123011 18:33867838-33867860 TTCTTGGGCCTTGAGCCTCCTGG - Intronic
1156269564 18:35518301-35518323 TTCATGGGTCTCAAGTCTGCCGG + Intergenic
1157405356 18:47418273-47418295 TTCATGGGTCTCGAGCCTGCTGG - Intergenic
1157675111 18:49562752-49562774 TTCTTGCCTCTCAAACCTCCAGG - Intronic
1157745045 18:50127964-50127986 TTTCCAGGTCTCAAGCCTGCTGG + Intronic
1157892024 18:51426889-51426911 ATTTTGGGTCACAATCCTGCAGG - Intergenic
1158141548 18:54261283-54261305 TTCCTGGTTCTCAGGCCTTCTGG + Intergenic
1159354243 18:67316588-67316610 TTCTTGGGGCTGAAGGGTGCAGG + Intergenic
1159749461 18:72282301-72282323 TCTTTGGGTCTCCAGCTTGCTGG + Intergenic
1160740593 19:683685-683707 TTTCTGGGTCCCAAGCCAGCTGG - Intergenic
1161119901 19:2519788-2519810 TCCCTGGGTCTCCAGCCTGCTGG + Intronic
1161122162 19:2534768-2534790 CTCTTGGGTCTCAAGCCTGCTGG - Intronic
1161291263 19:3494545-3494567 TTCTGGAGTCTCCAGCCGGCAGG - Intronic
1163293255 19:16394461-16394483 AGCTTGGGTTTGAAGCCTGCCGG - Intronic
1164813158 19:31174244-31174266 TTCTTGGGTCTCGAGCCTTCTGG - Intergenic
1164848610 19:31459603-31459625 TCCTCAAGTCTCAAGCCTGCTGG - Intergenic
1164911596 19:32016862-32016884 TGGGTGGGTCTCCAGCCTGCAGG - Intergenic
1165151918 19:33766043-33766065 TCCCTGGGTCTCCGGCCTGCTGG + Intronic
1165560309 19:36673571-36673593 TTTCTGGGTCTTCAGCCTGCTGG + Intergenic
1165860698 19:38907709-38907731 TTCTTGGGCTTCTTGCCTGCCGG - Intronic
1165904879 19:39187644-39187666 GTCCTGGGGCCCAAGCCTGCTGG - Intergenic
1167527132 19:49991380-49991402 TTCTTGGGTCTCAGGCCTGCTGG + Intronic
925019579 2:558073-558095 CTCGTGGGTCTCCAGCCTCCTGG + Intergenic
925094756 2:1187467-1187489 TTCCTGGGGCTCCAGCCTGCTGG + Intronic
925511123 2:4626408-4626430 TTCCTGCGTCTCCAACCTGCTGG - Intergenic
925961501 2:9021515-9021537 TCCCTGGGTCTCAAGCTTGAGGG - Intergenic
926035889 2:9635323-9635345 CTCCTGGGTCTACAGCCTGCTGG + Intergenic
926245339 2:11119000-11119022 TTCTTGGGCCTCTTGCCTGCTGG - Intergenic
926356785 2:12047954-12047976 TTCCTGTGTCTCTAGCCTGCTGG + Intergenic
926384679 2:12324554-12324576 TCCCTGGGTCTCCAGCCTGCTGG - Intergenic
926442111 2:12900485-12900507 TTGCTGGGTCTCCAGCCTGCTGG + Intergenic
926915285 2:17885518-17885540 CTCCTGGGTTTCCAGCCTGCTGG - Intronic
927400445 2:22704301-22704323 TTCTTGGGCCTCAAGGCTGCTGG - Intergenic
927506514 2:23618564-23618586 TTCTTGGGTCTCAAGCCTGCAGG + Intronic
927737049 2:25533773-25533795 TTCTCATCTCTCAAGCCTGCTGG + Intronic
927991667 2:27452305-27452327 TTCTTGGGTCTCAAGCTTGCTGG + Intronic
928376823 2:30781702-30781724 TTCCTGGGTCTCCAGATTGCAGG + Intronic
928413126 2:31069687-31069709 CTTTTGGGTGTCAAGCCTCCAGG - Intronic
928673912 2:33631715-33631737 TCCCTGGGTCTCCAGCCTGCTGG - Intergenic
928712607 2:34024152-34024174 TTCTCGGGTCTCCAGCTCGCAGG + Intergenic
929113359 2:38423836-38423858 TTCTTGGGTCTCAAGCCTACTGG + Intergenic
929386178 2:41409854-41409876 TCCCTGGGTCTCTAGCCTACTGG + Intergenic
931195100 2:60044904-60044926 TTCTTAGGTCTTGAGCCTGCTGG + Intergenic
931660663 2:64559471-64559493 TTCTTAGATCTTAAGCCTGCTGG - Intronic
931707199 2:64956769-64956791 TTCCTGGGTCTCCAGCCTGGTGG + Intergenic
931869768 2:66445427-66445449 TTCTCCGGTCTGGAGCCTGCTGG + Intronic
932199743 2:69814937-69814959 TTCATGGGTTTCCAGCCTGCTGG - Intronic
932400665 2:71478996-71479018 TGCTTGGCTCTAAAGCCTACTGG + Intronic
932510991 2:72290060-72290082 TTCCTGGGTCTCAAGCCTGCTGG + Intronic
932747287 2:74344460-74344482 TTCCTGGATCTAGAGCCTGCTGG + Intronic
932855582 2:75230618-75230640 TTCCTGAGTCTCCAGCCTGCTGG + Intergenic
932915735 2:75856058-75856080 TTCTGGGGTCTCAAGGTTGGTGG - Intergenic
933205252 2:79499917-79499939 GTCCTGGGTCTCCAGGCTGCTGG - Intronic
933405563 2:81853701-81853723 TTCTTGGATATCGAGGCTGCTGG - Intergenic
934675335 2:96245870-96245892 TTCCTGGATCTTCAGCCTGCTGG + Intergenic
934965775 2:98720515-98720537 TTCCTGGTTCTCCAGCTTGCAGG + Intronic
935095334 2:99938731-99938753 TCCCTGGGTGTCTAGCCTGCTGG + Intronic
935803010 2:106717406-106717428 TTCCTGGGTCTCCAGCTAGCAGG - Intergenic
935846703 2:107173774-107173796 CTCTAGGGTATCCAGCCTGCTGG - Intergenic
936026964 2:109039202-109039224 CCCCTGGGTCTCCAGCCTGCTGG + Intergenic
936125485 2:109786094-109786116 TTCCTGGTTCTCCAGCTTGCAGG + Intergenic
936219208 2:110585374-110585396 TTCCTGGTTCTCCAGCTTGCAGG - Intergenic
936897387 2:117444085-117444107 TTCTTGAGTCTTGAGCCTGCTGG - Intergenic
937044492 2:118843962-118843984 TTCTAGGGTCTCAGGGATGCAGG + Intronic
937571752 2:123371576-123371598 TTCTTGGGTCTCACGCATGCTGG - Intergenic
937824890 2:126357689-126357711 TTGTTGGATCTCAAGCCTGCTGG + Intergenic
937840770 2:126522243-126522265 TTCTTGAGTCTGGAGCCTGCTGG - Intergenic
937863976 2:126734073-126734095 TCCTTGGGTCTCTGGCCTTCTGG + Intergenic
938251971 2:129822403-129822425 TTCCTGGCTCTCCAGCCTGCTGG + Intergenic
938340917 2:130535921-130535943 TCCTTGAGTCTCTAGCCTGCTGG + Intergenic
938348913 2:130584788-130584810 TCCTTGAGTCTCTAGCCTGCTGG - Intergenic
938592471 2:132752785-132752807 CTCCTGGGTCTCCAGCTTGCTGG - Intronic
938592477 2:132752836-132752858 TTCATGGGTCTTGAGCTTGCTGG - Intronic
