ID: 1008233840

View in Genome Browser
Species Human (GRCh38)
Location 6:49019236-49019258
Sequence TCTGGGCAGTTCATGGCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008233832_1008233840 23 Left 1008233832 6:49019190-49019212 CCATCCAGTTGGGAATGGACTTA No data
Right 1008233840 6:49019236-49019258 TCTGGGCAGTTCATGGCATTTGG No data
1008233838_1008233840 -10 Left 1008233838 6:49019223-49019245 CCTATCAGCAATGTCTGGGCAGT No data
Right 1008233840 6:49019236-49019258 TCTGGGCAGTTCATGGCATTTGG No data
1008233834_1008233840 19 Left 1008233834 6:49019194-49019216 CCAGTTGGGAATGGACTTAAGGG No data
Right 1008233840 6:49019236-49019258 TCTGGGCAGTTCATGGCATTTGG No data
1008233831_1008233840 24 Left 1008233831 6:49019189-49019211 CCCATCCAGTTGGGAATGGACTT No data
Right 1008233840 6:49019236-49019258 TCTGGGCAGTTCATGGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008233840 Original CRISPR TCTGGGCAGTTCATGGCATT TGG Intergenic
No off target data available for this crispr