ID: 1008198655

View in Genome Browser
Species Human (GRCh38)
Location 6:48558553-48558575
Sequence TTCAGCTCAAGTTCAAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008198652_1008198655 10 Left 1008198652 6:48558520-48558542 CCAGCAGGCTTGAGACCCAAGAA 0: 6
1: 28
2: 95
3: 248
4: 512
Right 1008198655 6:48558553-48558575 TTCAGCTCAAGTTCAAAAGCTGG No data
1008198653_1008198655 -5 Left 1008198653 6:48558535-48558557 CCCAAGAATAGCTAATGTTTCAG No data
Right 1008198655 6:48558553-48558575 TTCAGCTCAAGTTCAAAAGCTGG No data
1008198651_1008198655 22 Left 1008198651 6:48558508-48558530 CCAGGCTCAAGGCCAGCAGGCTT No data
Right 1008198655 6:48558553-48558575 TTCAGCTCAAGTTCAAAAGCTGG No data
1008198654_1008198655 -6 Left 1008198654 6:48558536-48558558 CCAAGAATAGCTAATGTTTCAGC No data
Right 1008198655 6:48558553-48558575 TTCAGCTCAAGTTCAAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008198655 Original CRISPR TTCAGCTCAAGTTCAAAAGC TGG Intergenic
No off target data available for this crispr