938929225 2:136071729-136071751 TCCCTGGGTCTCCAGCCTACAGG - Intergenic
939074070 2:137579365-137579387 TTCTTGGGTATAAAGCCAGCAGG + Intronic
939109154 2:137986405-137986427 TTGTTGAGTCTCAAGCCTTCAGG - Intronic
939386224 2:141502428-141502450 TTGTTAGGTCTCAAGTATGCTGG - Intronic
940718457 2:157255980-157256002 TTCCTGGTTCTCCAGCTTGCAGG - Intergenic
941065734 2:160900533-160900555 TTCCTGGATCTTAAGCCTGCTGG - Intergenic
941675354 2:168338108-168338130 TTCTGGACTCTCAAGCCTGCTGG - Intergenic
942059705 2:172216848-172216870 TTTCTGGGTCTCAAGCCTGCCGG - Intergenic
943817912 2:192279307-192279329 TTCTTGGTTCTCAGAACTGCTGG + Intergenic
944047362 2:195428427-195428449 TCCTTGGGTCTCCAGATTGCTGG + Intergenic
944869818 2:203898797-203898819 TTCATGTGTCTTCAGCCTGCTGG + Intergenic
945785518 2:214230916-214230938 ATCTTGGGTCTCAAAGCTGTTGG + Intronic
946053553 2:216882899-216882921 TTCTTGGGTCTCCTTCCAGCTGG + Intergenic
946113628 2:217442677-217442699 GTCCTGCATCTCAAGCCTGCTGG - Intronic
946140841 2:217689348-217689370 CTCCTGGGTCTCCAGTCTGCTGG + Intronic
946530577 2:220565820-220565842 TTCTTGGTTGTCAAGCCTCTTGG - Intergenic
946873228 2:224103758-224103780 TTCCTGGGTCTCAAGCCTGCCGG - Intergenic
947036937 2:225870007-225870029 TTTTTGGGTCTCAAGCCTGATGG - Intergenic
947104994 2:226660168-226660190 TCCCTGGGTCTCCAGCCTGCCGG - Intergenic
947338668 2:229114049-229114071 TCCCTGGGTCTCCAGCCTGCTGG + Intronic
948088877 2:235274117-235274139 TTCCTAGGTCTTGAGCCTGCTGG + Intergenic
948099360 2:235361078-235361100 CTCCTGGGTCTCCAGCCTGACGG + Intergenic
948533339 2:238627811-238627833 TTCCTGGGTCTCCAGCCTGCAGG + Intergenic
948571650 2:238921562-238921584 TTCCCAGGTCTCCAGCCTGCCGG + Intergenic
948742837 2:240059141-240059163 TTCTTGGGTCTCACGCAGGAAGG + Intergenic
1169034691 20:2440006-2440028 TTCCTGGATCTCAAGCCTGCTGG - Intergenic
1169415642 20:5413730-5413752 TTCCTGGGTCTCAAGCCTGCTGG + Intergenic
1169627132 20:7583548-7583570 CTCCTGGGTTTCAAGCCTGCAGG - Intergenic
1170043190 20:12059825-12059847 TTCTTGTGTCTCCAGCTTGCCGG + Intergenic
1170167132 20:13372402-13372424 CTCCTGAGTCTCAAGTCTGCTGG + Intergenic
1170246182 20:14223937-14223959 TTCTCAGGTCTCCAGCCTGCTGG - Intronic
1170433294 20:16297044-16297066 TTCTTGGGACTTGAGCCTGCTGG + Intronic
1170990601 20:21298596-21298618 TCCCTGGGTCTCCAGCCTGCTGG - Intergenic
1171379905 20:24726862-24726884 TGCCTGGGTCTCCAGACTGCCGG - Intergenic
1171453571 20:25253198-25253220 TGCCTGGGTCTCCAGCCTGCTGG + Intronic
1172760689 20:37319154-37319176 TTCTTGGGTTTCCAGCTTGCAGG - Intergenic
1172996730 20:39076082-39076104 TTCCTGGGTCTCAAGCCTGCTGG + Intergenic
1173896527 20:46555225-46555247 TTCTTGGCTCTCCAGCCTCCTGG + Intergenic
1174138940 20:48399381-48399403 GCCCTGGGTCTCCAGCCTGCTGG + Intergenic
1174140683 20:48411422-48411444 TTCTTTGGTCATGAGCCTGCTGG - Intergenic
1174199876 20:48799756-48799778 TTCTTGGGTTTCAACCCAGCTGG - Intronic
1174309677 20:49642183-49642205 TTCCTGGGTCTGGAGCCTGCAGG + Intronic
1175065425 20:56282367-56282389 TCCCTGGGTCTCCAGCCTGTTGG - Intergenic
1175634372 20:60568385-60568407 TTCCTGAGTCTCCAGCCTGCTGG + Intergenic
1175963610 20:62649182-62649204 TTCTTGGGTCTTCAGCCTTCAGG - Intronic
1176384940 21:6134581-6134603 CTCTTGGATCCCAAGCCTCCAGG - Intergenic
1176587449 21:8602060-8602082 TTCCTGGGTCTCCAGCTTGCTGG - Intergenic
1176666971 21:9696767-9696789 TTCCTGGGTCTGCAGCCTGCTGG - Intergenic
1177151343 21:17458452-17458474 TTCCTGGGTCTTCAGCCAGCTGG - Intergenic
1177168372 21:17628430-17628452 TTCCTGGGTCTCAAGCCCGCCGG - Intergenic
1177407655 21:20691272-20691294 CTCTTGGGTCTGTAGCCTGCAGG + Intergenic
1177892496 21:26823356-26823378 TTCTTGGCTCTCAAACTTGAAGG - Intergenic
1177915067 21:27079193-27079215 TCCCTGGGTCTAAAGTCTGCAGG + Intergenic
1177972434 21:27807348-27807370 TGCCTGGGTTTCCAGCCTGCAGG + Intergenic
1178388772 21:32181296-32181318 TTCCTGGGTCTCCAGCTTGCAGG + Intergenic
1178424657 21:32469659-32469681 TTCCTGGGTCTCCAGCCTGCCGG - Intronic
1178473422 21:32915964-32915986 TTCCTGGGTCTGGAGGCTGCTGG - Intergenic
1178511965 21:33212852-33212874 CCCCTGGGTCTCCAGCCTGCTGG - Intergenic
1178522471 21:33297972-33297994 TACCTGGGTCTCTAGCCTGTTGG - Intergenic
1178907052 21:36645282-36645304 TCCCTGGGTCTCTAGCCTGCTGG + Intergenic
1179065392 21:38019977-38019999 TTCTTGGGTCAGGAGCCTGGAGG + Intronic
1179082285 21:38182658-38182680 TTCCTGGGTCTCCAGCCTGCTGG - Intronic
1179531870 21:42025098-42025120 TTCCTGGGTCTCCAGCGTGCCGG - Intergenic
1179738532 21:43403671-43403693 CTCTTGGATCCCAAGCCTCCAGG + Intergenic
1179767546 21:43584316-43584338 CTCTTGGGTCTCGAGCCTGCTGG - Intronic
1180270280 22:10579057-10579079 TTCCTGGGTCTCCAGCTTGCTGG - Intergenic
1181504815 22:23346023-23346045 TCCTTGGGTCTAAAGCCTGCTGG - Intergenic
1181655927 22:24298625-24298647 TCCTTGGGTCTAAAGCCTGCTGG - Intronic
1181709803 22:24676267-24676289 TCCTTGGGTCTAAAGCCTGCTGG - Intergenic
1181929404 22:26387920-26387942 TTCTTGTGTCTTATGCCTGCTGG - Intergenic
1182406645 22:30139089-30139111 CTCCTGGGTCTCTAGCCTGTTGG + Intronic
1182406653 22:30139140-30139162 TTCCTGGGTCTCATGCCTGCTGG + Intronic
