ID: 1008208558

View in Genome Browser
Species Human (GRCh38)
Location 6:48692786-48692808
Sequence TGTCCTTTGCAGGACATAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008208556_1008208558 -3 Left 1008208556 6:48692766-48692788 CCATAAAAAGAATGAGATTATGT 0: 28
1: 299
2: 998
3: 2201
4: 3207
Right 1008208558 6:48692786-48692808 TGTCCTTTGCAGGACATAGATGG No data
1008208555_1008208558 14 Left 1008208555 6:48692749-48692771 CCATGGAGTATACACAACCATAA No data
Right 1008208558 6:48692786-48692808 TGTCCTTTGCAGGACATAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008208558 Original CRISPR TGTCCTTTGCAGGACATAGA TGG Intergenic
No off target data available for this crispr