ID: 1008269839

View in Genome Browser
Species Human (GRCh38)
Location 6:49478316-49478338
Sequence GAAATAGATTTATTTACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 311}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008269839_1008269841 18 Left 1008269839 6:49478316-49478338 CCTGCAGTAAATAAATCTATTTC 0: 1
1: 0
2: 4
3: 32
4: 311
Right 1008269841 6:49478357-49478379 TCTCCCAAATTGCTATTTCTGGG 0: 1
1: 1
2: 0
3: 21
4: 226
1008269839_1008269840 17 Left 1008269839 6:49478316-49478338 CCTGCAGTAAATAAATCTATTTC 0: 1
1: 0
2: 4
3: 32
4: 311
Right 1008269840 6:49478356-49478378 ATCTCCCAAATTGCTATTTCTGG 0: 1
1: 1
2: 1
3: 21
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008269839 Original CRISPR GAAATAGATTTATTTACTGC AGG (reversed) Intronic
905388109 1:37618287-37618309 TAAACAGATTTCTTTACTGCAGG + Intronic
906928622 1:50146498-50146520 ATAATAGATTTATTTACTGAGGG - Intronic
907886689 1:58598463-58598485 GTAAGGGATTTATTTATTGCAGG - Intergenic
908466792 1:64404009-64404031 TAAATAGGTCTCTTTACTGCAGG + Intergenic
908552167 1:65220344-65220366 GAAATAGAAACATTTATTGCTGG - Intronic
908827440 1:68147174-68147196 GGAATATAGTTATTTTCTGCAGG + Intronic
909372920 1:74907281-74907303 GAAATAGAATTATTTAATGTTGG + Intergenic
909458545 1:75879451-75879473 TAAGTAGATTTATTTACTTCAGG - Intronic
910321967 1:85956241-85956263 GAAATAAATATATTTATTGAAGG - Intronic
911240597 1:95461665-95461687 GCAATACTTTTATTTACTGTAGG + Intergenic
911801090 1:102139377-102139399 GAAATAGATTTATATCCTGAAGG + Intergenic
912621061 1:111158632-111158654 TAAATGGATTTCTTTACTACAGG - Intronic
912638037 1:111317322-111317344 GAAACAAATTTCTATACTGCTGG + Intronic
913189996 1:116405425-116405447 GAAAGAGATGTGTTTACTTCAGG + Intronic
914308582 1:146445708-146445730 GAGAGAGCTTTATTTATTGCGGG + Intergenic
914593527 1:149127422-149127444 GAGAGAGCTTTATTTATTGCGGG - Intergenic
917051327 1:170927509-170927531 TAAATACATTTATTTACCACAGG + Intergenic
917636370 1:176940878-176940900 GAAAAGGATTTCTTTACTGCAGG + Intronic
917756755 1:178109101-178109123 GACATAGCTTTATTTACTCCAGG + Intronic
917993849 1:180413438-180413460 AAAATATATTTGATTACTGCAGG - Exonic
918088469 1:181265639-181265661 GATAAATATTTATTTGCTGCAGG - Intergenic
918274948 1:182944901-182944923 GCAATACAATTATTGACTGCTGG - Intronic
918770559 1:188553125-188553147 GAAATAGATATAAATACTGAAGG - Intergenic
919145341 1:193627058-193627080 GAAAAATCTTTCTTTACTGCAGG - Intergenic
919204466 1:194403827-194403849 GACATAGATTCATATACTCCAGG + Intergenic
919447350 1:197724967-197724989 TAAATAGATTTATTTTATTCTGG - Intronic
919567187 1:199203138-199203160 TAAACAGGTTTATTTACTACAGG + Intergenic
920817395 1:209347780-209347802 GAAATAAAGTAATTTATTGCTGG - Intergenic
922130044 1:222768634-222768656 GAAATAGGATTCTCTACTGCAGG - Intergenic
922325728 1:224526509-224526531 GAAATAGATTTCTTTTTTGCGGG + Intronic
924838748 1:247684779-247684801 TAAATACATGTATTTATTGCTGG + Intergenic
1063312073 10:4962246-4962268 GAAATAAACTTATTTATTTCTGG - Intronic
1063315816 10:5005010-5005032 GAAATAAACTTATTTATTTCTGG + Intronic
1065454330 10:25891532-25891554 GAAGTAGTTTTACTTACAGCAGG - Intergenic