1182871950 22:33655396-33655418 TTCCTGGGTCTCGAGCCTGTTGG + Intronic
1182962563 22:34489259-34489281 TCCCTGGGTCTCCAGGCTGCTGG + Intergenic
1183103666 22:35599443-35599465 TCCCTGGGTCTCCAGCCTCCCGG - Intergenic
1183528150 22:38336316-38336338 TTCGTGGTTCTCATGCTTGCGGG + Intronic
1184387927 22:44186793-44186815 TTCTGGGGGCTCAAGCCTGCTGG + Intronic
1184424689 22:44402617-44402639 TGCCTGCGTCTCAGGCCTGCAGG + Intergenic
1184541512 22:45128690-45128712 ATCCTGGGTCTCCAGCCTGCTGG - Intergenic
1184898243 22:47424960-47424982 TTCCCCGGTCTCCAGCCTGCTGG + Intergenic
949139910 3:619693-619715 TTCCTGGGTCTCCAGCTTGCTGG + Intergenic
949181891 3:1142018-1142040 TCATTGTCTCTCAAGCCTGCCGG + Intronic
949666789 3:6348374-6348396 TTCCTGGGTCTCCAGCTTGCAGG - Intergenic
949672110 3:6410861-6410883 TTCCTGAGTCTCCAGTCTGCTGG - Intergenic
949826619 3:8172401-8172423 TCCCTGGGTCTCCAGCCTGCTGG + Intergenic
950307739 3:11929270-11929292 TTCCTGGGTCTCAAGCCTGCTGG + Intergenic
950337701 3:12211162-12211184 TTAGTGGGTCTCAAGCCTGCTGG + Intergenic
950445238 3:13033649-13033671 TTCTTGGGTCTCAAGCCTGCTGG - Intronic
951745152 3:25970294-25970316 TTCCTGGGTCTTGAGCATGCTGG + Intergenic
951887871 3:27541411-27541433 TTCCTGGGTCTTGAGCCTGCTGG + Intergenic
951987728 3:28639620-28639642 TTCCTGAGTTTCTAGCCTGCTGG - Intergenic
952699044 3:36306004-36306026 TTTCTGGGTCTCCAGCCTGCAGG - Intergenic
952733899 3:36668888-36668910 TTCCTGGGTCTTCAGCTTGCAGG - Intergenic
953072965 3:39541468-39541490 TTTTGGGGTCTCAAGACTACTGG - Intergenic
953096798 3:39784962-39784984 TTCCTGGGCCTTAAGCCTGCTGG - Intergenic
953260961 3:41338820-41338842 TTCCTGGTTCTCAGGCCTTCAGG - Intronic
953547753 3:43876180-43876202 TCCCTGGGTCTCCAGCCTGCTGG - Intergenic
953937695 3:47060026-47060048 TTCCTGGGTCTCGAGGCTGGTGG - Intronic
954164588 3:48746036-48746058 TTCCTGGGTCTTGAGCCTGCTGG + Intronic
955318344 3:57957257-57957279 TCCCTGGGTCTCAAGCCTCTGGG - Intergenic
955488051 3:59454656-59454678 ATCCTGGGGCTCCAGCCTGCTGG + Intergenic
955663595 3:61327271-61327293 TTCCTGGGTCTCAGGCCTTTGGG - Intergenic
955703745 3:61707429-61707451 TTCCTGGGTCTTCAGCCTGCTGG - Intronic
956047973 3:65216685-65216707 TCCCTGGGTCTCTAGCCTGCCGG + Intergenic
957068975 3:75550612-75550634 GTCCTGGGTCTCCAGCTTGCTGG - Intergenic
957599721 3:82318967-82318989 TTCTTGGGTCTCAAGACTGCAGG - Intergenic
957612987 3:82492779-82492801 TTCCTGGGTCTCCAGCTTGTAGG - Intergenic
957630324 3:82709734-82709756 TTCTTGATTCTCAAGCCTTCAGG + Intergenic
957910405 3:86613936-86613958 TTCCTGGTTCTCAGGCCTTCTGG - Intergenic
958065050 3:88534110-88534132 TTCCTGGGTCTCTAGCCTGTAGG + Intergenic
958561210 3:95748984-95749006 TCCCTGGGTCTCCAGTCTGCCGG - Intergenic
958841070 3:99205921-99205943 TCCCTGAGTCTCCAGCCTGCTGG - Intergenic
958856949 3:99397028-99397050 TTCCTGGTTCTCCAGCCTGCAGG - Intergenic
960280087 3:115771588-115771610 CTCCTGAGTCTCCAGCCTGCTGG + Intergenic
960613363 3:119574799-119574821 TTCCTGGGTCTTTAGCCTGCTGG - Intergenic
960828817 3:121822084-121822106 TTCATGGATCTCGAGTCTGCTGG + Intronic
961284437 3:125789720-125789742 GTCCTGGGTCTCCAGCTTGCTGG + Intergenic
961336334 3:126181901-126181923 TTCTTTAGGCTCCAGCCTGCAGG + Intronic
962082083 3:132150433-132150455 TCCCTGGGTCTCCAGCCTGTTGG + Intronic
962090081 3:132234052-132234074 TTCTTGGGTCTTGAGCCTGCTGG + Intronic
963093536 3:141510480-141510502 TTCTTGGGCCTCAAGAATGAGGG + Intronic
963489549 3:145982291-145982313 TTTCTGAGTCTCAAGCCTGTTGG + Intergenic
963990708 3:151650204-151650226 TCCCTGGGTCTCCGGCCTGCTGG + Intergenic
964073747 3:152667548-152667570 TCTCTGGGTCTCCAGCCTGCTGG + Intergenic
965185749 3:165460473-165460495 TTCCCGGCTCTCAAGCCTGCTGG + Intergenic
965206544 3:165725265-165725287 TTCTTTGGTCTCGGGCCTGCTGG + Intergenic
965319792 3:167239104-167239126 TCCCTGGGTCTCCAGCCTGCAGG - Intergenic
965355977 3:167673355-167673377 TTCCTGGGTCTTGAGCCTACTGG + Intergenic
965991529 3:174825200-174825222 TTCTTGAGTCTCCAGCTTGCAGG - Intronic
966228655 3:177626267-177626289 TCCCTGTGTCTCCAGCCTGCTGG - Intergenic
966515439 3:180815812-180815834 CTCCTGGGTCTCCAGCCTGCTGG + Intronic
967570710 3:191025254-191025276 TTCCTGGGTGTTAATCCTGCTGG + Intergenic
967870919 3:194228351-194228373 CTCCAGGGTCTTAAGCCTGCTGG + Intergenic
968223101 3:196953060-196953082 TTCCTGGTTCTCCAGCTTGCAGG + Intronic
968889689 4:3361928-3361950 TTCTTGGGACTGAGGCTTGCAGG + Intronic
969090747 4:4692329-4692351 TTCTTGGGTCTCCAGTGTGGGGG - Intergenic
969094963 4:4725720-4725742 TCCCTGGGTCTCCAGCCTGCAGG - Intergenic
969144711 4:5112412-5112434 TTCTTGGGTCTCGAGCCTGTAGG - Intronic
969197132 4:5571973-5571995 TTCCTGAGTCTCCAGCCTGCAGG + Intronic
969203844 4:5626931-5626953 TTCCTGGGTCTCCAGCTTGCAGG + Intronic
969370850 4:6730769-6730791 ATCTGGGCTCACAAGCCTGCAGG + Intergenic
970160516 4:13183927-13183949 CTCTTGGTTCTCCAGCCTACAGG + Intergenic
970164585 4:13222924-13222946 GTCTTAGGTCTCAAGGGTGCTGG - Intergenic
970287521 4:14534661-14534683 TTCCTGGGTCTCCAGCCTGCTGG - Intergenic
970407949 4:15781506-15781528 TCCCTGGGTCTCCAGGCTGCTGG - Intronic
