ID: 1008270506

View in Genome Browser
Species Human (GRCh38)
Location 6:49483693-49483715
Sequence CCACACTTGGAGCAGCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1047
Summary {0: 2, 1: 18, 2: 110, 3: 320, 4: 597}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008270506_1008270519 29 Left 1008270506 6:49483693-49483715 CCAGCCAGCTGCTCCAAGTGTGG 0: 2
1: 18
2: 110
3: 320
4: 597
Right 1008270519 6:49483745-49483767 TACAGCTGACCTGCAAGCACCGG No data
1008270506_1008270513 3 Left 1008270506 6:49483693-49483715 CCAGCCAGCTGCTCCAAGTGTGG 0: 2
1: 18
2: 110
3: 320
4: 597
Right 1008270513 6:49483719-49483741 CTGCTAAACCCACGCCCACCTGG No data
1008270506_1008270520 30 Left 1008270506 6:49483693-49483715 CCAGCCAGCTGCTCCAAGTGTGG 0: 2
1: 18
2: 110
3: 320
4: 597
Right 1008270520 6:49483746-49483768 ACAGCTGACCTGCAAGCACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008270506 Original CRISPR CCACACTTGGAGCAGCTGGC TGG (reversed) Intronic
900113287 1:1018589-1018611 CCGCACTTGGAGCAGCCGGCCGG - Intergenic
900329822 1:2128415-2128437 CTAAACTCGGAGCAGCAGGCTGG - Intronic
900461844 1:2805440-2805462 ACACAGCGGGAGCAGCTGGCGGG - Intergenic
900463658 1:2813353-2813375 CCACACTTGGAGTGGCCGGCCGG + Intergenic
901601489 1:10426637-10426659 CCGCACTCGGAGCAGCCGGCTGG - Intergenic
901783329 1:11608840-11608862 CCGCACTCGGAGCAGCAGGCCGG + Intergenic
901849427 1:12006299-12006321 CCACACTCGGGGAAGCTGCCAGG + Intronic
902529119 1:17079163-17079185 TCACACATGGAGCAAGTGGCTGG - Intronic
902730074 1:18363447-18363469 ACACAGGTGGGGCAGCTGGCAGG + Intronic
902791687 1:18773134-18773156 CCACTGTTGGAGCAGCAGGGTGG - Intergenic
903326713 1:22573012-22573034 ACAGACAGGGAGCAGCTGGCTGG + Intronic
903679484 1:25087623-25087645 TCACACAGGGAGCAGGTGGCTGG + Intergenic
904883539 1:33718539-33718561 TCACACTTGGAGTAGCAGGTGGG - Intronic
905352402 1:37356706-37356728 CCTCACCTGCAGCAGCTGGGGGG - Intergenic
905927552 1:41762649-41762671 TGGCACTTGGAGCAGCTAGCCGG + Intronic
906259779 1:44378162-44378184 TCACAGTTGGAGCACCTGGAGGG - Intergenic
906294806 1:44643075-44643097 ACACACTTGAGGCAGCAGGCAGG - Intronic
906570196 1:46831259-46831281 TCACACTTGGAGCTGCAGACTGG + Intergenic
907407485 1:54262619-54262641 CCTCTCTTGGAGCCCCTGGCAGG - Intronic
907759511 1:57343684-57343706 CCACACTTGGAGCGGCCGGCCGG - Intronic
907761657 1:57367684-57367706 CCACACTCCGTGGAGCTGGCAGG + Intronic
907806602 1:57826729-57826751 CAATACTGGCAGCAGCTGGCAGG + Intronic
907889481 1:58623513-58623535 CCGCACTGGGAGCAGCCGGCCGG + Intergenic
907980049 1:59472211-59472233 CCGCACTTGGAGCGGTCGGCCGG + Intronic
908027768 1:59969942-59969964 CCGCACTTGGAGCAGCCGGCCGG - Intergenic
908888577 1:68817803-68817825 CCGCACTTGGAGCGGCCGGCCGG + Intergenic
909608745 1:77531998-77532020 CCGCACTCGGAGCGGCCGGCCGG - Intronic
910034780 1:82777059-82777081 CCGCACTCGGAGCAGCCAGCCGG - Intergenic
911001445 1:93170350-93170372 CCGCACTGGGAGCGGCCGGCCGG + Intronic
911110857 1:94183566-94183588 CTACATTTGGAGCACCTGGAAGG - Intronic
911259614 1:95669905-95669927 CCACACTCGGAGCAGCCGGCCGG - Intergenic
911476155 1:98375401-98375423 ACACATTTGGAACAGCTGGTAGG + Intergenic
911839266 1:102660290-102660312 CTGCACTCGGAGCAGCCGGCCGG - Intergenic
911853933 1:102853858-102853880 CCGCACTCGGAGCAGCCGGCTGG + Intergenic
912315915 1:108667558-108667580 CCGCACTCGGAGCAGCCGGCGGG + Intergenic
912475743 1:109933740-109933762 GCACTGTTGGACCAGCTGGCAGG - Intergenic
912819390 1:112854791-112854813 CGGCACTCGGAGCAGCCGGCCGG - Intergenic
913161080 1:116146833-116146855 CCGCACTCGGAGCAGCCAGCTGG - Intergenic
914438456 1:147681044-147681066 CCACACTCGGAGCAGCCGGCTGG - Intergenic
915104114 1:153521869-153521891 CCACACTCGGAGCAGCCGGCAGG + Intergenic
915260038 1:154670833-154670855 CCACACTCGGAGCAGCCGGCCGG + Intergenic
915261208 1:154678120-154678142 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
915439147 1:155933779-155933801 CCCCACCTGGGGCCGCTGGCGGG + Exonic
915865570 1:159494886-159494908 CTGCACTCGGAGCAGCTGGCCGG - Intergenic
916219850 1:162433236-162433258 CCGAACTCGGAGCAGCCGGCCGG + Intergenic
916939023 1:169661299-169661321 CCACACTTGGAGCGGCCAGCCGG + Intergenic
916940059 1:169668137-169668159 CCACACTCGGAGCGGCCGGCCGG + Intronic
916960267 1:169882194-169882216 CCCCACTTGGAGCAGCCGGCAGG + Intronic
917094005 1:171381962-171381984 CTGCACTTGGAGCAGCCGGCTGG - Intergenic
917348878 1:174056650-174056672 CCACACTCGGAGCGGCCAGCGGG - Intergenic
917578563 1:176349548-176349570 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
917599006 1:176556906-176556928 CCACACTTGGCGACGCTGCCTGG - Exonic
917933013 1:179837208-179837230 CCGCACTCGGAGCAGCCGGGCGG - Intergenic
918542716 1:185649205-185649227 CCGCACTCGGAGTGGCTGGCCGG - Intergenic
918789958 1:188813169-188813191 CCGCACTCGGAGCTGCCGGCCGG + Intergenic
918792054 1:188841452-188841474 CCGCACTGGGAGCAGCCGGCAGG - Intergenic
918993882 1:191731897-191731919 CCGCACTCGGAGCGGCCGGCCGG + Intergenic
919091886 1:192986993-192987015 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
919174456 1:194001924-194001946 CTGCACTTGGAGCAGCCGGCCGG + Intergenic
920604880 1:207371675-207371697 CCACACTCAGAGCAGCCGGCTGG - Intergenic
920878474 1:209858928-209858950 CCGCACTTGCAGCGGCCGGCTGG - Intergenic
921094441 1:211874570-211874592 CCACACTCGGAACAGCAGGCCGG - Intergenic
921396401 1:214673424-214673446 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
921897082 1:220412514-220412536 CCACCCTCGGAGCGGCCGGCTGG + Intergenic
921903855 1:220475947-220475969 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
921903863 1:220475972-220475994 CTGCACTCGGAGCAGCCGGCCGG - Intergenic
921983691 1:221285936-221285958 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
922056815 1:222049829-222049851 CCGCACTCGGAGCAGCAGTCCGG + Intergenic
922417063 1:225431448-225431470 CCGCACTCGGAGCGGCTGGCCGG + Intergenic
922485412 1:225969852-225969874 CTGCACTGGGAGCAGCCGGCAGG + Intergenic
922541927 1:226426570-226426592 CCGCACTCGGAGCAGCCAGCTGG - Intergenic
922786013 1:228282614-228282636 GCACACTTGGTGCAGCTCGGTGG + Intronic
922985862 1:229865539-229865561 CCGCACTCGGAGCGGCCGGCCGG + Intergenic
923157248 1:231289753-231289775 CCACACTCGGAGCAGCCGGCCGG - Intergenic
923172608 1:231431051-231431073 CCGCATTTGGAGTGGCTGGCTGG - Intergenic
923573796 1:235140367-235140389 CCGCACTCGGAGCAGCCGGCCGG + Intronic
923810534 1:237309904-237309926 CCGCACTCGGAGTGGCTGGCTGG - Intronic
923930090 1:238684908-238684930 CCGCACTCGGAGCAGCCGGCGGG - Intergenic