1067992631 10:51232365-51232387 GAATTAGATTTGGTTACTGAAGG + Intronic
1068391505 10:56403187-56403209 GAAGTAGATTTATTTCTTCCTGG - Intergenic
1069103758 10:64357462-64357484 GAAATATATGTATTTTCTGTAGG + Intergenic
1069384961 10:67875832-67875854 GATCTAGGTTTATATACTGCTGG + Intergenic
1071979596 10:90990450-90990472 GAAACAGATTTATTAACTAAGGG - Intergenic
1072558573 10:96546445-96546467 GAAACAGATTTATTTAAAACAGG - Intronic
1072739338 10:97900411-97900433 AATACAGGTTTATTTACTGCAGG - Intronic
1072761301 10:98059206-98059228 GAATTAGATGCATTTAATGCTGG - Intergenic
1074231953 10:111546441-111546463 GGAACAGATTTCTTTACAGCAGG - Intergenic
1076160392 10:128239766-128239788 GAAACAGAGGTAGTTACTGCAGG - Intergenic
1077449830 11:2633674-2633696 TAAATAAATTTATTTACTTCTGG + Intronic
1077665456 11:4104392-4104414 GAAACACATTTATTTTCTGTTGG + Intronic
1080086021 11:28283289-28283311 GAAATAAAATTATTTATTCCTGG + Intronic
1080342907 11:31288452-31288474 GAAATCCATTTATTTACTTTAGG - Intronic
1080437290 11:32256949-32256971 TAAATAGGTTTCTTTCCTGCAGG + Intergenic
1080629396 11:34059802-34059824 GAAATTGATTTTTTTCCTGAAGG + Intronic
1081077224 11:38692731-38692753 GAAATAGATTTTTTCAGGGCTGG + Intergenic
1081157489 11:39713301-39713323 GAAATAGAATAATTTTCTTCGGG - Intergenic
1081829043 11:46090566-46090588 TAAACAGGTTTCTTTACTGCAGG - Intronic
1082948288 11:58784051-58784073 GAAATTCATCTATTTACTCCAGG - Intergenic
1086069991 11:82789617-82789639 GGAATTGATTCATTTACTCCAGG - Intergenic
1087585788 11:100119962-100119984 AAAATAGATATATTTACAACTGG + Intronic
1087981423 11:104618709-104618731 GTAATAGATTTTTTTCCTGAAGG + Intergenic
1088161819 11:106880700-106880722 TACATAGATTTCTTTACTGTAGG + Intronic
1088464229 11:110116163-110116185 GAAATACATTGATTTAATGGTGG - Intronic
1089020602 11:115210152-115210174 GAAGTAGTTTTACTTCCTGCTGG - Intronic
1089522177 11:119072312-119072334 AAAATGGATGTTTTTACTGCAGG + Intronic
1091819710 12:3466788-3466810 GACATCGATTTGTTTAATGCAGG - Intronic
1092853560 12:12652507-12652529 GAAATATATTTATTTCATTCAGG - Intergenic
1093540602 12:20279499-20279521 GAAATGCATTTTTTTACTGTTGG - Intergenic
1093565054 12:20592364-20592386 GAATTCCTTTTATTTACTGCAGG - Intronic
1093814128 12:23522564-23522586 GAAATACATTTATTTACCTTTGG + Intergenic
1093926702 12:24915779-24915801 TAAATAGATATATTTTCTACAGG + Intronic
1093942449 12:25069317-25069339 GAAGTAGAGTTATTTACTACAGG - Intronic
1095792904 12:46186689-46186711 AAAATAGATTTATTTAGAGGAGG - Intronic
1097472130 12:60007673-60007695 GAAACAGAGTAATTTACAGCAGG - Intergenic
1098631803 12:72732419-72732441 GAAGTGGATTTATTATCTGCAGG + Intergenic
1099264020 12:80420998-80421020 AAAATACATGTTTTTACTGCAGG - Intronic
1099271500 12:80516094-80516116 GAAATCCATTTATTTAATGGTGG - Intronic
1099351580 12:81576631-81576653 GATAGAGATTTATTTACTTTTGG - Intronic
1100006640 12:89902534-89902556 GAAACAGATTTGTTTTCTGGTGG - Intergenic
1102837179 12:116075708-116075730 GAAATAGACTTCCTTTCTGCTGG + Intronic
1102922449 12:116802226-116802248 GAAATGAATTTCTTTATTGCGGG - Intronic
1104646291 12:130500050-130500072 GAAATGGATTTGTTTACCTCAGG - Intronic
1105802922 13:23925374-23925396 GAAATTTATTTATTTATTTCTGG + Intergenic
