ID: 1008237418

View in Genome Browser
Species Human (GRCh38)
Location 6:49067022-49067044
Sequence TGGCTATTCTGGGTCTTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008237418_1008237425 27 Left 1008237418 6:49067022-49067044 CCATAAAAGACCCAGAATAGCCA No data
Right 1008237425 6:49067072-49067094 ACTGAAGTCATCATATTACCTGG No data
1008237418_1008237421 -9 Left 1008237418 6:49067022-49067044 CCATAAAAGACCCAGAATAGCCA No data
Right 1008237421 6:49067036-49067058 GAATAGCCAATGCCATCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008237418 Original CRISPR TGGCTATTCTGGGTCTTTTA TGG (reversed) Intergenic
No off target data available for this crispr