ID: 1008242256

View in Genome Browser
Species Human (GRCh38)
Location 6:49127714-49127736
Sequence CTGTGCAAGGGCAGTGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008242248_1008242256 24 Left 1008242248 6:49127667-49127689 CCTGTCAGGCAGAGGTTTGCTGC No data
Right 1008242256 6:49127714-49127736 CTGTGCAAGGGCAGTGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008242256 Original CRISPR CTGTGCAAGGGCAGTGTGGA AGG Intergenic
No off target data available for this crispr