ID: 1008200799

View in Genome Browser
Species Human (GRCh38)
Location 6:48587337-48587359
Sequence GACCCACTAGCTTCTTTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008200797_1008200799 21 Left 1008200797 6:48587293-48587315 CCATGTAGACAATGCAATGCACT No data
Right 1008200799 6:48587337-48587359 GACCCACTAGCTTCTTTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008200799 Original CRISPR GACCCACTAGCTTCTTTGAC AGG Intergenic
No off target data available for this crispr