1106260941 13:28066211-28066233 GAAATAGATTTACTAACTAAAGG - Intronic
1106346536 13:28885072-28885094 GAAATTTATTTATTTACTTGGGG - Intronic
1106961410 13:35002749-35002771 GAAACAGATTTGTATACTACAGG - Intronic
1107301816 13:38974030-38974052 GAAGTAGATGTGTTTACAGCAGG - Intronic
1107487981 13:40849370-40849392 GAAACAGATTCATGTTCTGCAGG + Intergenic
1107621492 13:42235763-42235785 GTAATATATTTATCTACAGCTGG + Intronic
1107948743 13:45443456-45443478 GCCATAGATTTAGCTACTGCTGG - Intergenic
1108448938 13:50540721-50540743 CAAGCAGGTTTATTTACTGCTGG + Intronic
1108862407 13:54878105-54878127 AAAGTAGATTTATGTACTGAAGG - Intergenic
1109309027 13:60671219-60671241 AAAAAAGATTTATTTTTTGCAGG + Intergenic
1109611234 13:64767277-64767299 GTAATAGAGTTCTTCACTGCAGG - Intergenic
1109748595 13:66659939-66659961 GAAATAAGCTTATTAACTGCTGG + Intronic
1109753029 13:66721392-66721414 TAAACAGATATCTTTACTGCAGG - Intronic
1109772183 13:66990797-66990819 GAAATATATTGATTATCTGCTGG - Intronic
1110082503 13:71333696-71333718 GAAAGACATTTATTTACTTAAGG + Intergenic
1110686798 13:78384995-78385017 GAAATAAATTTATGTTCTGATGG - Intergenic
1111042237 13:82763995-82764017 GAAATAGATTTAAGTATTTCAGG - Intergenic
1111541595 13:89674519-89674541 TAAATATATTTATTTACAACAGG - Intergenic
1111667171 13:91284065-91284087 TAAATAGATTTTTTTAATTCTGG - Intergenic
1112035889 13:95496344-95496366 TAAATAGCTTCCTTTACTGCAGG + Intronic
1113044309 13:106138435-106138457 GGAATAGATTTATTTGATGGTGG - Intergenic
1115164233 14:30429990-30430012 TAAATAGGTTTCTTTATTGCAGG - Intergenic
1117088939 14:52230098-52230120 GAAACAGTTTTATTTCCAGCAGG + Intergenic
1119896821 14:78226958-78226980 CAAATGCATTTAATTACTGCAGG + Intergenic
1120403045 14:84056297-84056319 GAAATAGAGTCACTTACTGTGGG + Intergenic
1121364863 14:93299852-93299874 CAAATAGGTTTCTTTACTTCAGG + Intronic
1121366979 14:93321988-93322010 GAAATACTTTTATTTCCTTCAGG - Intronic
1122450236 14:101799933-101799955 GATATAGATTAAGTCACTGCAGG - Intronic
1124063816 15:26320943-26320965 GAAATACATTTCTTTATTGTAGG - Intergenic
1124108361 15:26762625-26762647 AAAATAGGTTTCTTTGCTGCAGG - Intronic
1124434530 15:29635952-29635974 CAAATAGATTTATGTTCTGGAGG - Intergenic
1124643116 15:31411244-31411266 AAAAAAGATTTATATATTGCTGG - Intronic
1126281367 15:46954771-46954793 AAAATATATTTATGTACTACAGG + Intergenic
1127649089 15:60988780-60988802 GACCTAGATTTATCTACTCCAGG + Intronic
1127999868 15:64180733-64180755 GAAATAGGTTTTTTTACAGATGG + Intronic
1128692841 15:69738380-69738402 TAGACAGGTTTATTTACTGCAGG - Intergenic
1128779120 15:70346307-70346329 AAAAAAGATTTCTTTGCTGCAGG + Intergenic
1129762263 15:78136701-78136723 GAAAAAGATTTTCTTACTGGAGG + Intronic
1130153924 15:81333426-81333448 TAAACAGTTTTCTTTACTGCTGG + Intronic
1130323663 15:82861100-82861122 GAAAAAGCCTTATTCACTGCAGG + Intronic
1130807289 15:87338048-87338070 GAAATAGATTAACTTTCTGAAGG + Intergenic
1130941419 15:88512690-88512712 GAAATGGACTTAATTAATGCTGG + Exonic
1133523784 16:6584164-6584186 AAAATAGATGTAATTACAGCAGG - Intronic
1137879820 16:52034451-52034473 GAAATAAATTCATGTACTGGTGG + Intronic
