ID: 1008246441

View in Genome Browser
Species Human (GRCh38)
Location 6:49179705-49179727
Sequence TTTTCCTCATATATGGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008246441_1008246444 26 Left 1008246441 6:49179705-49179727 CCATGTTCCATATATGAGGAAAA No data
Right 1008246444 6:49179754-49179776 CATGTCACTCAGTTAGTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008246441 Original CRISPR TTTTCCTCATATATGGAACA TGG (reversed) Intergenic
No off target data available for this crispr