924117505 1:240762572-240762594 CCGCACTCAGAGCAGCTGGCCGG + Intergenic
924219252 1:241855856-241855878 CCGCACTCAGAGCAGCCGGCCGG - Intronic
924305930 1:242689510-242689532 CCACACTCTGAGCAGCCAGCCGG + Intergenic
924795309 1:247288507-247288529 CCACACTTGAAACAGGTGCCAGG - Intergenic
1063036266 10:2289474-2289496 CCACATGTGGAGCTGCAGGCAGG - Intergenic
1063148971 10:3320106-3320128 CCACACTCTGAGCGGCTGGCCGG - Intergenic
1063848691 10:10160979-10161001 CCACACTCGGAGCAGCCAGCCGG + Intergenic
1065284807 10:24177002-24177024 CCGCACTCGGAGCAGCCAGCTGG - Intronic
1065441319 10:25756081-25756103 GCGCACTCGGAGCAGCCGGCCGG + Intergenic
1065554889 10:26905628-26905650 CCACACTCGGATTGGCTGGCCGG + Intergenic
1065743295 10:28815951-28815973 CCGCACTCCGAGCAGCCGGCCGG - Intergenic
1065965857 10:30769697-30769719 CTGCACTCGGAGCGGCTGGCCGG - Intergenic
1065981580 10:30903076-30903098 CCGCACTGGGAGCGGCTGGCTGG - Intronic
1065995487 10:31055905-31055927 CCTCACTCGGAGCCGCTGGCCGG + Intergenic
1066544258 10:36482276-36482298 CCACACTCGGAGCAGCCGGCTGG - Intergenic
1066660883 10:37737457-37737479 CTGCACTTGGAGCAGCCAGCCGG + Intergenic
1067223653 10:44361743-44361765 CCAAACTTGGAGCTGCTTTCTGG - Intergenic
1067907615 10:50309992-50310014 TCACTCTTGCAGCAGCTTGCAGG - Intronic
1068374007 10:56155205-56155227 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
1068863155 10:61867727-61867749 CCAAACTCGGAGCAGCCGGCCGG + Intergenic
1069215362 10:65812331-65812353 CCCGACTCGGAGCAGCCGGCCGG - Intergenic
1069766126 10:70861726-70861748 CCGCACTCGGAGCAGCCGGCCGG + Intronic
1069992954 10:72326037-72326059 CCGCACTCGGAGCAGCCCGCCGG + Intergenic
1070793492 10:79203505-79203527 CCACCCTTGGCTCAGCTGGCAGG + Intronic
1070937880 10:80315513-80315535 CCGCACTCGGAGCGGCAGGCCGG + Intergenic
1070967193 10:80536715-80536737 GCACACTGGGACCAGCTAGCTGG + Intergenic
1071387989 10:85141482-85141504 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
1071963794 10:90832454-90832476 CCGCACTCGGAGCAGCCGGCTGG - Intronic
1072278483 10:93845274-93845296 CCACACTCGGAGCGGCCGGCAGG + Intergenic
1072341865 10:94459775-94459797 CCACACTTGGAGCTGCTGGCCGG - Intronic
1072662862 10:97373282-97373304 CCTCTCTTGGGGGAGCTGGCAGG + Intronic
1072775127 10:98183124-98183146 TCACACTGGGAGCAGCAGACTGG + Intronic
1073729322 10:106270896-106270918 CCACATTTGTAGCAGTTGGTAGG - Intergenic
1073789785 10:106928372-106928394 CCGCACTCGGAGCAGCCTGCCGG - Intronic
1075255605 10:120923907-120923929 CCGCACTTGGAGCAGCCGGCCGG + Intergenic
1075305709 10:121365659-121365681 CCACGCTCGGAGCGGCCGGCGGG + Intergenic
1076261673 10:129071630-129071652 CCACACTCGGAGCAGCCGGCCGG - Intergenic
1076773599 10:132680744-132680766 CCGCACTCCGAGCAGCCGGCCGG + Intronic
1076794814 10:132793350-132793372 CCACACCTGGAGGAGCTCACTGG + Intergenic
1076796548 10:132801214-132801236 CCGCACTCCGAGCAGCCGGCCGG - Intergenic
1077026205 11:441152-441174 CCACACGTGGAGGCCCTGGCAGG + Intronic
1077105619 11:841216-841238 CGGCACTTGGTGCAGCTTGCTGG - Intronic
1077603232 11:3588809-3588831 CCGCACTAGGAGCTGCCGGCAGG + Intergenic
1077764577 11:5144497-5144519 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
1078795806 11:14591144-14591166 CTGCACTCGGAGCAGCCGGCCGG + Intronic
1079708685 11:23653427-23653449 CCACACTGGGAGCAGCCGGCCGG - Intergenic
1079731770 11:23942556-23942578 CCGCACTAGGAGCAGCCGGCCGG - Intergenic
1079803157 11:24896370-24896392 CCACACTTGGAGCAGCCAGCCGG + Intronic
1081036228 11:38149434-38149456 ACATACTTTGAGCAGCTCGCTGG - Intergenic
1081046423 11:38278877-38278899 CCGCACTTCTAGCAGCCGGCCGG - Intergenic
1081115342 11:39192829-39192851 CCGCACTCGGAGCTGCTGGCCGG - Intergenic
1081136163 11:39442340-39442362 CTGCACTTGGAGCGGCTGGCTGG - Intergenic
1081324477 11:41728361-41728383 CCACACTTGGAGTGGCCAGCTGG - Intergenic
1081329725 11:41788504-41788526 CCACACTCGGAGCAGCTGGCCGG - Intergenic
1081428365 11:42949959-42949981 CCGCACTCGGAGCAGCCAGCCGG + Intergenic
1081790471 11:45779744-45779766 CCACACGGGGAGCAGCAGGAGGG - Intergenic
1082272102 11:50183355-50183377 CCACACTCGGAGCAGCCAGCCGG + Intergenic
1082698775 11:56402197-56402219 CCCCACTCGGAGCAGCTGGCTGG - Intergenic
1083074309 11:60020495-60020517 CCACACTCGGAGCCGCCGGCTGG - Intergenic
1083546097 11:63550288-63550310 CCGCACTCGGAGCAGCCAGCCGG + Intergenic
1084024758 11:66441011-66441033 CCGCACTCGGAGCGGCCGGCCGG - Intronic
1084406091 11:68974518-68974540 CCGCACTCGGAGCAGCTGGCCGG - Intergenic
1084840677 11:71843893-71843915 CCACACTTGGGGCGGCTGGCCGG - Intergenic
1085051601 11:73382901-73382923 CCAGACTGGGAGGAGCTGGGTGG + Intronic
1085245585 11:75098289-75098311 CCACACTCAGAGCAGCCGGCCGG + Intergenic
1085687677 11:78638930-78638952 CTGCACTTGGAGCAGCCAGCCGG + Intergenic
1085800518 11:79585187-79585209 CCATGCTTGGAGCACCTGGAGGG + Intergenic
1085863110 11:80257645-80257667 CCCCACTCGGAGCAGCCCGCCGG + Intergenic
1085886973 11:80533021-80533043 CCACACTCGGAGTGGCCGGCTGG - Intergenic
1086001102 11:81986953-81986975 CTGCACTTGGAGCAGCTGGCCGG - Intergenic
1086001623 11:81991156-81991178 CCGCACTTGGAGCAGCCGGCCGG - Intergenic
1086043018 11:82501241-82501263 CCGCACTCGGAGCGGCCGGCCGG + Intergenic
1087486406 11:98763688-98763710 CCGCACTCAGAGCAGCCGGCCGG - Intergenic
1088027287 11:105200820-105200842 TCACACTGGGAGGAGCTGACAGG - Intergenic
1088481717 11:110301177-110301199 CCGCACTTGGAGCCGCAGGCCGG - Intergenic
1088570862 11:111222061-111222083 CCGCACTCGGAGCAGCCGGCAGG + Intergenic
1088843982 11:113649612-113649634 CCCCACTCGGAGCAGCCGGCCGG - Intergenic
1089244752 11:117110730-117110752 CCGCACTCAGAGCAGCCGGCCGG - Intergenic
1089466420 11:118689252-118689274 CCGCACTAGGAGCAGCCGACCGG - Intergenic
1089666847 11:120025981-120026003 CCACACTCGGAGCAGCCGGCCGG + Intergenic
1090229206 11:125089579-125089601 CTGCACTCGGAGCAGCCGGCCGG + Intronic
1090588248 11:128237173-128237195 CCGCGCTCGGAGCAGCCGGCCGG + Intergenic
1090776739 11:129972098-129972120 CCACACTCGGAGCAGCCAGCCGG - Intronic
1090782713 11:130021755-130021777 CCGCGCTCGGAGCAGCCGGCCGG + Intergenic
1091550684 12:1532659-1532681 CCAGGCTCGGAGGAGCTGGCTGG + Intronic
1091848759 12:3678448-3678470 CCACAGCTGGGGCAGCTGGGAGG + Intronic
1092101703 12:5889125-5889147 CCGCACTTGGAGCAACCAGCCGG - Intronic
1092277252 12:7070663-7070685 CCACCCTTGGAGAGGCTGGTGGG - Exonic
1092336661 12:7639922-7639944 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
1092350536 12:7752351-7752373 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
1092366536 12:7881361-7881383 CCGCACTCGGAGCGGCCGGCCGG + Intronic
1092471755 12:8787349-8787371 CTGCACTCGGAGCAGCCGGCCGG + Intergenic
