ID: 1008198654

View in Genome Browser
Species Human (GRCh38)
Location 6:48558536-48558558
Sequence GCTGAAACATTAGCTATTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008198654_1008198657 -4 Left 1008198654 6:48558536-48558558 CCAAGAATAGCTAATGTTTCAGC No data
Right 1008198657 6:48558555-48558577 CAGCTCAAGTTCAAAAGCTGGGG No data
1008198654_1008198658 20 Left 1008198654 6:48558536-48558558 CCAAGAATAGCTAATGTTTCAGC No data
Right 1008198658 6:48558579-48558601 AAGCCAATATCCCAGTTCAAAGG No data
1008198654_1008198656 -5 Left 1008198654 6:48558536-48558558 CCAAGAATAGCTAATGTTTCAGC No data
Right 1008198656 6:48558554-48558576 TCAGCTCAAGTTCAAAAGCTGGG No data
1008198654_1008198655 -6 Left 1008198654 6:48558536-48558558 CCAAGAATAGCTAATGTTTCAGC No data
Right 1008198655 6:48558553-48558575 TTCAGCTCAAGTTCAAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008198654 Original CRISPR GCTGAAACATTAGCTATTCT TGG (reversed) Intergenic
No off target data available for this crispr