970465643 4:16320406-16320428 CTCCTGGTTCTCAAGCCTTCAGG - Intergenic
970543401 4:17101944-17101966 TTTCTGGGTCTCCAGCCTTCTGG + Intergenic
970715832 4:18921555-18921577 TTCTTCAGTCTCAAGGCTGTAGG + Intergenic
970805550 4:20026236-20026258 CTCCTGGGTCTCCAGCCTGTTGG + Intergenic
970878345 4:20898211-20898233 TTCCTGGTTCTCCAGCTTGCAGG + Intronic
971023129 4:22558628-22558650 TTCTTGAGACTCAAGCTTGCTGG + Intergenic
971363074 4:25954522-25954544 TTCTTGGGTCTCCAGCATGCTGG - Intergenic
971426452 4:26520634-26520656 TTCCTTGGACTCCAGCCTGCTGG + Intergenic
971678243 4:29663829-29663851 TTCTTGGGCCTTGAGCCTGCTGG + Intergenic
971872268 4:32257819-32257841 TCACTGGGTCTCAAGCCTGCTGG - Intergenic
972127122 4:35782584-35782606 TTCCTGGGTTTCCAGCCTGTTGG - Intergenic
972130066 4:35821570-35821592 TTTTTGGGTCCCAGGCCTTCTGG + Intergenic
972180856 4:36463373-36463395 TTCCTAGGTCTCAGGTCTGCTGG + Intergenic
972371863 4:38431767-38431789 TTCTCGAGTCTCCAGCCTGCTGG - Intergenic
973036345 4:45412123-45412145 TTCTTGGTTCTCCAGCTTGCAGG + Intergenic
973136590 4:46715736-46715758 TTCTTGGGTCTTGGGCCTTCTGG + Intergenic
973198802 4:47476652-47476674 TCCCTGGGTCTCCAGCCTGCTGG + Intergenic
973337403 4:48970598-48970620 GTCTTGGGTCTTGAGCCTCCTGG + Intergenic
973594913 4:52478236-52478258 TTCTTGGGTCTCAAGTCCGCTGG - Intergenic
973726723 4:53784411-53784433 TTCCTGGGTTTCCAGCCTGCTGG + Intronic
973846712 4:54920281-54920303 CTCTTGGGCCTTGAGCCTGCTGG - Intergenic
974166242 4:58207514-58207536 TTATTGCATCTCAAGCCTGCTGG - Intergenic
974318643 4:60314928-60314950 TTCCTGGGTCTCCAGCCTGCTGG + Intergenic
974481467 4:62449135-62449157 TTCTTGGGTTTCCAGGCTGCTGG + Intergenic
974733993 4:65904629-65904651 TTCCTGGGTCTCACCCCTGGAGG + Intergenic
974743847 4:66043510-66043532 TTCTTTGGTCTCTAGTCAGCTGG + Intergenic
974852724 4:67422972-67422994 TCCCTGGGTCACCAGCCTGCTGG + Intergenic
975033605 4:69655511-69655533 TCCCTGAGTCTCAAGCCTGCTGG + Intergenic
975712230 4:77172339-77172361 CTCTTGGTACTCAAGCCTGTGGG + Intronic
975901306 4:79156456-79156478 TTCCTGGGTCTCCAGCCTGCTGG - Intergenic
977076599 4:92459943-92459965 TTCCTGGGTCTCCAGCCTGCTGG + Intronic
978146039 4:105372665-105372687 CTCCTGGGTCTCCAGGCTGCTGG + Intronic
978495876 4:109358631-109358653 TTCTTGGGCCTTAAGACTCCAGG + Intergenic
978585495 4:110272051-110272073 TTCTTGGGTCTCAAGCCGGCTGG - Intergenic
978827450 4:113042338-113042360 TTCTTGGTTCTCCAGCTTGCAGG + Intronic
980844941 4:138312935-138312957 CTCTCTGGTCTCAAGCCAGCTGG - Intergenic
982081973 4:151799062-151799084 TCCTTTGGTATGAAGCCTGCTGG + Intergenic
982343969 4:154335472-154335494 TTCCTAGGTCTCGAGCCTGCTGG + Intronic
982467041 4:155744449-155744471 TTCTTGGGACTCTGGCTTGCCGG - Intergenic
982493972 4:156066642-156066664 TTGTTGGGTCTCAAGCCTGCTGG + Intergenic
983012826 4:162569550-162569572 TTCCTGGGTCTCAAGCATGCTGG - Intergenic
983486237 4:168334018-168334040 TTCTTAGGTCTGAAGGCTTCCGG + Intergenic
983857252 4:172661305-172661327 CCCCTGGGTCTCCAGCCTGCTGG + Intronic
984417979 4:179485142-179485164 TTCCTGGGTCTTTAGCTTGCAGG - Intergenic
984534589 4:180957943-180957965 TTCCTGGGTCTCCAGCCAGTTGG - Intergenic
984745994 4:183218647-183218669 TTCCTGGGTCTCCAGGCTGCTGG - Intronic
985233831 4:187851135-187851157 GTCCTGAGTCTCCAGCCTGCTGG - Intergenic
985408043 4:189655570-189655592 TTCCTGGGTCTGCAGCCTGCTGG + Intergenic
985647444 5:1091601-1091623 TTCTGGGGTTTCACGCATGCTGG - Intronic
986098728 5:4585643-4585665 TCCATGGGTCTCCAGCCTGTGGG + Intergenic
986623414 5:9700674-9700696 ATCTTGGGTTTCTAGCCTCCAGG - Intronic
986974141 5:13376201-13376223 TTCCTGGGCCACACGCCTGCAGG - Intergenic
987089196 5:14496367-14496389 CTCCGGGGTCTGAAGCCTGCTGG - Intronic
987145950 5:14991895-14991917 TTCCTGGGTCTTGAGCTTGCTGG + Intergenic
987154236 5:15071810-15071832 TTCCTGGGTCTCTAGCCTGCTGG + Intergenic
987164396 5:15179637-15179659 TTCTTGGATCTCATGCCGGAAGG - Intergenic
987199841 5:15565698-15565720 TTCCTGGGTCTCAAGCCTGTTGG - Intronic
987343432 5:16958141-16958163 TTCCCTGGTCTCCAGCCTGCTGG - Intergenic
987542792 5:19276825-19276847 TTCATTGGTGTTAAGCCTGCAGG + Intergenic
987951638 5:24684168-24684190 CTACTGGGTCTGAAGCCTGCTGG + Intergenic
988363518 5:30266411-30266433 TCCTTGGGTCTACAGCCTGCTGG - Intergenic
988592896 5:32564414-32564436 TCCCTGGGTCTCCAGTCTGCTGG + Intronic
988675833 5:33432056-33432078 TTCTTGGATCTTGAGCCTGCTGG + Intergenic
989712560 5:44417488-44417510 TCCTTGGGTTTCTAGCCTGCTGG + Intergenic
990054480 5:51554470-51554492 TGCCTGGGTCTCTAGCCTGCTGG + Intergenic
990146313 5:52764653-52764675 TTCTTGGGTTTCAAGACCACTGG - Intergenic
990523806 5:56605604-56605626 GGCTTGGGTCTCAAGCCTCAGGG - Intronic
990835613 5:60015814-60015836 TCCTTGGGTCTTCAGTCTGCTGG + Intronic
991051644 5:62279119-62279141 TCCCTGGGTCTCCAGCCTGCTGG - Intergenic
991281350 5:64917752-64917774 TTGTTGGGTCTGAAGCCTGCTGG + Intronic
991417580 5:66408030-66408052 TCCTTGGGTCTGACTCCTGCAGG - Intergenic
991606333 5:68405236-68405258 TTCCTGGGTCATAAGCCTTCTGG - Intergenic
992210374 5:74473771-74473793 TTCTTGAGTCTCCAGCCTGCTGG - Intergenic