1138307043 16:55987918-55987940 GAAATAGATTAATCTACTCATGG + Intergenic
1139102754 16:63788151-63788173 GAAATATATTTGTTTATTGGTGG - Intergenic
1139155484 16:64436886-64436908 GATATGGATGTATTTACTTCTGG - Intergenic
1139223847 16:65214788-65214810 TATACACATTTATTTACTGCAGG + Intergenic
1139443714 16:66983238-66983260 GACATAGTTGGATTTACTGCTGG + Intergenic
1139904033 16:70350726-70350748 GAATTAGATTTTGTTACTGAAGG + Intronic
1141232364 16:82181057-82181079 GAAAAAGATTTTGTTAATGCAGG - Intergenic
1141368823 16:83468521-83468543 GAAATAGATTTAGTGAGTGAAGG + Intronic
1144225603 17:13142186-13142208 TAAGAAGCTTTATTTACTGCAGG - Intergenic
1145368142 17:22282251-22282273 GTAATAAAATTATTTTCTGCTGG + Intergenic
1146988841 17:37248501-37248523 GAAAAAGTTTGATTTAATGCAGG - Intronic
1149384544 17:56128697-56128719 GACATAGGTTTCTTTACTGTAGG - Intronic
1149538382 17:57450196-57450218 GAAAAAGATTTATTTCCTTCTGG + Intronic
1151099942 17:71545254-71545276 GAAATAGACCTACTTACAGCGGG - Intergenic
1151981750 17:77515471-77515493 AAAATAGATATATTTAATGAGGG + Intergenic
1152164110 17:78690428-78690450 AAAAGAAATGTATTTACTGCTGG + Intronic
1154933457 18:21026025-21026047 TAAATAAAGTTATTAACTGCTGG + Intronic
1155292530 18:24356235-24356257 GACATAGAACTATTTACTGAAGG + Intronic
1155587104 18:27379115-27379137 GAAATGGATTTATTTACTCCAGG + Intergenic
1155799728 18:30086231-30086253 GAAATAAATTCATCTACTGATGG - Intergenic
1156697796 18:39788437-39788459 GAAATGGATTAATTTGCTGGAGG + Intergenic
1157363382 18:47040054-47040076 GGATTAGCTTTATTTACAGCAGG + Intronic
1158740984 18:60141912-60141934 GAAATAGAATTACCTACTTCTGG + Intergenic
1159213383 18:65359226-65359248 AAAACAGATTTATTTTTTGCCGG + Intergenic
1159534123 18:69693754-69693776 TAAATAGATCTATTTTATGCAGG - Intronic
1159948259 18:74459396-74459418 GAAAAGGATTTCTTTACTGTGGG - Intergenic
1160517178 18:79485039-79485061 GAAATGCTTTTGTTTACTGCAGG + Intronic
1165280877 19:34796214-34796236 GAAACAGGTTTATTTAATCCTGG + Intergenic
925104162 2:1275336-1275358 GTGATAGATTTGCTTACTGCAGG - Intronic
927444841 2:23150146-23150168 AAAAAAGATTGTTTTACTGCTGG + Intergenic
928764953 2:34635122-34635144 GAAAAATATTTATTTTCTGTAGG - Intergenic
930197157 2:48521501-48521523 TAAAAAAAATTATTTACTGCTGG + Intergenic
931951311 2:67365758-67365780 GACATAGATATTTTGACTGCTGG - Intergenic
935439767 2:103078592-103078614 GAAAGAGACTTTTTTAATGCAGG + Intergenic
935923922 2:108046685-108046707 GAAATTGATTTTTTTTCTTCTGG - Intergenic
937612384 2:123877893-123877915 CAAACATACTTATTTACTGCAGG - Intergenic
937849162 2:126617523-126617545 GAATGAGATTTATTTCATGCTGG - Intergenic
938734537 2:134174355-134174377 GGAATGGATTTAGTTACTGTGGG + Intronic
939410219 2:141815219-141815241 GAAATAGATTGATTTTTAGCTGG + Intronic
940477183 2:154177929-154177951 GAATTTGATTTATATACTTCTGG + Intronic
940538313 2:154976146-154976168 GAAATAGTTTTATTTGATGAGGG - Intergenic
940806195 2:158189539-158189561 AAAATAAATTTATTTATGGCAGG + Intronic
940811609 2:158249169-158249191 GAAACAGTTTCATTTACTGGGGG - Intronic
941276195 2:163493716-163493738 GAGAGTGATTTATTTACAGCAGG + Intergenic
941430846 2:165412167-165412189 GAAATAGATTAATCACCTGCTGG - Intergenic