1092572438 12:9739854-9739876 CCGCACTCGGAGCAGCCGGCAGG - Intergenic
1092583822 12:9876318-9876340 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
1093034477 12:14320177-14320199 CCCCACTCGGAGCAGCCGGTAGG + Intergenic
1093189386 12:16057465-16057487 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
1093266258 12:17007706-17007728 CCGCACTCGGAGCAGCCAGCTGG + Intergenic
1093381553 12:18500229-18500251 CCGCACTCGGAGCGGCCGGCCGG + Intronic
1093524789 12:20093545-20093567 CCACACTCGGAGCGGCCAGCGGG - Intergenic
1093652535 12:21661612-21661634 CCGCACTCGGAGCAGCCGGCCGG + Intronic
1093970198 12:25369449-25369471 CCGCACTCGGAGCAGGCGGCCGG + Intergenic
1094338626 12:29386518-29386540 CCACACTTGGAGCAGCCGGCCGG - Intergenic
1094405365 12:30110726-30110748 CCACACTTGGAGCGGCCGGCCGG - Intergenic
1094718210 12:33034209-33034231 CCACACTCGGAGCAGCCGGCCGG - Intergenic
1094722048 12:33075428-33075450 CCGCACTCGGAGCAGCCGGACGG + Intergenic
1095304141 12:40620739-40620761 CCGCACTCGGAGCGGCAGGCCGG + Intergenic
1095444969 12:42273980-42274002 CCACACTCGGAGGGGCCGGCCGG - Intronic
1095448037 12:42302063-42302085 CCACACTTGTAGCAGTTAACAGG + Intronic
1095642368 12:44500480-44500502 CTGCACTCGGAGCAGCCGGCTGG + Intergenic
1095776691 12:46018100-46018122 CCGCACTCGGAGCAGCGGGCTGG + Intergenic
1095901527 12:47333467-47333489 CTGCACTCTGAGCAGCTGGCCGG + Intergenic
1096324560 12:50647816-50647838 CAAGAATAGGAGCAGCTGGCCGG + Intronic
1096470455 12:51872151-51872173 CCGCACTTGAAGCGGCTTGCAGG + Intergenic
1096529575 12:52234308-52234330 CCACACATGGGGCCGCTGGAGGG + Intronic
1096808498 12:54155211-54155233 CCCTCCTTGGAGCAGCTGGGAGG - Intergenic
1097017941 12:56000421-56000443 CCGCACACGGAGCAGCCGGCTGG - Intronic
1097664202 12:62461511-62461533 CCACACTGGGAGCCGCTAGCCGG - Intergenic
1097863828 12:64543216-64543238 CCGCACTTGGAGTGGCCGGCCGG + Intergenic
1097982002 12:65744441-65744463 CCGCACTAGGAGCAGCTGGCTGG + Intergenic
1098168236 12:67719510-67719532 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
1099204339 12:79711018-79711040 CCGCACTCGGAGCGGCTGGCCGG + Intergenic
1099478657 12:83140202-83140224 CTGCACTAGGAGCAGCCGGCTGG + Intergenic
1099716247 12:86296680-86296702 CCGCACTCGGAGCCGCTGGCCGG - Intronic
1100211902 12:92406796-92406818 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
1100563708 12:95774401-95774423 GCGCACTGGGAGCACCTGGCAGG + Intronic
1100600631 12:96108987-96109009 CCGCACTCGGAGCGGCCGGCCGG + Intergenic
1100734632 12:97513015-97513037 CCGCAGTTGGAGCGGCCGGCCGG - Intergenic
1102387250 12:112520167-112520189 CCACACTTGGAGCGGCAGGCCGG - Intergenic
1102521903 12:113483002-113483024 CTGCAAATGGAGCAGCTGGCTGG + Intergenic
1102609303 12:114097252-114097274 CCAGCCTTGGAGTAGCAGGCAGG + Intergenic
1102698444 12:114818006-114818028 TCTCTCCTGGAGCAGCTGGCAGG + Intergenic
1102703669 12:114862561-114862583 CCTCAGTTGGATCAGATGGCTGG + Intergenic
1103146163 12:118597453-118597475 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
1103239116 12:119398315-119398337 ACGCACTAGGAGCGGCTGGCCGG - Intronic
1103439248 12:120950618-120950640 CCACACTCGGAGCAGCCGGCCGG - Intergenic
1103783409 12:123414391-123414413 CCGCACTCGGAGCAGCTGGCGGG - Exonic
1104344478 12:127983464-127983486 CCACACTCCGAGCGGCCGGCCGG + Intergenic
1104749222 12:131227894-131227916 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
1105291875 13:19058558-19058580 CCACACTTGGTGCTCCTCGCCGG - Intergenic
1105477403 13:20740206-20740228 CCGCACTCGGAGCAGCCGGCTGG - Intronic
1105697235 13:22900686-22900708 CCGCACTCGGAGCAGCAAGCTGG - Intergenic
1105701556 13:22938915-22938937 CCACACTCCCAGCAGCCGGCTGG - Intergenic
1106379457 13:29222816-29222838 CCGCAATTGGAGCAGATGCCAGG - Intronic
1106600560 13:31183286-31183308 CCGCACTCGGAGCGGCAGGCCGG - Intergenic
1107590481 13:41898857-41898879 CCACACTCGGAGCAGCCGGCCGG - Intronic
1107652576 13:42559852-42559874 CCGCACTCGGAGCGGCCGGCGGG + Intergenic
1107836097 13:44413658-44413680 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
1108350602 13:49587419-49587441 CCATACTTGGAGCATCTTGGAGG + Intergenic
1108435325 13:50396677-50396699 CCGCATTCGGAGCAGCCGGCTGG + Intronic
1108845652 13:54676653-54676675 CCACACTTGGAGCGGCCCACCGG + Intergenic
1108856538 13:54799956-54799978 CCGCACTCGGAGCAGCTGGCCGG - Intergenic
1108996000 13:56735691-56735713 CCGCACTGGGAGCGGCTGGCCGG + Intergenic
1109124935 13:58505698-58505720 CCACACTTGGGGCAGCCAGCCGG - Intergenic
1109145393 13:58773400-58773422 CCACACTGGGAGCAGCTGGCCGG + Intergenic
1109563173 13:64077772-64077794 CCGCACTTGGAGCGGCCGGCCGG - Intergenic
1109741518 13:66561148-66561170 CCGCACTCGGAGCGGCCGGCTGG + Intronic
1109745803 13:66622031-66622053 CCGCACTCGGAGCAGCCGGCCGG + Intronic
1110368849 13:74718474-74718496 CTGCACTCGGAGCAGCCGGCCGG + Intergenic
1110792411 13:79600436-79600458 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
1110862118 13:80355629-80355651 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
1110874383 13:80490840-80490862 CTGCACTGGGAGCAGCCGGCGGG - Intergenic
1110999859 13:82165228-82165250 CCACACTCGGAGCAGCTGGCTGG - Intergenic
1111138796 13:84086654-84086676 CCGCACTCGGAGCGGCCGGCCGG - Intergenic
1111220891 13:85204995-85205017 CCGCACTTGGAGTGGCCGGCTGG + Intergenic
1111333555 13:86792347-86792369 CCACACTCCGAGCGGCCGGCCGG + Intergenic
1111441890 13:88291902-88291924 CCGCACTCGGAGCAGCTGGCCGG + Intergenic
1111591007 13:90348681-90348703 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
1111841430 13:93455063-93455085 CTGCACTCGGAGCAGCCGGCCGG - Intronic
1112430239 13:99344759-99344781 CCACACGAGGAGCACGTGGCAGG - Intronic
1112518627 13:100077598-100077620 CCGCACTCGGAGCAGCCAGCCGG + Intergenic
1112533185 13:100224327-100224349 CCGCACTCGGAGCAGCCGGCTGG - Intronic
1112613081 13:100975779-100975801 CCGCACTCGGAGCAGCGGGCCGG + Intergenic
1113144886 13:107197542-107197564 CCACACATGAAGAAGCAGGCAGG - Intronic
1113487327 13:110663734-110663756 CCACACTGAGAGCAGATGGCAGG + Intronic
1113839553 13:113351029-113351051 CCACCCTCGGGGCAGCTGGAGGG - Intronic
1114051387 14:18921639-18921661 CCTGGCTTGGAGCAGCTGGGAGG - Intergenic
1114111174 14:19480286-19480308 CCTGGCTTGGAGCAGCTGGGAGG + Intergenic
1114394755 14:22347693-22347715 CATCACTTGGAGCAGCGGGGAGG + Intergenic
1114431805 14:22667819-22667841 CCTCACCAGGAGCAGCTTGCTGG - Intergenic
1114812505 14:25917240-25917262 CCACAGCTGGAGCAGCTGTGGGG - Intergenic
1115118268 14:29909079-29909101 CCACACTCAGAGTGGCTGGCCGG + Intronic
