ID: 1008237572

View in Genome Browser
Species Human (GRCh38)
Location 6:49068915-49068937
Sequence GTATATGTGCATATACATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008237570_1008237572 1 Left 1008237570 6:49068891-49068913 CCAGATATTGGTAAGTCTGGTGT No data
Right 1008237572 6:49068915-49068937 GTATATGTGCATATACATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008237572 Original CRISPR GTATATGTGCATATACATAT GGG Intergenic
No off target data available for this crispr