ID: 1008237421

View in Genome Browser
Species Human (GRCh38)
Location 6:49067036-49067058
Sequence GAATAGCCAATGCCATCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008237418_1008237421 -9 Left 1008237418 6:49067022-49067044 CCATAAAAGACCCAGAATAGCCA No data
Right 1008237421 6:49067036-49067058 GAATAGCCAATGCCATCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008237421 Original CRISPR GAATAGCCAATGCCATCCTG AGG Intergenic
No off target data available for this crispr