1115268647 14:31527364-31527386 CCGCACTCGGAGCAGCCGGCCGG - Intronic
1115385276 14:32789447-32789469 CCACACCTGTAGAAGGTGGCTGG - Intronic
1115421366 14:33199017-33199039 CCACACTTGGAGCGGCCAGCAGG - Intronic
1116152141 14:41154517-41154539 CCACACTCAGAGCGGCCGGCCGG - Intergenic
1116390512 14:44384825-44384847 CTGCACTCGGAGCAGCTGGCAGG + Intergenic
1116452343 14:45080519-45080541 CCGCACTCGGAGCAGCCGACCGG + Intergenic
1117077852 14:52122326-52122348 CCGCACTCCGAGCAGCTGGCCGG + Intergenic
1117727350 14:58687531-58687553 CCACACTTGGAGCGGCCGGCCGG - Intergenic
1117742611 14:58834001-58834023 ACTCACTTGGAGTGGCTGGCGGG + Intergenic
1117837264 14:59819846-59819868 CCGCACTCGGAGCGGCTGGCTGG - Intronic
1119027771 14:71167622-71167644 CCGCACTCGGAGCGGCCGGCGGG + Intergenic
1119300336 14:73566611-73566633 CCACACTCGGAGCCGCCAGCTGG - Intergenic
1119303686 14:73590712-73590734 CCGCACTTGGAGCGGCCGGCCGG - Intergenic
1120169669 14:81236181-81236203 CCACACTCAGAGCAGCCGGCTGG + Intergenic
1120330965 14:83092467-83092489 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
1120844147 14:89111730-89111752 CCGCACTCGGAACAGCCGGCCGG + Intergenic
1121169679 14:91843110-91843132 CCCTCCTTGGAGCAGCTGGCTGG - Intronic
1121274156 14:92656507-92656529 TCAGCCTTGGGGCAGCTGGCTGG + Intronic
1121634690 14:95445970-95445992 GCACTCCTGGAGCAGGTGGCAGG - Exonic
1121646193 14:95518415-95518437 CCACCCTTGGAGCAGCCTGGGGG - Intergenic
1121969592 14:98344097-98344119 ACACACTGGGAGCTGGTGGCCGG - Intergenic
1122216545 14:100208436-100208458 CCACACTCGGAGCGGCCAGCCGG - Intergenic
1122272835 14:100575994-100576016 CCACCCCTGGAGGAGCAGGCGGG + Intronic
1122277986 14:100605046-100605068 CCTCACCCGGAGCTGCTGGCAGG - Intergenic
1122314832 14:100819826-100819848 CCACACGTTGTGCACCTGGCGGG - Intergenic
1123799125 15:23802996-23803018 CCGCACTTGGAGCAGCCGGCCGG + Intergenic
1123949146 15:25253471-25253493 CCACACTCGGAGCAGCGGGCCGG - Intergenic
1124114876 15:26831457-26831479 CCACCCTCGGAGCAGCCAGCCGG - Intronic
1124373309 15:29115535-29115557 CCACCCGTGGAGGAGCGGGCGGG + Intronic
1125112200 15:36047037-36047059 CCGCACTCGGAGCGGCCGGCCGG + Intergenic
1125733355 15:41906818-41906840 CAGCACTTGGAGTGGCTGGCTGG + Intronic
1125914570 15:43474156-43474178 CTGCACTCGGAGCAGCCGGCCGG - Intronic
1126088975 15:45034917-45034939 CCGCACTCAGAGCAGCCGGCCGG + Intronic
1126165544 15:45651282-45651304 CCGCACTTGGAGTGGCAGGCTGG - Intronic
1126713171 15:51483839-51483861 GCACACTGGGAGCAGCCTGCAGG - Intronic
1126802754 15:52315257-52315279 CCACACTTGCAGAAACTGGGAGG + Intronic
1127054087 15:55114004-55114026 CCTAAATTGGAGCAGGTGGCTGG - Intergenic
1127731172 15:61803306-61803328 CCCCACTTGGCACAGCTGGGAGG - Intergenic
1127766081 15:62186840-62186862 CCGCACTCGGAGCAGCCCGCTGG - Intergenic
1127984761 15:64060966-64060988 CCGCACTCAGAGCCGCTGGCTGG + Intronic
1128353566 15:66908435-66908457 GCAGACTTGTAGCAGCTGGCAGG + Intergenic
1128669994 15:69567636-69567658 CCGCACTCGGAGCAGCCAGCTGG - Intergenic
1128779475 15:70349506-70349528 GCACACTTGGATCAGCAGCCTGG - Intergenic
1128813325 15:70587452-70587474 CCGCACTCGGAGCAGCCGGACGG - Intergenic
1129724404 15:77894251-77894273 CCGCACTCGGAGCAGCTGGCCGG - Intergenic
1130132846 15:81158705-81158727 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
1130429317 15:83830841-83830863 CCAGACTGGGAGCAGCAGGTGGG + Intronic
1131472839 15:92711295-92711317 CCGCACTTGGAGCGGCCGGCCGG - Intronic
1131846138 15:96492115-96492137 CCGCACTCGGAGCAGCTGGCCGG - Intergenic
1131912578 15:97224330-97224352 CCGCACTTGGAGCCGCTGGCCGG + Intergenic
1132896731 16:2232764-2232786 CCACACTTGGAGCACTTGTAGGG - Exonic
1133041892 16:3065314-3065336 CCAGACTCGGGACAGCTGGCTGG - Intronic
1133315050 16:4877666-4877688 CCCCACTTGGAGCTGCCGCCAGG + Intronic
1133362658 16:5186600-5186622 CCGCACTCGGAGCGGCCGGCAGG - Intergenic
1135262139 16:20989918-20989940 CCGCACTCGGAGCAGCCGGCCGG - Intronic
1135280834 16:21152680-21152702 CCGCACTGGGAGCAGCCAGCTGG + Intronic
1135751084 16:25059188-25059210 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
1136233750 16:28902595-28902617 CCACCGTGGGAGCAGCTGCCTGG + Exonic
1136481607 16:30545446-30545468 CCACACTTGGAACAGGTGCCAGG + Intronic
1136485629 16:30570192-30570214 GCACACGTGGCGCCGCTGGCCGG + Exonic
1136622246 16:31436902-31436924 CCGCACTTGGCGCAGCTGTGGGG + Exonic
1137572477 16:49575859-49575881 CCACACTTGGAGGAGCCTGAAGG + Intronic
1137624925 16:49901535-49901557 ACACACTAGGAGCAGCAGGAGGG - Intergenic
1137734213 16:50712077-50712099 CCTCACCCGGTGCAGCTGGCGGG - Exonic
1137924636 16:52528588-52528610 CCACATATGAAGCAGTTGGCCGG - Intronic
1139442298 16:66974362-66974384 CCCCACTCAGAGCAGCTGGCCGG + Exonic
1139563056 16:67755979-67756001 CCACATTTGAACCAGCAGGCAGG + Intronic
1140722538 16:77784656-77784678 CCTCACTCGGAGCGGCCGGCCGG - Intergenic
1143127997 17:4656786-4656808 CCGCACTCGGAGCGGCTGGCCGG - Intergenic
1143470893 17:7174432-7174454 CTTCACGTGGAGCAGCAGGCTGG + Exonic
1143902395 17:10184006-10184028 CCATACTGGGAGCAGCTGCAGGG + Intronic
1144779817 17:17802154-17802176 CCACACCTGGACCAGCTGCTTGG - Intronic
1145050325 17:19654593-19654615 CCACACTCGGAGCAGCTGGCCGG - Intronic
1145766105 17:27459272-27459294 CCTCACTAGGGGCAGCTGCCAGG - Intronic
1146740484 17:35279191-35279213 CCAAACTCAGAGCAGCCGGCTGG - Intergenic
1147997516 17:44368906-44368928 CCGCACTCGGAGCAGCCAGCCGG + Intergenic
1148016852 17:44528048-44528070 CTGCACTCGGAGCAGCCGGCCGG + Intergenic
1148366194 17:47057560-47057582 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
1148697997 17:49572660-49572682 CCACGCTGGGAGTAGCTGGAGGG + Intergenic
1148991235 17:51668854-51668876 CCACACTTGGAGCGGCCGGCCGG + Intronic
1150772266 17:68051955-68051977 CCGCACTCGGAGCGGCCGGCCGG + Intergenic
1150778263 17:68099365-68099387 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
1150786765 17:68169635-68169657 CCGCACTCAGAGCAGCCGGCCGG - Intergenic
1150788251 17:68179931-68179953 CCGCACTCAGAGCGGCTGGCCGG + Intergenic
1150792230 17:68207940-68207962 ACGCACTTGGAGCAGCCGGCAGG + Intergenic
1150804624 17:68309187-68309209 CCGCACTCGGAGCAGCCAGCTGG - Intronic
1151410668 17:73925586-73925608 CCACGCTTGGAGTAGCAGCCGGG - Intergenic
1151677338 17:75605489-75605511 CCATCCTTGGAGCAGCTTCCAGG + Intergenic
1151840661 17:76615187-76615209 CCACACTCAGAGCGGCTGGCCGG - Intergenic
1152096354 17:78274071-78274093 CCAGGCTTGGATTAGCTGGCTGG + Intergenic
1152515174 17:80819126-80819148 GCACAGCTCGAGCAGCTGGCGGG - Intronic
1152602454 17:81271329-81271351 CCACTCATGGAGCAGCAGGCAGG - Intronic