992259543 5:74956080-74956102 TTCCTGGGTCTTGAGCTTGCTGG + Intergenic
992832504 5:80608051-80608073 TTCCTGGCTCTTGAGCCTGCTGG - Intergenic
992952544 5:81874670-81874692 TTCTTAGCTCTCAAGCCTGAAGG - Intergenic
993132774 5:83920277-83920299 TTCCTGGGTCTCCAGCCTGCTGG + Intergenic
993315714 5:86403599-86403621 TTCTTGGGTCTTGAGCCTGCTGG - Intergenic
993677211 5:90831022-90831044 TTCCTGGGTCTTAAGCCTGCTGG + Intronic
993770940 5:91925465-91925487 TCCCCGGGTCTCCAGCCTGCTGG + Intergenic
993937712 5:94024349-94024371 TTCCTGAGTCTCCAGCCTGCTGG + Intronic
994037806 5:95222930-95222952 CTCATGGGTTTCCAGCCTGCTGG - Intronic
994382694 5:99090069-99090091 TTCCTGTGTCTTGAGCCTGCTGG - Intergenic
994397999 5:99242730-99242752 TTCTGGAGTCTCAGGCCTACGGG - Intergenic
994466325 5:100137918-100137940 TTCCTGGCTCTCCAGCTTGCAGG - Intergenic
995057828 5:107780803-107780825 TTCCTGGGTCATGAGCCTGCTGG + Intergenic
995395908 5:111686661-111686683 TTCCTGGGTCTCCAGCCTTCTGG + Intronic
995783061 5:115798188-115798210 AGCTTGGGTCATAAGCCTGCAGG + Intergenic
995793654 5:115920362-115920384 TTCCTGAGTTTCAAGCATGCTGG - Intergenic
996048645 5:118907427-118907449 CTCTTGGGTCTTGAACCTGCTGG - Intronic
997093408 5:130883321-130883343 TCCCTGGGTCTCCAGCCTGCTGG - Intergenic
998879790 5:146634310-146634332 TTCCTGGGTCTTCAGCCTGAGGG + Intronic
999073335 5:148770976-148770998 TTCCTGGGTCTCCAGCTTACAGG + Intergenic
999105380 5:149065982-149066004 TACTTGAGTCTCCAGACTGCTGG - Intergenic
999148762 5:149412977-149412999 TTGTTGGGTCACATGCCTGGTGG - Intergenic
999168553 5:149572818-149572840 TTCCTGAATCTCCAGCCTGCTGG + Intronic
999840087 5:155415223-155415245 TCCCTGAGTCTCCAGCCTGCTGG + Intergenic
1000022685 5:157332212-157332234 TTCCTGTGTTTCAAGCCTACAGG + Intronic
1000249633 5:159481741-159481763 TTCCTGGTTGTCAGGCCTGCAGG - Intergenic
1000434635 5:161193152-161193174 TTCCTAGGTTTCAAGCCTGCTGG - Intergenic
1000434651 5:161193311-161193333 TTCCTGGTTCTCAAGGCTGCTGG - Intergenic
1000580122 5:163026242-163026264 TTCTTGGTTCTCCAGTTTGCAGG - Intergenic
1000639505 5:163684974-163684996 TTCCTGAGTCTCCAGCTTGCTGG - Intergenic
1000818065 5:165948504-165948526 TGCCTGAGTCTCCAGCCTGCTGG + Intergenic
1001075167 5:168621114-168621136 TTCCTGGGTCTCCAGCCTGCTGG + Intergenic
1001386678 5:171345128-171345150 TTCCTTGGTCTTAGGCCTGCAGG + Intergenic
1002403503 5:179009260-179009282 TGCATGGGTCTCAAGGCTACTGG - Intergenic
1002805357 6:568392-568414 TCCTTAGGTCTCGAGCCGGCTGG + Intronic
1002983519 6:2165337-2165359 TTCTCAGGTCTCAAAGCTGCTGG - Intronic
1003096675 6:3147840-3147862 TTCCTGGGTCTCAAGCCTCCTGG - Intronic
1003268374 6:4586528-4586550 CTCCTGGGTCTCCAGCCTACAGG - Intergenic
1003560210 6:7173711-7173733 TTCTTGTGCCTCAAGCCTCCCGG - Intronic
1003611701 6:7620194-7620216 TCCCTGGGTCTCCAGCCTGCGGG - Intergenic
1003618595 6:7677296-7677318 TTTCTGGGTCTCCAGCCTGCTGG + Intergenic
1003685942 6:8302273-8302295 CTCCTGGGTTTCCAGCCTGCCGG + Intergenic
1003973137 6:11318074-11318096 TTCCTGGGTCTCAAACCTGCTGG + Intronic
1004012483 6:11702852-11702874 CTCCTGGGTCTCCAGCCTGCTGG - Intergenic
1004461678 6:15842491-15842513 TTCCCGGATCTCAAGCCTGCTGG - Intergenic
1004731409 6:18362837-18362859 ATCTTGGGTCACAGGGCTGCAGG + Intergenic
1004843012 6:19608403-19608425 TCCCTGGTTCTCCAGCCTGCTGG - Intergenic
1005584682 6:27264697-27264719 TTCCTGGGTTTCCAGCCTGCTGG - Intergenic
1005698002 6:28369495-28369517 TTCCTGGGTCTTGAACCTGCTGG - Intergenic
1005839343 6:29731350-29731372 TCCTTGGTTCTCCAGCTTGCAGG - Intronic
1005937443 6:30534150-30534172 TTCCTGTGTCTCCAGCCTGCTGG - Intergenic
1007160576 6:39788810-39788832 TCCCTGGGTCTCCAGCCTGCTGG - Intergenic
1007164272 6:39817682-39817704 TTCCTGGGTCTCCAGCCTGCTGG - Intronic
1007373576 6:41442289-41442311 TACTTGGGCCTCAGGCCTGCAGG + Intergenic
1007832419 6:44648597-44648619 TTCTCCAGTGTCAAGCCTGCTGG + Intergenic
1007846950 6:44766950-44766972 TTTTTGTGTGTCAATCCTGCAGG + Intergenic
1008006440 6:46414708-46414730 TCTCTAGGTCTCAAGCCTGCTGG + Intronic
1008198652 6:48558520-48558542 TTCTTGGGTCTCAAGCCTGCTGG - Intergenic
1008351808 6:50499982-50500004 TTCTTGGGTCCCTAGACAGCTGG - Intergenic
1008474873 6:51925667-51925689 TTCTTGGATATCCAGCTTGCTGG + Intronic
1008985805 6:57541666-57541688 TTCCTGGGTCTCAAAGCTGTTGG - Intronic
1009449418 6:63784082-63784104 TTCTTGGGTCTTGAGCCTGATGG + Intronic
1009616117 6:66009594-66009616 TTCTTGGGTCCCTAGGCAGCTGG + Intergenic
1010051878 6:71514399-71514421 TTCCTGGGTGTCTAGACTGCTGG - Intergenic
1010131610 6:72500702-72500724 TTCTTGGATTTCAAGCCCGCTGG - Intergenic
1010970323 6:82255888-82255910 TTCTTGGGTCTTGAGCCTGCTGG + Intergenic
1010995907 6:82532132-82532154 TTCCTGGGTCTCCAACCTGCTGG + Intergenic
1011073980 6:83418288-83418310 CTCTTGGGTCTCTAGCTTGCTGG - Intronic
1011331218 6:86208831-86208853 TTTTTGGGTCTCAAGCTTGCTGG - Intergenic
1011653869 6:89531942-89531964 CTCTTAGGTCTCCAGCCTGCTGG - Intronic
1011818952 6:91227866-91227888 TTCTTGGGTCTCAAGCCTGCTGG - Intergenic
1011890512 6:92153572-92153594 TTGCTGGGTCTCAATCCTGTTGG - Intergenic
1012392326 6:98756601-98756623 TCCCTGAGTCTCCAGCCTGCTGG - Intergenic