942378522 2:175362046-175362068 GAAATGGATTTATGTACTTGTGG + Intergenic
943909993 2:193551632-193551654 AAGATAGATTTATAGACTGCTGG + Intergenic
945478186 2:210311328-210311350 CAAATACATTTACTTACTGATGG - Intronic
947090276 2:226502520-226502542 TAAATACATTTATTTATTTCTGG - Intergenic
948620233 2:239229995-239230017 AAAATACTTTTATTTCCTGCAGG + Intronic
1169014579 20:2281189-2281211 TAGATAGATGTCTTTACTGCAGG - Intergenic
1172919161 20:38466967-38466989 CTAATACATTTATTTAATGCTGG + Intergenic
1173064185 20:39694065-39694087 GAAAAAGGTTTCTTTACTGCAGG - Intergenic
1175211749 20:57362539-57362561 GAAATAGAATTAACTAATGCAGG + Intronic
1176738691 21:10576483-10576505 TAAATAGTTTTATATACTTCAGG - Intronic
1177142035 21:17367825-17367847 GAAATAGATATATTTAGTTCAGG + Intergenic
1177679254 21:24342746-24342768 GAAATAAAGTTATTAAATGCTGG + Intergenic
1178967223 21:37132254-37132276 GAAAAAAATATATTTACTGAAGG - Intronic
1179385664 21:40939796-40939818 GAAATAGATTTATTCATGGTTGG - Intergenic
1180828892 22:18887460-18887482 GAAATAAATATAATTAATGCTGG - Intergenic
1181568909 22:23756306-23756328 GAAAAAGAGTTATTTACTATCGG - Intergenic
1203278982 22_KI270734v1_random:113448-113470 GAAATAAATATAATTAATGCTGG - Intergenic
949892993 3:8746995-8747017 TAAACAGGTTTATCTACTGCAGG - Intronic
951105421 3:18736528-18736550 GGAAAAGTTTTATTTTCTGCTGG - Intergenic
952525086 3:34201557-34201579 CAGATAGTTTTACTTACTGCAGG - Intergenic
953142475 3:40241586-40241608 TAAACAGATTTCTTTACTGCAGG - Intronic
953970158 3:47341135-47341157 TAAACAGAGTTATTTACTGCAGG - Intronic
955849888 3:63208865-63208887 TAAATAGATTTCTTTATTGAGGG - Intergenic
956257047 3:67294229-67294251 TAAATAGGTTTTTCTACTGCAGG - Intergenic
956369780 3:68546427-68546449 AAAATAGAGATATTTACTGGGGG + Intergenic
957649783 3:82985010-82985032 GAAATAGCCTTATTTACTGCAGG - Intergenic
958711868 3:97726433-97726455 GAAATATAAATATTTTCTGCAGG + Intronic
958897993 3:99851516-99851538 GCAATAATTTTATTTACTTCAGG + Intronic
959252164 3:103962942-103962964 GAAAAATATTTCTTTTCTGCTGG + Intergenic
959280667 3:104334578-104334600 GCAATAAATTTTTTTAATGCGGG + Intergenic
959465402 3:106680335-106680357 AAAATAGATCTATATACGGCCGG - Intergenic
959790381 3:110354081-110354103 GAAATAGGTCTAGATACTGCAGG - Intergenic
960230948 3:115226693-115226715 TAAATAGATTTCTTGACTGCAGG - Intergenic
960428805 3:117543491-117543513 CAAACATATTTATTTACTGTGGG - Intergenic
961104779 3:124231693-124231715 AAAATAAAGTTCTTTACTGCAGG - Intronic
961188080 3:124933292-124933314 GAAATATTTTTATTTCCTTCAGG - Intronic
962348175 3:134637482-134637504 CAAATAGAGTTCTTTACTACAGG - Intronic
962402187 3:135069949-135069971 CAAACAGATGTCTTTACTGCAGG + Intronic
963747323 3:149137996-149138018 AAAATTTATTTATTTACTGGGGG + Intronic
964103321 3:153013332-153013354 TATATAGATTTATTTCCTGATGG - Intergenic
964169536 3:153753366-153753388 TATTTAGATTTATTTACTGTGGG - Intergenic
965259102 3:166457169-166457191 GAAATAGTTGTAGGTACTGCTGG - Intergenic
966372002 3:179260415-179260437 GACATAGAGGTATTCACTGCTGG - Intronic
967049282 3:185767474-185767496 TAAACAGATTTCTTTACTACAGG + Intronic
967500684 3:190193988-190194010 ATAATAAATTTATTTACTACAGG - Intergenic