1152619070 17:81352325-81352347 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
1153644073 18:7178943-7178965 CCACACTCGGAGCAGCCAGCCGG - Intergenic
1153868693 18:9297019-9297041 CCACACTCAGAGCGGCCGGCTGG + Intergenic
1154128765 18:11717189-11717211 CCGCACTGGGAGCGGCCGGCTGG - Intronic
1154255331 18:12777131-12777153 CCACACTCGGAGCGGCCGGCCGG - Intergenic
1155295048 18:24376857-24376879 CCGCACTGGGAGCAGCCGGCCGG - Intronic
1156038653 18:32794658-32794680 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
1156657810 18:39309176-39309198 CCACACTCGGAGCAGCCAGCCGG + Intergenic
1156863642 18:41865840-41865862 CCACACTCGGAGCAGCCGGCCGG + Intergenic
1157446484 18:47750548-47750570 CCACACTGGGAGCTGCTGAGGGG + Intergenic
1157616938 18:48992578-48992600 CCACATTTGGGGCAAGTGGCAGG - Intergenic
1157935195 18:51864647-51864669 CCACACTCGGAGCAGCCAGCTGG - Intergenic
1158597464 18:58828589-58828611 CATCACATGGAGCTGCTGGCTGG - Intergenic
1158697279 18:59714370-59714392 CTGCACTCGGAGCAGCCGGCCGG - Intergenic
1159167970 18:64725907-64725929 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
1159230780 18:65605337-65605359 CTGCACTCGGAGCAGCCGGCCGG + Intergenic
1159458654 18:68694402-68694424 CCTCACATGGAGCAGGTGCCTGG + Intronic
1159516185 18:69461394-69461416 CCACCATGGGAACAGCTGGCAGG + Intronic
1160198538 18:76777328-76777350 CCGCACTCGGAGCAGCCGGCTGG + Intergenic
1161159886 19:2755919-2755941 TCACACCGGGAGCAGCTGGAAGG + Exonic
1161937873 19:7383161-7383183 CCACACAGGGGGCAGCTGGAGGG - Exonic
1162020559 19:7866554-7866576 CCACACTGGGTGCAGAGGGCAGG - Intergenic
1162230129 19:9259597-9259619 CCGCACTCGGAGCAGCAGGCCGG + Intergenic
1162262068 19:9541604-9541626 CTGCACTCGAAGCAGCTGGCCGG - Intergenic
1162263035 19:9547890-9547912 CTGCACTTGGAGCAGTCGGCTGG + Intergenic
1162814747 19:13186986-13187008 CTGCACTTGGAGCAGCCGGCTGG - Intergenic
1162987089 19:14277708-14277730 CCGCACTCGGAGCAGCAGGCTGG + Intergenic
1163181738 19:15608922-15608944 CCGCACTGGGAGCAGCCAGCCGG - Intergenic
1163218829 19:15899766-15899788 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
1164082742 19:21874843-21874865 CCACTCTGGGAGCAGTTGTCAGG - Intergenic
1164598997 19:29548674-29548696 CCACCCTGGGAGCATCTGGCGGG - Intronic
1165776082 19:38405082-38405104 CAACTCCTGCAGCAGCTGGCTGG - Exonic
1166036239 19:40170418-40170440 CCGCACTTGGAGCAGCCGGCAGG - Intergenic
1166487030 19:43222209-43222231 TCGCACTCGGAGCAGCCGGCTGG - Intronic
1167399872 19:49258025-49258047 CCACACTTGCAACAGGTAGCTGG - Intergenic
1167736979 19:51300775-51300797 CCACCTTGGGAGCAGCAGGCAGG + Intergenic
925537826 2:4935591-4935613 CTGCACTTGGAGCAGCCGGCCGG - Intergenic
925908873 2:8558280-8558302 CCACAGCTGGGACAGCTGGCAGG - Intergenic
926474785 2:13308569-13308591 CTGCACTCGGAGCAGCCGGCTGG - Intergenic
926550791 2:14298712-14298734 CCAAACTAGGAGCAGGAGGCAGG - Intergenic
926648448 2:15315616-15315638 CCAGTCTTGAAGCAGCTGGGAGG - Intronic
926685840 2:15697008-15697030 CCGCACTTGGAGAGGCCGGCCGG - Intronic
927869128 2:26612747-26612769 CGTCACGGGGAGCAGCTGGCAGG - Intronic
928599208 2:32886845-32886867 CCGCACTTGAAGCAGCCGGCCGG - Intergenic
928723132 2:34142804-34142826 CCACACTTGGAGCAGCCAGCTGG - Intergenic
928880564 2:36092324-36092346 CCGCACTCGGAGCAGCCAGCTGG + Intergenic
928936878 2:36688344-36688366 CCGCACTCCGAGCAGCCGGCTGG + Intergenic
929070041 2:38020595-38020617 CCACACTGGGAGCGGCCAGCCGG + Intronic
929138036 2:38643338-38643360 CCGCACTCCGAGCAGCCGGCCGG - Intergenic
929379670 2:41335673-41335695 CCGCACTCGGAGCAGCAGGCCGG + Intergenic
930037998 2:47099815-47099837 CCACACTCAGAGCAGCTGGTGGG + Intronic
930039195 2:47107363-47107385 CCGCACTCGGAGCAGCTGGCCGG + Intronic
930485489 2:52006882-52006904 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
930962380 2:57276904-57276926 TCACACTGGGAGCTGCAGGCTGG + Intergenic
931005888 2:57849930-57849952 CCAGACTTGGAGCAGGTGCCAGG + Intergenic
931106955 2:59067011-59067033 CCGCCCTCGGAGCGGCTGGCCGG + Intergenic
931499893 2:62854824-62854846 ACACACTCCAAGCAGCTGGCGGG + Intronic
932359535 2:71092764-71092786 CCACACTCGGAGCAACCGGCTGG - Intergenic
932902031 2:75711657-75711679 CTGCACTCGGAGCAGCCGGCCGG + Intergenic
933487275 2:82938722-82938744 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
933506314 2:83181126-83181148 CCACACTTGGAGCAGCCAGCCGG + Intergenic
934085113 2:88503221-88503243 CCGCACTCGGAGCGGCCGGCCGG + Intergenic
934898476 2:98139086-98139108 CCGCACTCGGAGCAGCCGGCCGG + Intronic
935672936 2:105570972-105570994 GCACACATGGAGCACCTGCCTGG - Intergenic
935896872 2:107747616-107747638 CCGCACTTGGAGCAGCCGGCCGG - Intergenic
935922539 2:108031647-108031669 CCGCACTCGGAGTGGCTGGCTGG + Intergenic
936047297 2:109197537-109197559 CCACCCTTGATGCAGGTGGCCGG + Intronic
936346870 2:111681933-111681955 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
936581541 2:113704682-113704704 CCGCACTCGGAGCGGCCGGCAGG - Intergenic
937181122 2:119997066-119997088 CCGCACTCGGAGCCGCCGGCCGG + Intergenic
937596831 2:123683856-123683878 CTGCACTCGGAGCAGCCGGCCGG + Intergenic
938067255 2:128287832-128287854 CCTGCCTTGGAGCAGCAGGCAGG - Intronic
938401010 2:130991528-130991550 CGGCACTCGGAGCAGCCGGCCGG + Intronic
938421100 2:131147500-131147522 TAAAACTTGGAGAAGCTGGCTGG + Exonic
938728762 2:134130021-134130043 CCGCACTCGGAGCGGCCGGCTGG + Intronic
939053234 2:137331885-137331907 CCGCACTTGGAGCAGCCGGCCGG - Intronic
939085660 2:137715879-137715901 CCACACTCAGAGCAGCCAGCTGG + Intergenic
939113380 2:138033549-138033571 CCACCCTTGCAGATGCTGGCAGG + Intergenic
939229739 2:139410423-139410445 CCACACTCGGAGCAGCCGGCCGG + Intergenic
939281735 2:140073872-140073894 CTGCACTCGGAGCAGCCGGCAGG + Intergenic
939738799 2:145881186-145881208 CCTCACTCGGAGCAGCCTGCCGG - Intergenic
939898896 2:147826943-147826965 CCGCACTCGGAGCGGCCGGCCGG + Intergenic
940784617 2:157968148-157968170 CCGCACTCGGAGCCGCCGGCCGG - Intronic
941397948 2:164995032-164995054 CCGCACTCGGAGCAGCCGGCGGG - Intergenic
941476603 2:165957345-165957367 CCGCACTTGGAGCGGCGGGTCGG - Intergenic
941712141 2:168725175-168725197 CTGCACTTGAAGCAGCCGGCCGG - Intronic
942403353 2:175626947-175626969 CCACACTTTGAGCTCCTGGAGGG - Intergenic
942867270 2:180691470-180691492 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
943134422 2:183892617-183892639 CCACACTTGGAGTGGCCGGCCGG + Intergenic
943166088 2:184327930-184327952 CCGCACTCGGAGCTGCCGGCCGG - Intergenic
943680367 2:190761241-190761263 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
943903770 2:193472945-193472967 CCACACTTGTAGCAATTGGCAGG - Intergenic
