ID: 1008236485

View in Genome Browser
Species Human (GRCh38)
Location 6:49057686-49057708
Sequence CCCAGTGGGTACCCAGTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008236479_1008236485 -9 Left 1008236479 6:49057672-49057694 CCACTAAGCAGTACCCCAGTGGG No data
Right 1008236485 6:49057686-49057708 CCCAGTGGGTACCCAGTGTGGGG No data
1008236476_1008236485 0 Left 1008236476 6:49057663-49057685 CCCACAGCTCCACTAAGCAGTAC No data
Right 1008236485 6:49057686-49057708 CCCAGTGGGTACCCAGTGTGGGG No data
1008236477_1008236485 -1 Left 1008236477 6:49057664-49057686 CCACAGCTCCACTAAGCAGTACC No data
Right 1008236485 6:49057686-49057708 CCCAGTGGGTACCCAGTGTGGGG No data
1008236474_1008236485 7 Left 1008236474 6:49057656-49057678 CCACCTTCCCACAGCTCCACTAA No data
Right 1008236485 6:49057686-49057708 CCCAGTGGGTACCCAGTGTGGGG No data
1008236475_1008236485 4 Left 1008236475 6:49057659-49057681 CCTTCCCACAGCTCCACTAAGCA No data
Right 1008236485 6:49057686-49057708 CCCAGTGGGTACCCAGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008236485 Original CRISPR CCCAGTGGGTACCCAGTGTG GGG Intergenic
No off target data available for this crispr