969222676 4:5771600-5771622 GAAATAAATTTGTTTATTGAAGG + Intronic
970526321 4:16935915-16935937 TAAATAGATTTACTTTTTGCAGG + Intergenic
970657668 4:18249391-18249413 GAAAGAGATTTATTTATTGCAGG + Intergenic
971088842 4:23315458-23315480 GAAATAGATTAATTTGTTACTGG - Intergenic
971198247 4:24489437-24489459 CAAACAGGTTTCTTTACTGCAGG - Intergenic
972110857 4:35557603-35557625 AATATATATTTCTTTACTGCTGG - Intergenic
972398273 4:38675661-38675683 CAACTGGATTGATTTACTGCCGG + Intronic
973630406 4:52815112-52815134 GAAAAGGATTAATTTACAGCGGG - Intergenic
976952050 4:90845400-90845422 GAAATAGATTTATTGAAACCTGG + Intronic
977334527 4:95679769-95679791 GAAATAGATTAATTTCTTTCTGG + Intergenic
977495718 4:97772779-97772801 AAAATAGATTAATTTACTTTTGG - Intronic
977739201 4:100457101-100457123 GATATAGATGTATTTATTTCAGG + Intronic
978575482 4:110185893-110185915 GAAAATGATTTATTTAAGGCTGG + Intronic
979070745 4:116203396-116203418 GAAATTGTATTATTTACTGAAGG + Intergenic
979762284 4:124421093-124421115 TAATTAGAAGTATTTACTGCAGG - Intergenic
979952769 4:126915085-126915107 TAAGTAGATTTCTTTACTCCAGG - Intergenic
981118912 4:141025590-141025612 GAAATAAATTTATTTAAAACAGG + Intronic
983196486 4:164812312-164812334 GGAATAGATTTAATTTCTGGTGG + Intergenic
984421137 4:179523421-179523443 TAAACAGGTTTATTTACTGGAGG + Intergenic
984490339 4:180426693-180426715 TAAACACATTTCTTTACTGCAGG + Intergenic
984613016 4:181862514-181862536 GAGATATATTTTTTTTCTGCAGG - Intergenic
985149985 4:186937080-186937102 TAAACAGAATTATATACTGCAGG + Intergenic
988000090 5:25336464-25336486 AAAATTGATTTAGTTACTGATGG - Intergenic
988214870 5:28258595-28258617 TAAATAGATTAAATTCCTGCTGG + Intergenic
988342757 5:29995483-29995505 GAGATATGTTTATTTCCTGCAGG + Intergenic
988567130 5:32328372-32328394 AAAATTAATTTATTTACTGTTGG - Intergenic
988612740 5:32742874-32742896 GACATAGATTTTTTTACTTTAGG + Intronic
989638312 5:43558463-43558485 AAAATTGATTTCTTTACTGTTGG + Intergenic
991637981 5:68725219-68725241 TAAACAGATTTCTTTTCTGCTGG - Intergenic
993021355 5:82595378-82595400 GCATTAGAGTTATTTATTGCTGG + Intergenic
993626911 5:90236574-90236596 GAAACAGATGAATTTAGTGCAGG + Intergenic
996248051 5:121289764-121289786 TAAATAGCTTTATTTACTTCAGG + Intergenic
999341352 5:150776501-150776523 CAAATATATTTATTTACTTTTGG - Intergenic
999454367 5:151702655-151702677 GAAATGGATCTATATACTCCCGG - Intergenic
999718356 5:154380063-154380085 GAAAAAGATTGATTTCCTTCTGG - Intronic
1000598734 5:163246782-163246804 GTAATAGCTTTCTTTACTCCAGG - Intergenic
1001033934 5:168283355-168283377 TAAATAGATTTCTTTCCTGTGGG - Intergenic
1002774437 6:316718-316740 GAAATAGTTTTGTTTCCTGCAGG - Intronic
1004715072 6:18208986-18209008 AAAATAGATTTCTTTAATGCAGG - Intronic
1004735372 6:18400619-18400641 GAAATAGATTGAGTTCCTGTAGG + Intronic
1004912063 6:20295636-20295658 AAAATAGAAATATTTATTGCGGG + Intergenic
1005372987 6:25154328-25154350 GGAATGGATTTATTAACTACAGG - Intergenic
1005670253 6:28098548-28098570 AAACTAGTTTTATTTACTGAAGG - Intergenic
1007126198 6:39427626-39427648 TAAAAAGACTGATTTACTGCTGG + Intronic
1008153341 6:47983258-47983280 GAAATTCATTTTTCTACTGCAGG - Intronic
