ID: 1008246455

View in Genome Browser
Species Human (GRCh38)
Location 6:49179992-49180014
Sequence TTCTAAATGCATAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008246455_1008246459 3 Left 1008246455 6:49179992-49180014 CCTTCCTCCCTATGCATTTAGAA No data
Right 1008246459 6:49180018-49180040 TACTAATTATGTATCATCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008246455 Original CRISPR TTCTAAATGCATAGGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr