ID: 1008228264

View in Genome Browser
Species Human (GRCh38)
Location 6:48950640-48950662
Sequence TGCAAGGTATTGATCCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008228260_1008228264 -5 Left 1008228260 6:48950622-48950644 CCTGATTAGATTGAAGGATGCAA No data
Right 1008228264 6:48950640-48950662 TGCAAGGTATTGATCCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008228264 Original CRISPR TGCAAGGTATTGATCCTGGG TGG Intergenic
No off target data available for this crispr