1008269839 6:49478316-49478338 GAAATAGATTTATTTACTGCAGG - Intronic
1008593401 6:53016714-53016736 GAAACACCTTTCTTTACTGCTGG - Intronic
1008606243 6:53142435-53142457 TAAACAGATTTCTTGACTGCAGG - Intronic
1009842511 6:69093996-69094018 GAACTAGAGTGATTGACTGCAGG + Intronic
1010740733 6:79500761-79500783 GAAATGGATTTATTTCCTGAGGG - Intronic
1011248888 6:85349342-85349364 GGAATAGAGTTATTTAGTGCAGG - Intergenic
1011676566 6:89740292-89740314 GAAATAGAGCTGTTGACTGCTGG - Exonic
1012234264 6:96795007-96795029 TAAATAGATATATTTTCTACAGG + Exonic
1013043423 6:106459880-106459902 AAAACAGACTTATTTACTGTTGG - Intergenic
1013277197 6:108596813-108596835 AAAACAGGTTTCTTTACTGCAGG - Intronic
1013381861 6:109580957-109580979 GAAATAGAGTTGCTTATTGCAGG - Intronic
1013972338 6:116036336-116036358 CAAATATACTTACTTACTGCTGG + Intronic
1014997632 6:128170326-128170348 GAAATAGACTTATCTATTGATGG - Intronic
1015132221 6:129825453-129825475 AAAACAGATTTATTTATTTCAGG - Intergenic
1015680755 6:135805731-135805753 GAGAAAGAATTATTTAGTGCAGG + Intergenic
1016009884 6:139128305-139128327 TAAACAGGTTTCTTTACTGCTGG + Intergenic
1016467351 6:144338957-144338979 TAAACATATGTATTTACTGCAGG + Intronic
1016867292 6:148779810-148779832 GAAAAGGATTTCTTTCCTGCAGG - Intronic
1018533248 6:164790340-164790362 GAAATCCATTTATTTCCTTCAGG - Intergenic
1018564713 6:165139174-165139196 GAATTAGATTTATTTACCACAGG - Intergenic
1020413426 7:7918067-7918089 GAAACAGAGTTGTTAACTGCTGG - Intronic
1021269239 7:18564940-18564962 AAAATACATTTATTTGATGCTGG - Intronic
1022583005 7:31575523-31575545 GTAATAGGTTTATTTACTGCAGG + Intronic
1023267419 7:38421896-38421918 GAAATAGAAATAGTTACTCCTGG - Intronic
1023304549 7:38811172-38811194 GAAATAGATTTATTTAGTTGAGG - Intronic
1023667770 7:42542520-42542542 AAAATATATTTATTTCCTTCAGG + Intergenic
1024193647 7:47037523-47037545 TAAATATATTTCTTTACTGTGGG - Intergenic
1024375179 7:48629348-48629370 GAAATGGATTTCTTTATTCCAGG + Intronic
1024724425 7:52176498-52176520 GACATAGATTTGTTTTGTGCTGG + Intergenic
1026620534 7:71946267-71946289 GAATTAGATTTTTTTACTCAGGG - Intronic
1026666315 7:72342758-72342780 GAAGTAGATATATTTACTGATGG - Intronic
1027432465 7:78128703-78128725 GCAATAGATGTATTTACTTGGGG + Intronic
1030793100 7:113753792-113753814 GAAATAGAATTTTTTTCTGCAGG + Intergenic
1031392616 7:121234110-121234132 GAAATCAATTTTTTTAATGCTGG + Intronic
1031943810 7:127817512-127817534 GAATCAGATTTTTTTTCTGCAGG - Intronic
1032254349 7:130285148-130285170 GAGATATATTTATTGACTGTGGG + Intronic
1032542124 7:132711910-132711932 GAAATAGAGTAGTTTAGTGCAGG - Intronic
1033627681 7:143126963-143126985 GAAATAGTTTTGTTTTCTTCAGG - Intergenic
1033825161 7:145180309-145180331 GTAATAGATCTATTTTCTGCAGG - Intergenic
1034109749 7:148525588-148525610 GAAATTTATTTATTTCATGCTGG + Intergenic
1034595023 7:152181531-152181553 GCAAAAGATTCATTCACTGCTGG + Exonic
1034636780 7:152573740-152573762 GAAAAAGATTTATTTTTTCCAGG + Intergenic
1036030225 8:4962883-4962905 GAGATAGATTTATTTTTTACAGG - Intronic
1037062819 8:14537155-14537177 GCAATAGAGTTATCTCCTGCAGG + Intronic
1037156604 8:15708080-15708102 GAAACAGATTTAATTAGTTCAGG - Intronic
