ID: 1008239538

View in Genome Browser
Species Human (GRCh38)
Location 6:49092465-49092487
Sequence ATGTTTCAGGACATTGATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008239538_1008239543 16 Left 1008239538 6:49092465-49092487 CCTAGATCAATGTCCTGAAACAT No data
Right 1008239543 6:49092504-49092526 TCTAGTAGTTTTATAATGTTGGG No data
1008239538_1008239542 15 Left 1008239538 6:49092465-49092487 CCTAGATCAATGTCCTGAAACAT No data
Right 1008239542 6:49092503-49092525 TTCTAGTAGTTTTATAATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008239538 Original CRISPR ATGTTTCAGGACATTGATCT AGG (reversed) Intergenic
No off target data available for this crispr