ID: 1008237572 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:49068915-49068937 |
Sequence | GTATATGTGCATATACATAT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1008237570_1008237572 | 1 | Left | 1008237570 | 6:49068891-49068913 | CCAGATATTGGTAAGTCTGGTGT | No data | ||
Right | 1008237572 | 6:49068915-49068937 | GTATATGTGCATATACATATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1008237572 | Original CRISPR | GTATATGTGCATATACATAT GGG | Intergenic | ||
No off target data available for this crispr |