ID: 1008211037

View in Genome Browser
Species Human (GRCh38)
Location 6:48726417-48726439
Sequence AGAGCTCTGTCTAGGCTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008211034_1008211037 5 Left 1008211034 6:48726389-48726411 CCTGAATCAGCTGTGAGACAGAG No data
Right 1008211037 6:48726417-48726439 AGAGCTCTGTCTAGGCTCAGAGG No data
1008211033_1008211037 6 Left 1008211033 6:48726388-48726410 CCCTGAATCAGCTGTGAGACAGA No data
Right 1008211037 6:48726417-48726439 AGAGCTCTGTCTAGGCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008211037 Original CRISPR AGAGCTCTGTCTAGGCTCAG AGG Intergenic
No off target data available for this crispr