1012493809 6:99812285-99812307 TTCCTGAGTCTCTAGCCTGCTGG - Intergenic
1012496474 6:99838833-99838855 TTCCTGGGCCTCCAGCTTGCAGG + Intergenic
1012550904 6:100464350-100464372 AACTTGGGTCTCAAGTCTGAGGG + Intronic
1012626381 6:101408524-101408546 TTCCTGGACCTCAAGTCTGCTGG - Intronic
1012934713 6:105354701-105354723 TCCTTGAGTCTCCAGCCTGTGGG + Intronic
1013192173 6:107812730-107812752 TTCTTGGGTCTCATGTCTGCTGG + Intronic
1013222225 6:108088619-108088641 TTTTTGAATCTCCAGCCTGCTGG + Intronic
1013406153 6:109845886-109845908 TTCTTGGGTGTCCAGCTTGCTGG - Intergenic
1013406169 6:109845981-109846003 TTCCTGGGTCTCCAGCTTGCTGG - Intergenic
1013463215 6:110395347-110395369 TTCTTGAGTCTCAAGCCTGCTGG + Intronic
1013700107 6:112756886-112756908 TTCCTGGTTCTCAGGCCTTCAGG + Intergenic
1014120520 6:117720444-117720466 TTCCTGGGTCTTAAGGCTGCAGG + Intergenic
1014324416 6:119974426-119974448 TTCCTGGGTTTCAAGCCTGCAGG - Intergenic
1014394733 6:120912285-120912307 CTCTTGAGTCCCAAGCCTGCAGG + Intergenic
1015428584 6:133102662-133102684 TCCTTGGGTTTCCAGCCTGCTGG - Intergenic
1015469751 6:133590574-133590596 CTCTTAGGTCTTGAGCCTGCTGG + Intergenic
1015543222 6:134337196-134337218 TTCCTGGGTCTTGAGCCTGCCGG - Intergenic
1015962505 6:138664800-138664822 TTGCTGGGGCTCCAGCCTGCTGG - Intronic
1016284585 6:142458998-142459020 TCCCCGGGTCTCCAGCCTGCTGG - Intergenic
1017008638 6:150046572-150046594 TTCCTGGGTCTCCAGCCGGGTGG + Intergenic
1018033285 6:159861292-159861314 TTCTTGGCTCTAAACCCTGAGGG + Intergenic
1018699823 6:166417522-166417544 TCCTTGGGGCTCCAGCCTGCCGG + Intronic
1018773336 6:166991759-166991781 CTCCTGGGTCTCCAGCTTGCTGG + Intergenic
1019133696 6:169895435-169895457 TTCCTGGGTCTCCAGCCTGCCGG - Intergenic
1019799341 7:3076904-3076926 TCCCTGGGCCTCAAGCTTGCTGG - Intergenic
1019967634 7:4512996-4513018 TTCCTGGAGCTCCAGCCTGCTGG + Intergenic
1021118830 7:16774144-16774166 TGCTTGAGTTTCCAGCCTGCTGG + Intronic
1021304753 7:19019038-19019060 TTCCTGGGTCTCAAGCCCACTGG - Intergenic
1021408305 7:20299674-20299696 TTCCTAGGTCTCCAGCCTGCGGG + Intergenic
1021768390 7:23971935-23971957 TTCTTGAGTCTCAAGTCTACTGG + Intergenic
1021814695 7:24435781-24435803 TCCCTGGGTTTCCAGCCTGCTGG + Intergenic
1021946166 7:25729908-25729930 TTCTTGGGTATCAAAGCTGTTGG - Intergenic
1022138296 7:27469533-27469555 TCCCTGGATCTCCAGCCTGCTGG + Intergenic
1022632328 7:32097003-32097025 TTCTTGAGTCCTGAGCCTGCTGG - Intronic
1022970930 7:35516524-35516546 TTCTTGGATCTTAATCCTCCTGG - Intergenic
1023356331 7:39370838-39370860 TTCCTGGGTCTCCACCCTGTAGG + Intronic
1023411701 7:39894570-39894592 TTCTGGGGCCTGAAGTCTGCAGG + Intergenic
1023574473 7:41611337-41611359 TGGCTGGGTCTCCAGCCTGCTGG - Intergenic
1023601369 7:41884690-41884712 TCCCTGGGTCTCCAGCCTGCTGG + Intergenic
1023652240 7:42383939-42383961 TCCCTGAGTCTCCAGCCTGCTGG + Intergenic
1024317913 7:48038499-48038521 TCCCTGGGTCTCCAGCCTGCTGG - Intronic
1024388935 7:48785044-48785066 TCCTTGAGTCTCCAGCCTGCTGG + Intergenic
1024476169 7:49813923-49813945 TTCTTGGTGCTGAAGCCTGGAGG + Intronic
1024509988 7:50196299-50196321 TCCCTGAGTCTCCAGCCTGCTGG - Intergenic
1024602120 7:50992865-50992887 CTCCTGGGTCTCCAGCCTGTTGG + Intergenic
1024727426 7:52214088-52214110 TTCTTAGGCCTCAAGCCTGCAGG + Intergenic
1025012369 7:55407724-55407746 TTCCTGAGTCTCCAGCTTGCTGG + Intronic
1026144346 7:67733558-67733580 TTCCTGAGTCTCAAGTCTGCTGG - Intergenic
1026311531 7:69189588-69189610 TTCCTGGGTCTCCAGGTTGCAGG + Intergenic
1026503479 7:70962676-70962698 TCCCTGGGTCTCCAGCCTGCTGG + Intergenic
1026600266 7:71771794-71771816 TTCCTGGATCTCCAGCTTGCAGG + Intergenic
1028246184 7:88480445-88480467 TTCCTAGGTGTCAAGCTTGCGGG + Intergenic
1028361189 7:89968632-89968654 TGCTTGGGTTTCAACCTTGCTGG - Intergenic
1028517806 7:91697729-91697751 TACCTGGGACTCAATCCTGCTGG - Intronic
1028812447 7:95103111-95103133 TTCCTGGGTCTCTGGCCTGCAGG + Intronic
1028851955 7:95547862-95547884 TCCCTGGGTCTCCAGCCTGCTGG + Intergenic
1029071955 7:97906793-97906815 GTCCTGGGTCTCCAGCTTGCTGG - Intergenic
1029103718 7:98156779-98156801 TCCCTGGGTCTCCAGCCTCCTGG - Intronic
1029345392 7:99974971-99974993 TCCCTGGGTCTCCAGCCTGCTGG + Intronic
1029346441 7:99982134-99982156 TTGCTTGGTCTCTAGCCTGCTGG - Intergenic
1029558778 7:101288737-101288759 TTCCTGGGTCTCCAGCCTGCTGG + Intergenic
1030100981 7:105945004-105945026 TCCTTGGGTCTCCAGCCTGTTGG - Intronic
1030166658 7:106562270-106562292 TTCCTGGGCCTCCAGCTTGCAGG + Intergenic
1030789963 7:113712391-113712413 TCCCTGGGTCTCTAGCCTGCTGG + Intergenic
1031808767 7:126339931-126339953 TCCCTGGGGCTCCAGCCTGCTGG - Intergenic
1032460580 7:132107135-132107157 CTCTTGACTCCCAAGCCTGCTGG + Intergenic
1032799335 7:135305964-135305986 TTCCTGGTTCTCCAGCTTGCAGG + Intergenic
1032857412 7:135846785-135846807 GTCCTGGGTCTCCAGCTTGCAGG - Intergenic
1034204607 7:149304629-149304651 ATCTTGGGCCTCCAGCCTCCAGG + Intergenic
1034747297 7:153534447-153534469 CTCTTGGGTATCTAGCCTGCAGG - Intergenic
1035154278 7:156899475-156899497 CTCTTGGATCTTGAGCCTGCTGG - Intergenic
