ID: 1008198658

View in Genome Browser
Species Human (GRCh38)
Location 6:48558579-48558601
Sequence AAGCCAATATCCCAGTTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008198654_1008198658 20 Left 1008198654 6:48558536-48558558 CCAAGAATAGCTAATGTTTCAGC No data
Right 1008198658 6:48558579-48558601 AAGCCAATATCCCAGTTCAAAGG No data
1008198653_1008198658 21 Left 1008198653 6:48558535-48558557 CCCAAGAATAGCTAATGTTTCAG No data
Right 1008198658 6:48558579-48558601 AAGCCAATATCCCAGTTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008198658 Original CRISPR AAGCCAATATCCCAGTTCAA AGG Intergenic
No off target data available for this crispr