ID: 1008265886

View in Genome Browser
Species Human (GRCh38)
Location 6:49425790-49425812
Sequence CAGAGAAAAAAGTAGAATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008265886_1008265889 12 Left 1008265886 6:49425790-49425812 CCACCATTCTACTTTTTTCTCTG No data
Right 1008265889 6:49425825-49425847 CTATAGAAACCTCATACAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008265886 Original CRISPR CAGAGAAAAAAGTAGAATGG TGG (reversed) Intergenic
No off target data available for this crispr