1039565733 8:38551407-38551429 GAAAATGTTTTATTTACTGCTGG + Intergenic
1039654216 8:39381637-39381659 GAAATAGGTGAATTTACTGGAGG - Intergenic
1039744809 8:40414948-40414970 CAAACACATTTATTTACTACTGG + Intergenic
1040906062 8:52470854-52470876 TAAGGAGATATATTTACTGCAGG + Intergenic
1042942418 8:74121023-74121045 GAAATTGATTTCTTTACAGCAGG - Intergenic
1043014326 8:74919661-74919683 GAAATAGATTTTTCTGCGGCAGG - Intergenic
1043157289 8:76799578-76799600 GAAACAGATTTATTTAGTTATGG - Intronic
1043160141 8:76836898-76836920 GAAATAGTATGATTTACTGATGG + Intronic
1043519064 8:81025296-81025318 TAAATTGATTTACTTATTGCAGG - Intronic
1043681537 8:83032900-83032922 CAACAAGAATTATTTACTGCTGG - Intergenic
1044221135 8:89671155-89671177 GAAACAGACTTTTCTACTGCAGG + Intergenic
1044288921 8:90444702-90444724 GAAATATAGATATTTACTGGTGG - Intergenic
1044320660 8:90797230-90797252 TAAATTGATGTAATTACTGCAGG - Intronic
1044616000 8:94142030-94142052 GAAATAGATTTATGTATAGGTGG + Intronic
1045156718 8:99483428-99483450 TAAATAGCTTTTTTTACTGCAGG - Intronic
1045160778 8:99541650-99541672 GAGATAGATTTATTTACTTTCGG - Intronic
1046144488 8:110140677-110140699 TAAAGAGATTTATTTGCTGTGGG - Intergenic
1051042557 9:12830166-12830188 GAAATAAGTTTGTTTACTTCTGG + Intergenic
1051520131 9:17977752-17977774 GAAGAAGATGTATTTTCTGCTGG + Intergenic
1051591520 9:18780468-18780490 TAAACAGATGTATGTACTGCTGG + Intronic
1051864240 9:21661551-21661573 GAAATATATATATTTCCTTCTGG + Intergenic
1052000021 9:23266962-23266984 GAATTACATTTATATACTGGTGG - Intergenic
1052350430 9:27453259-27453281 GAAATTGATTTCTTTACCACAGG - Intronic
1053315736 9:37050016-37050038 GAAACAGATTTATTTATTAAAGG + Intergenic
1054954468 9:70892682-70892704 GAAATATATTTATTTAGAACTGG - Intronic
1056092873 9:83221395-83221417 TAAATGTATTTCTTTACTGCAGG + Intergenic
1056443023 9:86639186-86639208 AAAAAAGATTTCTTTAATGCAGG + Intergenic
1057364364 9:94405148-94405170 GACATATATGTATTTACTTCTGG + Intronic
1057658967 9:96982920-96982942 GACATATATGTATTTACTTCTGG - Intronic
1058221310 9:102306915-102306937 GAAATATATCTATTTACTCTTGG + Intergenic
1058306537 9:103449427-103449449 GAAATAGAATGATTTTTTGCAGG + Intergenic
1059249354 9:112874650-112874672 GAAAGTGATTTATTTACAGATGG + Exonic
1059703804 9:116801284-116801306 GAAAAAGATAAATTTACGGCTGG + Intronic
1059927410 9:119224476-119224498 AAACCACATTTATTTACTGCAGG - Intronic
1062371800 9:136243153-136243175 GAAATATTTTGATTTCCTGCAGG - Intronic
1188689165 X:33107772-33107794 AAAATAGAATTATTTAGTTCAGG + Intronic
1189102991 X:38210369-38210391 TAAATAGGTTTCTTTATTGCAGG - Intronic
1189277901 X:39800080-39800102 GAAAAAGATTTATTCAGGGCTGG - Intergenic
1190575280 X:51830631-51830653 CAAATAGATTTAACTACTGGTGG + Intronic
1194056212 X:89135782-89135804 TAAATAGGTTTATTTACTGTAGG - Intergenic
1194304740 X:92229779-92229801 AAAGTAAATTTATTTACTTCTGG + Intronic
1195592844 X:106651696-106651718 AATAGAGATTTATATACTGCAGG + Intronic
1196081476 X:111637489-111637511 GAAATAGATGTATTTCATGAAGG + Intergenic
1198640151 X:138747493-138747515 AAAATAGATTTATTTACCGTAGG - Intronic
1198885890 X:141336042-141336064 GAATTACATTTTTTTCCTGCAGG + Intergenic