943941455 2:194003015-194003037 CCACACTCAGAGCAGCTGGCTGG - Intergenic
943954899 2:194176396-194176418 CCACACTTGGAGCCGCCGGCCGG + Intergenic
944252500 2:197591820-197591842 CCACACTCAGAGCGGCCGGCTGG - Intronic
944482790 2:200174866-200174888 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
944857952 2:203785851-203785873 CTGCACTCGGAGCAGCCGGCCGG - Intergenic
945302578 2:208227961-208227983 CTACACTTGGAGCAGCCGGCCGG - Intergenic
945872844 2:215246006-215246028 CCACACTCGGAGCGGCCAGCTGG - Intergenic
946053982 2:216885331-216885353 CCGCACTCGGAGCTGCCGGCTGG + Intergenic
946177169 2:217928936-217928958 CCACACACAGAGCAGCTGCCAGG + Intronic
946982186 2:225229726-225229748 CCGCACTCGGAGCAGCAGGCCGG - Intergenic
947026610 2:225744212-225744234 CCGCACTCGGAGCAGCCGGCGGG + Intergenic
947083949 2:226429837-226429859 CCAGACTGGGTGCAGCTGGAGGG + Intergenic
947932075 2:233972745-233972767 CCGCACTGGGAGCAGCCGGCCGG - Intronic
948295713 2:236858838-236858860 GCTCACTTGAAGCAGTTGGCAGG + Intergenic
1170246450 20:14226591-14226613 GCGCACTCGGAGCAGCCGGCCGG + Intronic
1170649486 20:18226848-18226870 CCGCACTTGGAGCAGCCAGTCGG + Intergenic
1170989867 20:21291954-21291976 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
1171973444 20:31578838-31578860 CCGCACTTGGAGCGGCTGGCCGG - Intergenic
1172035476 20:32007865-32007887 CCACCCTTGGAGCAGCAGCCGGG - Intergenic
1172431876 20:34899080-34899102 CCGCACTCGGAGCAGCCGGCCGG - Intronic
1172445511 20:34991139-34991161 CTCCACCTGGAGCAGCAGGCAGG - Intronic
1173601579 20:44299216-44299238 CCGCACTCGGAACAGCCGGCCGG + Intergenic
1173727654 20:45308441-45308463 CCACGCTTGGAGCTGCAGACAGG + Intronic
1174055794 20:47797298-47797320 CCACACATAGAGCAGCAGGAAGG - Intergenic
1174162894 20:48564341-48564363 CCGCACTCGGAGCGGCTGGCCGG - Intergenic
1174194972 20:48766582-48766604 TGAGACTTGAAGCAGCTGGCAGG - Intronic
1175210049 20:57348479-57348501 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
1175254135 20:57628877-57628899 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
1176332305 21:5559884-5559906 CCACACTCGGAGCCGCCGGCTGG - Intergenic
1176344842 21:5733751-5733773 CCGCACTTGGAGCGGCCAGCTGG - Intergenic
1176351656 21:5854335-5854357 CCGCACTTGGAGCGGCCAGCTGG - Intergenic
1176395452 21:6261067-6261089 CCACACTCGGAGCCGCCGGCTGG + Intergenic
1176441705 21:6728037-6728059 CCACACTCGGAGCCGCCGGCTGG - Intergenic
1176465967 21:7055106-7055128 CCACACTCGGAGCCGCCGGCTGG - Intronic
1176489528 21:7436884-7436906 CCACACTCGGAGCCGCCGGCTGG - Intergenic
1176499985 21:7590704-7590726 CCGCACTTGGAGCGGCCAGCTGG + Intergenic
1176539163 21:8131821-8131843 CCGCACTTGGAGCGGCCAGCTGG - Intergenic
1176558114 21:8314866-8314888 CCGCACTTGGAGCGGCCAGCTGG - Intergenic
1177182407 21:17757864-17757886 CTGCACTTGGAGCAGCGGGCTGG - Intergenic
1177565845 21:22819117-22819139 CCACACTCGGAGCAGCCGGCCGG - Intergenic
1177637601 21:23807100-23807122 CCGCACGTGGAGCAGCCGGCCGG + Intergenic
1178326981 21:31654276-31654298 CCGCACTCGGAGCAGCCGGCAGG + Intergenic
1178585661 21:33868594-33868616 CCGCACTCGGAGCAGCCGGCCGG - Intronic
1179479405 21:41668183-41668205 CCAGACGTGGAGCAGCCAGCAGG + Intergenic
1179842177 21:44084242-44084264 CTGCACGTGGAGCCGCTGGCTGG + Exonic
1180469860 22:15644014-15644036 CCTGGCTTGGAGCAGCTGGGAGG - Intergenic
1180741063 22:18053634-18053656 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
1181406688 22:22689998-22690020 TAACAGTGGGAGCAGCTGGCAGG + Intergenic
1181414659 22:22750648-22750670 TAACAGTGGGAGCAGCTGGCAGG + Intronic
1181485004 22:23225009-23225031 CGGCATTTGGAGCAGCTGGCTGG + Intronic
1181604409 22:23971686-23971708 CCACAGTGGGAGTACCTGGCAGG - Exonic
1183136427 22:35893210-35893232 CAACCCTTGGAGCAGCCAGCTGG - Intronic
1183422141 22:37718117-37718139 CCGCACTCGGAGCGGCCGGCTGG - Intronic
1183509044 22:38224552-38224574 CCACACTTGGACCTGCTGCAAGG + Intronic
1184578834 22:45398310-45398332 CGGTACTTGGAACAGCTGGCTGG + Intronic
1203244111 22_KI270733v1_random:48176-48198 CCGCACTTGGAGCGGCCAGCTGG - Intergenic
949292739 3:2484991-2485013 CCGCACTCAGAGCAGCGGGCTGG + Intronic
949540480 3:5027995-5028017 CCACACTTGGAACTGCTGCTGGG - Intergenic
950203585 3:11061465-11061487 CCACACTCAGAGCGGCCGGCCGG + Intergenic
950256977 3:11513520-11513542 CCGCACTGGGAGCGGCCGGCTGG - Intronic
950418545 3:12882974-12882996 CCGCACTCGGAGCTGCTGGCCGG + Intergenic
950600394 3:14029772-14029794 CTGCACTTGGAGCAGCTGGCCGG - Intronic
950632627 3:14293290-14293312 CCGCACTCGGAGCGGCCGGCCGG + Intergenic
950929378 3:16773799-16773821 CCGCACTTGGAGCAGCCAGCCGG + Intergenic
951006281 3:17618986-17619008 TCACACTTGGAGCTGCAGACCGG + Intronic
951024954 3:17818273-17818295 CCGCACTCGGAGCAGCCGGCCGG - Intronic
951184958 3:19702652-19702674 CCGCACTCGGAGCGGCCGGCTGG + Intergenic
951323219 3:21271899-21271921 CCGCACTCGGAGCAGCTGGCCGG - Intergenic
951491248 3:23272281-23272303 CCACACTCAGAGAAGCCGGCCGG - Intronic
951551896 3:23882813-23882835 CCGCACTCGGAGCAGCCGGCCGG - Intronic
952011294 3:28903443-28903465 CCGCACTTGGAGCAGCCAGCTGG - Intergenic
952058106 3:29473779-29473801 CCACACTTGGAGGGGCTGGCCGG - Intronic
952076301 3:29701659-29701681 CCGCACTCGGAGAGGCTGGCCGG + Intronic
952275230 3:31870204-31870226 CCGCACTCCGAGCAGCCGGCGGG + Intronic
952355372 3:32578837-32578859 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
952730624 3:36633990-36634012 CCGCACTCGGAGCGGCCGGCCGG + Intergenic
952795229 3:37233086-37233108 CCGCACTCGGAGCAGCCTGCCGG + Intergenic
953002872 3:38951235-38951257 CCGCACTCGGAGCAGCCGGCTGG + Intergenic
953124531 3:40078204-40078226 CCGCACTCGGAGCAGCCAGCTGG - Intronic
953423016 3:42769795-42769817 CCACACTCCAAGCAGCCGGCTGG + Intronic
953514771 3:43579309-43579331 CCACACTTAGGGCAACTAGCAGG - Intronic
953522509 3:43656703-43656725 CCACACTCAGAGCAGCCGGCCGG - Intronic
954089340 3:48272200-48272222 CCACACTCGGAGCGGCCGGCCGG - Intronic
954140082 3:48600331-48600353 CCACCCTTGGAGATGCAGGCAGG - Intronic
954462813 3:50637298-50637320 CCACCCTGGGAGCAGCTTGAGGG - Intronic
954620107 3:51990646-51990668 TCGCACTCGGAGCAGCCGGCCGG + Intergenic
955183332 3:56691962-56691984 CCACACTCGGAGCAGCCGGCCGG + Intergenic
955186409 3:56719016-56719038 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
956195730 3:66651654-66651676 CCGCACTCCGAGCAGCCGGCTGG + Intergenic
957002278 3:74900211-74900233 CCGCACTCGGAGCCGCCGGCGGG - Intergenic
957009199 3:74985403-74985425 CCATACTCGGAGCAGCTGGCGGG - Intergenic
957074072 3:75587881-75587903 CCACACTAGGAGCGGCTGGCCGG + Intergenic
