ID: 1008218572

View in Genome Browser
Species Human (GRCh38)
Location 6:48825944-48825966
Sequence TACCTAAGGCTGGTGGGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008218567_1008218572 20 Left 1008218567 6:48825901-48825923 CCGGAACAGGCAAATCTATAGAA No data
Right 1008218572 6:48825944-48825966 TACCTAAGGCTGGTGGGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008218572 Original CRISPR TACCTAAGGCTGGTGGGAAA TGG Intergenic
No off target data available for this crispr