1035590879 8:812186-812208 TCCCTGGGTCTCCTGCCTGCTGG - Intergenic
1035611609 8:969243-969265 TTCCTGGGTCTCCAGCCTGCAGG + Intergenic
1036220925 8:6921170-6921192 TCCCCGGGTCTCCAGCCTGCTGG - Intergenic
1036245740 8:7115209-7115231 GTCCTGGGTCTCCAGCTTGCTGG + Intergenic
1036255049 8:7199255-7199277 GTCTTGGGTCCCCAGCTTGCTGG - Intergenic
1036362440 8:8088252-8088274 GTCTTGGGTCCCCAGCTTGCTGG + Intergenic
1036602269 8:10272360-10272382 TTCCTGGATCTAAAGGCTGCTGG - Intronic
1036888527 8:12578817-12578839 GTCCTGGGTCTCCAGCTTGCTGG - Intergenic
1036896126 8:12636919-12636941 GTCTTGGGTCCCCAGCTTGCTGG - Intergenic
1037578843 8:20232694-20232716 TTCTTTGGTCACAATCCAGCCGG + Intergenic
1037711462 8:21358631-21358653 CTCTTGGGCCTCCAGCTTGCTGG - Intergenic
1038345667 8:26730203-26730225 TTTTTGGGTCTCAGGCCTGCTGG + Intergenic
1038571969 8:28670499-28670521 TTCTTGAGTCTCAAGCCTGCTGG - Intronic
1038939717 8:32291018-32291040 TTCCTGGGTATGGAGCCTGCTGG - Intronic
1039205071 8:35143387-35143409 TCTCTGGGTCTCTAGCCTGCTGG + Intergenic
1040105748 8:43540799-43540821 GCCTAGAGTCTCAAGCCTGCTGG + Intergenic
1040829506 8:51661586-51661608 TTCCTGGGTCCCCAGCCTGCCGG + Intronic
1041181072 8:55248785-55248807 GTCTGGGGTCTCCTGCCTGCAGG + Intronic
1041354640 8:56987577-56987599 TTCCTGGGTTTCCAGCTTGCAGG + Intronic
1041765029 8:61410519-61410541 TTCTTGGGTCAGAAGCCTTTTGG + Intronic
1041815150 8:61962153-61962175 TTCCTGGGTCTCCTGCTTGCAGG + Intergenic
1042127709 8:65555381-65555403 TTCATGGGTCTCAAGCATCAGGG + Intergenic
1042320441 8:67469704-67469726 TCCCTGGGTTTCCAGCCTGCTGG + Intronic
1042425657 8:68644743-68644765 TACCTGGCTCTCAAGACTGCAGG - Intronic
1043988508 8:86722795-86722817 CTTTTGGGTCTCAAGTTTGCTGG + Intronic
1044527071 8:93264270-93264292 TTTCTGGGTCTGCAGCCTGCTGG + Intergenic
1044853846 8:96454544-96454566 TCCTTGGGGCTCCAGCCTTCAGG - Intergenic
1045051752 8:98333821-98333843 CTCTTGGTTCTCAGGCCTTCAGG + Intergenic
1045396284 8:101763812-101763834 TTCCTGGGTGTTGAGCCTGCTGG + Intronic
1045706232 8:104926321-104926343 TTCCTGAGTCTCCAGCCTGCTGG + Intronic
1045947684 8:107814874-107814896 TTCTTGGGCCTTCAGACTGCAGG + Intergenic
1046230037 8:111343134-111343156 TTCCTGAGTCTCCAGCTTGCTGG + Intergenic
1046831502 8:118751468-118751490 TTCTGGGGTCTGAAGGATGCTGG - Intergenic
1047284099 8:123471603-123471625 TCCCTGGGTCTCAAGCCTGCTGG - Intergenic
1047670750 8:127143456-127143478 TTCTTGAGTTTCAAGACTGGGGG + Intergenic
1047766563 8:127994686-127994708 TTCCTAGGTCTCCAGCCTGCAGG - Intergenic
1048028839 8:130612165-130612187 TTTCTGGGTCTTTAGCCTGCTGG + Intergenic
1048061205 8:130920912-130920934 TCCCTGGATCTCCAGCCTGCTGG + Intronic
1048613245 8:136047142-136047164 CTTCTGGGTCTCCAGCCTGCTGG + Intergenic
1048689774 8:136948849-136948871 TTCCTGGGTCTCTAGCCTGTGGG + Intergenic
1048716885 8:137281106-137281128 TTCTTGCTTCTCAGGCCTTCGGG + Intergenic
1048889908 8:138937566-138937588 CTCCTGGGTCTCCAGCCTGCTGG + Intergenic
1048961980 8:139587641-139587663 TCCCTGGGTCTCCAGCCTGATGG + Intergenic
1049533037 8:143165879-143165901 TTCCTGGGTTTCCAGCCTGCTGG + Intergenic
1049555684 8:143280471-143280493 TTTGTGGGTCTCAAGTCTACTGG - Intergenic
1050102654 9:2135059-2135081 TTCCTGGGTCTCCAACTTGCAGG - Intronic
1050630627 9:7554903-7554925 TTCCTGGATCTCAAGCCTGCTGG - Intergenic
1051222182 9:14860424-14860446 TCCTTGGGTTTCTAGGCTGCTGG - Intronic
1051994679 9:23200848-23200870 TTCCTGGGTCTTGAGCCTTCCGG + Intergenic
1052540584 9:29806759-29806781 TTCTTGAGTTTCCAGCTTGCTGG + Intergenic
1052780345 9:32776496-32776518 CTCTTGAGTCTCCAGCCTGCTGG + Intergenic
1052799395 9:32953502-32953524 TTCTTGGGTCTCACGCAGGAAGG + Intergenic
1053205776 9:36185004-36185026 TTCGTGGGACTTCAGCCTGCTGG + Intergenic
1053525133 9:38822175-38822197 TTTTTAGGTCTCAAGACTGCTGG - Intergenic
1053603582 9:39634208-39634230 TCCCTGGGTCTCGAGCCTGCTGG - Intergenic
1053861470 9:42390565-42390587 TCCCTGGGTCTCGAGCCTGCTGG - Intergenic
1054197364 9:62046597-62046619 TTTTTAGGTCTCAAGACTGCTGG - Intergenic
1054249955 9:62708211-62708233 TCCCTGGGTCTTGAGCCTGCTGG + Intergenic
1054564066 9:66742742-66742764 TCCCTGGGTCTCGAGCCTGCTGG + Intergenic
1054641046 9:67542085-67542107 TTTTTAGGTCTCAAGACTGCTGG + Intergenic
1054791072 9:69257297-69257319 CCCCTGGGTCTCCAGCCTGCTGG - Intergenic
1054976990 9:71159020-71159042 TTCTTGGGTCTCCTGCTTGCAGG + Intronic
1055104716 9:72500447-72500469 TTCCTGAGTCTCCAGGCTGCTGG + Intergenic
1055116447 9:72610456-72610478 TTCCTGTGTCTAGAGCCTGCAGG - Intronic
1055462748 9:76534497-76534519 TCCCTGGGTCTGTAGCCTGCTGG + Intergenic
1055724566 9:79213509-79213531 CTCCTGGGTCTCCAGCATGCTGG - Intergenic
1055817333 9:80221979-80222001 TCCTTGGGTCTGCAGCCTGGTGG + Intergenic
1056068167 9:82958448-82958470 TTCTTAGCTCTCAAGCCCTCAGG + Intergenic
1056296815 9:85201478-85201500 TTCTTGGGTTTTGAACCTGCTGG - Intergenic
1056385773 9:86095688-86095710 TTCTTGGTTTTCAGCCCTGCTGG - Intronic
1056616916 9:88176663-88176685 TTCCTGAGTCTCCAGCTTGCAGG - Intergenic
1056878442 9:90363081-90363103 TTTTTGGATCTCAAGCCTGCTGG + Intergenic