957371466 3:79300302-79300324 CTGCACTTGGAGCAGCCCGCCGG + Intronic
957419686 3:79951648-79951670 CCACACTCGGAGCAGCCGGCCGG - Intergenic
957446118 3:80314576-80314598 CTGCACTTGGAGCAGCCGGCCGG + Intergenic
957624876 3:82644051-82644073 CCACATTTGTAGCAGTTAGCAGG - Intergenic
957665200 3:83217888-83217910 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
957804925 3:85134138-85134160 CCGCACTCAGAGCAGCCGGCCGG - Intronic
957921799 3:86757676-86757698 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
958419858 3:93917670-93917692 CGGCACTCGGAGCAGCCGGCCGG + Intronic
958875109 3:99607362-99607384 TCATTCTTGGTGCAGCTGGCTGG - Intergenic
959323323 3:104906220-104906242 CCACATTCGGAGCAGCCAGCCGG + Intergenic
959422722 3:106148710-106148732 CCACACTCAGAGCAGCCGGCTGG + Intergenic
959947141 3:112137135-112137157 CCACACATGGAGCAGCATCCAGG - Intergenic
960149822 3:114238567-114238589 CCACACTCGGAGCAGCCGGCCGG - Intergenic
960227550 3:115185163-115185185 CCGCACTGGGAGCAGCCGGCTGG - Intergenic
960276869 3:115738577-115738599 CCACACTGGGAGCTGCAGACTGG + Intergenic
960282120 3:115791645-115791667 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
960560057 3:119073679-119073701 CCACACTTGGAGCAGCCGGCCGG - Intronic
960669188 3:120140332-120140354 CCGCACTTGGAGCCGCCGGCCGG + Intergenic
960685487 3:120289801-120289823 CCGCACTCGGAGCAGCCAGCCGG + Intergenic
960868603 3:122227454-122227476 CTGCACTTGGAGCAGCTGGCTGG - Intronic
961268764 3:125671760-125671782 CCGCACTTGGAGCGGCTGGCTGG + Intergenic
961368810 3:126417517-126417539 CCACAGTTGGAGAGGCAGGCAGG + Intronic
961465055 3:127076518-127076540 CCGCACTGGGAGTAGCTGGCTGG - Intergenic
961688782 3:128653478-128653500 CCGCACTCGGAGCGGCCGGCCGG + Intronic
961700810 3:128743199-128743221 CCACACTCGGAGTGGCCGGCTGG - Intronic
961874387 3:130010723-130010745 CCGCACTAGGAGCTGCCGGCCGG + Intergenic
961932331 3:130547337-130547359 CCGCACTTGGAGTGGCTGGCAGG - Intergenic
962383781 3:134916637-134916659 CCACACTCAGAGCTGCCGGCTGG - Intronic
962600521 3:136987864-136987886 CCGCACTCGGAGCAGCCGGCCGG - Intronic
962758235 3:138484732-138484754 CCACACTCGGAGCAGCCGGCCGG + Intergenic
962998123 3:140651507-140651529 CTGCACTGGGAGCAGCCGGCCGG + Intergenic
963112829 3:141701014-141701036 CCACACTTGAAACAGGTGCCAGG + Intergenic
963397195 3:144749895-144749917 CCGCACTGGGAGCAGCAGGCCGG + Intergenic
963397866 3:144756965-144756987 CTGCACTTGGAGCAGCTGGCCGG + Intergenic
963440393 3:145333476-145333498 CCGCACTCGGAGCGGCCGGCAGG + Intergenic
963533249 3:146497381-146497403 CCGCACTCGGAGCAGCTGGCCGG + Intergenic
963589991 3:147245843-147245865 CCGCACTCGGAGCGGCCGGCCGG - Intergenic
963651842 3:147989658-147989680 CCACACTTGGAGTGGTCGGCTGG - Intergenic
963743019 3:149098127-149098149 CCGCACTTGGAGCCGCTGGTTGG - Intergenic
963760579 3:149284104-149284126 CCACACTGGGAGCAGCCGGCAGG + Intergenic
963862152 3:150323051-150323073 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
964037526 3:152217386-152217408 CCACACTCGGAGCAGCTGGCTGG + Intergenic
964443986 3:156740661-156740683 CCGCACTTGGAACAGCCGGCTGG + Intergenic
964452158 3:156822954-156822976 CCGCACTCGGAGCAGCCAGCCGG - Intergenic
964751844 3:160060607-160060629 CCACATTCGGAGCAGCTGGCCGG + Intergenic
964974154 3:162599781-162599803 CCACACTTGGAGCTGCTGGCCGG + Intergenic
965003510 3:162987432-162987454 CCACACTCAGAGCAGCCAGCCGG + Intergenic
965040279 3:163499106-163499128 CCGTACTGGGAGCAGCCGGCAGG + Intergenic
965044153 3:163552599-163552621 CCGCACTCAGAGCAGCGGGCCGG - Intergenic
965077978 3:164003052-164003074 CCGCACTGGGAGCAGCCCGCCGG + Intergenic
965200361 3:165649594-165649616 CTGCACTCGGAGCAGCCGGCCGG - Intergenic
965220230 3:165918725-165918747 CGGCATTCGGAGCAGCTGGCCGG - Intergenic
965245258 3:166258745-166258767 CCGCACTCAGAGCAGCCGGCCGG - Intergenic
965652343 3:170947306-170947328 CCACACTTGGAGTGGCCGGCTGG + Intergenic
965837353 3:172866864-172866886 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
966096812 3:176213705-176213727 CTGCACTCGGAGCAGCCGGCCGG - Intergenic
966191034 3:177272005-177272027 CCGCACTCAGAGCAGCCGGCCGG - Intergenic
966548976 3:181183264-181183286 CCCCACTCCAAGCAGCTGGCTGG - Intergenic
967499171 3:190177326-190177348 CTGCACTCGGAGCAGCGGGCCGG - Intergenic
967594934 3:191317275-191317297 CCGCACTCAGAGAAGCTGGCTGG - Intronic
968181613 3:196599314-196599336 CCGCACTCGGAGCAGCTGGCGGG - Intergenic
968412817 4:404236-404258 CTGCACTTAGAGCAGCCGGCTGG - Intergenic
968478684 4:824707-824729 CCCCACCTGGAGCGGCTGCCTGG + Intronic
968568422 4:1327061-1327083 CCACATGTGGGGCTGCTGGCTGG - Intronic
968607486 4:1542361-1542383 CCACTACTGGAGCAGCTGGAGGG + Intergenic
968610242 4:1553774-1553796 CCATGCTTGCACCAGCTGGCGGG - Intergenic
968957626 4:3727213-3727235 CTGCACTGGGAGCTGCTGGCTGG + Intergenic
969362339 4:6672807-6672829 CCGCACTCGGAGCAGCCGGCTGG + Intergenic
970108305 4:12609715-12609737 CCGCATTTAGAGCAGCCGGCAGG + Intergenic
970120158 4:12744784-12744806 CTAGACTTGGAGCAGCTTGAGGG - Intergenic
970649344 4:18159546-18159568 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
970673183 4:18418615-18418637 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
970803509 4:20004095-20004117 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
971209145 4:24599393-24599415 CCATACTTGGAGCAGCCAGCTGG - Intergenic
971280548 4:25239509-25239531 CCGCAGTCGGAGCGGCTGGCCGG - Intronic
971377132 4:26064256-26064278 CGGCACTCGGAGCAGCCGGCCGG - Intergenic
971563549 4:28112863-28112885 CCGCACTGGGAGTGGCTGGCCGG + Intergenic
971618746 4:28828079-28828101 CCACACTCGGAGCTGCTGACCGG + Intergenic
971639807 4:29117436-29117458 CGGCACTCAGAGCAGCTGGCCGG + Intergenic
972189529 4:36573604-36573626 CAACAGTTGAAGCAGCTGGTGGG + Intergenic
972237572 4:37151281-37151303 CCACACTGGAAGCAGCTGCCTGG - Intergenic
972360958 4:38325193-38325215 CTGCACTCGGAGCGGCTGGCCGG - Intergenic
972392535 4:38626986-38627008 CCGCACTCGGAGCAGCCGGCAGG + Intergenic
972913289 4:43846253-43846275 CCGCACTTGGAGCAGCCGGCTGG + Intergenic
973037085 4:45420246-45420268 CCACACTCGGAGCAGCCGGCAGG + Intergenic
973039955 4:45457392-45457414 CCACACTCAGAGCGGCCGGCCGG - Intergenic
973041817 4:45477627-45477649 CTGCACTTGGAGCGGTTGGCCGG - Intergenic
973190328 4:47378331-47378353 CCGCACTTGGAGCGGCCGGCCGG - Intronic
973684364 4:53354352-53354374 CCACACTTGGAGTGGCCGGCCGG - Intronic
973764320 4:54149576-54149598 CCGCACTTGGAGCGGCCGGCCGG - Intronic
973765110 4:54155401-54155423 CCGCACTCGGAGCAGCCGGCCGG - Intronic
974299266 4:60042495-60042517 CTGCACTTGGAGCAGCCAGCTGG - Intergenic