1057169712 9:92954386-92954408 TCCTTGGGTCTCAAGGGTTCTGG + Intronic
1057209361 9:93191323-93191345 TGCTTGGGTCTCAACAGTGCAGG + Intronic
1057458283 9:95234803-95234825 TTCCCGGGTCTAAAGCCTGCTGG - Intronic
1057720019 9:97524677-97524699 TTCCTGGGTCTTCGGCCTGCTGG - Intronic
1057927167 9:99163002-99163024 TTCTTTGGTCTCTGGTCTGCGGG + Intergenic
1057993626 9:99799151-99799173 TTCCTGGGTCTCCAGCTTGCAGG - Intergenic
1058315474 9:103560105-103560127 TTTATGGGTCTCCAGCTTGCAGG - Intergenic
1058459309 9:105168157-105168179 TTCCTGGGTCTTGAGCCTGCTGG - Intergenic
1059356881 9:113706706-113706728 TTCTTGGTTCTCAATCCTGCCGG + Intergenic
1059356897 9:113706788-113706810 CTCCTGGGTCTCCAGCTTGCTGG + Intergenic
1059740918 9:117148914-117148936 TCCTTGGGTCTTTAGCTTGCTGG + Intronic
1060550434 9:124482437-124482459 TCCTGGAGTCTGAAGCCTGCAGG - Exonic
1060919783 9:127412162-127412184 TTCCTGTATCTCCAGCCTGCTGG - Intergenic
1061501064 9:131002273-131002295 TTCCCGGGTCTCCAGCCTGCTGG + Intergenic
1061892819 9:133631704-133631726 ATCTTGGGGCTGAGGCCTGCTGG - Intergenic
1061928311 9:133818600-133818622 TTCCTGGGTCTCCAGCTTGCAGG + Intronic
1062156821 9:135053831-135053853 CTCTGGGGTCTCCAGCTTGCAGG + Intergenic
1203617411 Un_KI270749v1:80242-80264 TTCCTGGGTCTCCAGCTTGCTGG - Intergenic
1203659126 Un_KI270753v1:24995-25017 TTCCTGGGTCTGCAGCCTGCTGG + Intergenic
1185563012 X:1075114-1075136 CTCCTGGGTCTCAGGCCTTCCGG + Intergenic
1185635084 X:1546440-1546462 CTCCTGGGTCTCAGGCCTTCAGG - Intergenic
1185635103 X:1546590-1546612 CTCCTGGGTCTCAGGCCTTCAGG - Intergenic
1185840251 X:3382932-3382954 TCCCTGGGTCTCCAGCCTTCTGG - Intergenic
1185913669 X:4010367-4010389 TTCCTGGGTCTCCAGCTTTCAGG - Intergenic
1186139940 X:6561333-6561355 CTCTTGAGTCTCATGCCTTCAGG + Intergenic
1186178623 X:6950998-6951020 TTCCTGGGTCTCAAGCCTGCAGG + Intergenic
1186386453 X:9115067-9115089 TTCCTGGGTCTTGAGCCTGCTGG + Intronic
1187004904 X:15222988-15223010 TTCCTGGGTCTTGAGCCTGCTGG + Intergenic
1187441105 X:19321004-19321026 TCCCTGGGTCTCCAGCCTACTGG - Intergenic
1187588683 X:20692019-20692041 TTCCTGGGTCTCCAGCCTGCTGG - Intergenic
1187590875 X:20715891-20715913 CTCTTGAGTCTTGAGCCTGCTGG - Intergenic
1187911547 X:24115892-24115914 TCCCTGGGTCTCCAGCCTGCTGG + Intergenic
1188235092 X:27718754-27718776 TTCTTGGGTCTCAAGCCTGCTGG + Intronic
1188439145 X:30197441-30197463 TTCCTGGTTCTCCAGCTTGCTGG + Intergenic
1189943637 X:46154210-46154232 TTCTTGGGTCTCAAGCCTGCTGG - Intergenic
1190045441 X:47108236-47108258 TCCCTGGGTCTCCAGCTTGCTGG + Intergenic
1190152194 X:47957845-47957867 TTCCTTGGCCTCAAGTCTGCTGG + Intronic
1190160468 X:48028287-48028309 TTCATTGGCCTCAAGTCTGCTGG - Intronic
1190618074 X:52258720-52258742 CCCTTGGGTCTCCAGGCTGCTGG + Intergenic
1190766081 X:53476866-53476888 TTCCTGGGTCTCAAGCCTGCTGG + Intergenic
1191673801 X:63773870-63773892 TTCTTGTGTCTCAAGTCTGATGG + Intronic
1193220380 X:78918457-78918479 TTCTTGGGTCTCCAGCCTGCTGG + Intergenic
1193264557 X:79453196-79453218 TATTTGGGTCTCAAGGCAGCTGG - Intergenic
1193779843 X:85687837-85687859 TTCCTGGGTCTTGAGCCTGTTGG + Intergenic
1194538539 X:95140963-95140985 TTCCTGGGTCTCCACCCTGCAGG - Intergenic
1194560808 X:95417273-95417295 TTCCTGGCTCTCCAGCTTGCAGG + Intergenic
1194634904 X:96333368-96333390 TCCCTGGGTCTAGAGCCTGCTGG - Intergenic
1195053890 X:101124212-101124234 CTCCTGGGTCTCCAGCCTGCTGG - Intronic
1195303050 X:103550884-103550906 TTCCTGAGTCTGAAGCCTGCTGG + Intergenic
1195399139 X:104443306-104443328 TTTTTGAGTCCAAAGCCTGCTGG - Intergenic
1195653189 X:107308804-107308826 TTCCTGGGTCTTGAGCCTGCTGG - Intergenic
1195940073 X:110160698-110160720 TTACTGGGTGTCAAGCCTGAGGG - Intronic
1196114160 X:111981217-111981239 TTTAGGGGTCTCAAGCCTGCTGG - Intronic
1196118655 X:112024565-112024587 TTCCTAGGTCTCCAGCTTGCAGG + Intronic
1196642334 X:118076788-118076810 TCCCTGGGTCTCCAGCCTGTAGG + Intronic
1197323244 X:125060057-125060079 TCCCTGGATCTCCAGCCTGCTGG + Intergenic
1197642073 X:128977970-128977992 TTCCTAGGTCTCCAGCCTCCTGG + Intergenic
1197822991 X:130560466-130560488 TCCTTGGGTCTCTAGCCTGCTGG + Intergenic
1197881810 X:131174594-131174616 TTCCTGGTTCTCCAGCTTGCAGG - Intergenic
1198058382 X:133018562-133018584 TTCATGAGTCTCCAGCGTGCTGG + Intergenic
1198220233 X:134592602-134592624 TCCCTGAGTCTCCAGCCTGCTGG + Intronic
1198259055 X:134950322-134950344 TCCCTGGGTCTCGAGCCTGCGGG + Intergenic
1198848152 X:140935952-140935974 TCCCTGGGTCTCCAGCCTACTGG - Intergenic
1198868751 X:141153942-141153964 TTCCTGGATCTCAAGCGTGCTGG - Intergenic
1199008785 X:142733655-142733677 TTCTTGGCTCTTGAGCCTGCTGG + Intergenic
1199386513 X:147229493-147229515 TTCCTGGGTCTCAAACCTGCTGG + Intergenic
1199773867 X:150993982-150994004 TTCCTTGGTCTTAGGCCTGCGGG - Intergenic
1199799395 X:151234574-151234596 TTCTTGGGTGTGAAGTCTGTTGG + Intergenic
1199965525 X:152817621-152817643 CTCTTGAGTCTTGAGCCTGCTGG - Intergenic
1200289053 X:154854462-154854484 TTTCTGGGTCTGTAGCCTGCTGG + Intronic
1201254815 Y:12096895-12096917 TCCCTGGGTCTCCAGCTTGCAGG + Intergenic
1202037783 Y:20651833-20651855 TTCTTGAGACGCAAGTCTGCCGG + Intergenic