974484805 4:62492173-62492195 CCGCACTCAGAGCAGCCGGCGGG - Intergenic
974563491 4:63553234-63553256 CCATACCTGGAGCAGCTGAGAGG + Intergenic
974792784 4:66712690-66712712 CCACACGCGGAGCAGCCGGCCGG - Intergenic
974804368 4:66860252-66860274 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
974827741 4:67151963-67151985 CCGCACTCGGAGCAGCCGGCGGG + Intergenic
974950360 4:68578603-68578625 CCACACTTGAAACAGGTGCCAGG - Intronic
974992890 4:69115520-69115542 TCGCACTCGGAGCAGCCGGCCGG - Intronic
975160689 4:71121011-71121033 CCGCACTTGGAGTGGCAGGCTGG + Intergenic
975596383 4:76050934-76050956 CCGCACTCGGAGCAGCCCGCCGG - Intronic
976102480 4:81580534-81580556 CCACACTCAGAGCAGCCGGCCGG + Intronic
976846059 4:89490140-89490162 CCACACTTGGAGCGGCCTGCCGG + Intergenic
977206502 4:94169928-94169950 CCGCACTCGGAGCCGCCGGCCGG + Intergenic
977416650 4:96742602-96742624 CCACACTTGGAGCGGCCAGCTGG + Intergenic
977470718 4:97438362-97438384 CCGCACTCAGAGCAGCTGGTGGG - Intronic
977641153 4:99359767-99359789 GAGCACTTGGAGCGGCTGGCCGG + Intergenic
977708642 4:100099401-100099423 CCACACTTTGAGCAGCAAGAGGG - Intergenic
977717364 4:100196797-100196819 CGGCACTAGGAGCAGCCGGCCGG - Intergenic
978030581 4:103936861-103936883 CCCCACTGGGAGCGGCTGGCCGG + Intergenic
978080234 4:104582066-104582088 CTGCACTCGGAGCAGCCGGCCGG + Intergenic
978207207 4:106092669-106092691 CCGCACTGGGAGCAGCCGGCCGG - Intronic
978241901 4:106525621-106525643 CCGCACTCGGAGCAGCCGGAGGG - Intergenic
978917987 4:114148819-114148841 CCACACTCGGAGCGGCCGGCCGG - Intergenic
978999592 4:115200471-115200493 CCACACTCGGAGCAGCCTGCCGG - Intergenic
979688570 4:123538000-123538022 CCGCACTCGGAGCAGCCAGCCGG + Intergenic
979755856 4:124339137-124339159 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
979825722 4:125229868-125229890 CTGCACTCGGAGCAGCCGGCCGG - Intergenic
979829340 4:125281032-125281054 CCGCACTTGGAGCAGCCTACTGG + Intergenic
979865203 4:125745075-125745097 CCACACTAGGAGCGGCCGGCTGG + Intergenic
979899725 4:126201567-126201589 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
980043397 4:127964514-127964536 CCGCACTGGGAGCAGCAGGCCGG - Intronic
980051949 4:128047835-128047857 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
980230269 4:130038819-130038841 CCGCACTCTGAGCAGCCGGCCGG - Intergenic
980698736 4:136395429-136395451 CCAGACTCGGAGCAGCTGGCCGG + Intergenic
980827334 4:138088846-138088868 TCGCACTCGGAGCAGCCGGCCGG - Intergenic
981146741 4:141333295-141333317 CTGCACTCGGAGCAGCCGGCCGG - Intergenic
981146748 4:141333320-141333342 CTGCACTCGGAGCAGCCGGCCGG - Intergenic
981146755 4:141333345-141333367 CTGCACTCGGAGCAGCCGGCCGG - Intergenic
981146762 4:141333370-141333392 CTGCACTCGGAGCAGCCGGCCGG - Intergenic
981146769 4:141333395-141333417 CTGCACTCGGAGCAGCCGGCCGG - Intergenic
981146776 4:141333420-141333442 CTGCACTCGGAGCAGCCGGCCGG - Intergenic
981146783 4:141333445-141333467 CTGCACTCGGAGCAGCCGGCCGG - Intergenic
981146790 4:141333470-141333492 CTGCACTCGGAGCAGCCGGCCGG - Intergenic
982024338 4:151236316-151236338 CCGCACTTGGCACAGCTGGCTGG + Intronic
982728175 4:158927785-158927807 CCGCACTCGGAGCAGCCGGCGGG + Intronic
982770129 4:159390042-159390064 CCACACTCGGAGCAGCCGGCTGG + Intergenic
982773688 4:159420984-159421006 GCGCACTCGGCGCAGCTGGCCGG + Intergenic
982868826 4:160550394-160550416 CCGCACTCGGAGCAGCTGGCCGG - Intergenic
982921252 4:161277326-161277348 CCGCACTGGGAGCGGCCGGCCGG + Intergenic
982985747 4:162203671-162203693 CCGCACTGGGAGCGGCCGGCCGG + Intergenic
983026083 4:162739624-162739646 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
983230675 4:165126214-165126236 CTGCACTCGGAGCAGCCGGCCGG - Intronic
983369780 4:166843093-166843115 CCGCACTCAGAGCGGCTGGCAGG - Intronic
983752829 4:171298358-171298380 CCGCACTCGGAGCAGCAGGCCGG + Intergenic
984069277 4:175092195-175092217 CCGCACCTGGAGCAGCCGGCTGG + Intergenic
984192854 4:176625441-176625463 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
984238835 4:177193472-177193494 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
984265638 4:177495675-177495697 CCACACTTGGAGCAGCCGGCCGG + Intergenic
984662235 4:182386644-182386666 CCGCACTCGGAGCTGCCGGCCGG + Intronic
984901734 4:184591992-184592014 CCACACTCGGAGCGGCCGGCCGG + Intergenic
984948738 4:184990365-184990387 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
985087082 4:186324667-186324689 CCACACTCGGAGCAGCCGGCCGG + Intergenic
985145417 4:186890198-186890220 TCACACTGGGAGCCGCAGGCCGG + Intergenic
985162674 4:187060818-187060840 ACACACTTGGAAGTGCTGGCAGG - Intergenic
985203233 4:187505714-187505736 CTGCACTCGGAGCAGCCGGCCGG + Intergenic
985324694 4:188754582-188754604 CCACACTTGGAGTGGCCGGCTGG + Intergenic
985403615 4:189615494-189615516 CCACACTCGGAGTGGCTGGCCGG - Intergenic
985696273 5:1342450-1342472 CTACAGTTGTAGCAGCTCGCCGG - Intronic
985972285 5:3388035-3388057 CCTCCCTTGGAGAGGCTGGCAGG + Intergenic
986371879 5:7088143-7088165 CAGCACCTGGAGCAGATGGCTGG + Intergenic
986480765 5:8184688-8184710 CCACACTTGGATGAGAGGGCTGG - Intergenic
986626148 5:9725392-9725414 CCGCACTTGGAGCAGCCGGCTGG + Intergenic
986697980 5:10375241-10375263 CTGCACTCGGAGCAGCCGGCCGG + Intronic
986912402 5:12574221-12574243 CCGCACTCGGAGCGGCCGGCTGG - Intergenic
987146266 5:14994082-14994104 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
987358208 5:17083543-17083565 CCGCACTCGGAGCAGCCCGCCGG + Intronic
987384028 5:17312049-17312071 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
987476713 5:18399949-18399971 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
987543813 5:19287828-19287850 CGGCACTTGGAGCAGCCGGCCGG + Intergenic
987896278 5:23951380-23951402 CTGCACTCGGAGCAGCCGGCTGG + Intronic
988073475 5:26324505-26324527 CCGCACTCGGAGCAGCCGGCGGG + Intergenic
988087006 5:26485557-26485579 CCGCACTCTGAGCAGCCGGCCGG - Intergenic
988143072 5:27267474-27267496 CGGCACTCGGAGCAGCCGGCCGG - Intergenic
988201791 5:28077928-28077950 CCACACTCGGAGCAGCCAGCCGG - Intergenic
988369226 5:30345812-30345834 CCGCACTAGGAGCAGCTGACCGG + Intergenic
988500118 5:31777186-31777208 CCGCACTCGGAGTGGCTGGCAGG + Intronic
988684749 5:33515663-33515685 CCACACTCGGAGCAGCGGGCCGG - Intergenic
988883572 5:35531710-35531732 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
989003186 5:36782665-36782687 CCGCACTTGGAGCAGCCCGCCGG + Intergenic
989203242 5:38786654-38786676 CCACAGCTGGAGCACCTGGGAGG - Intergenic
989950562 5:50292935-50292957 CCACACTGGGAGCTGCCAGCAGG + Intergenic
990243245 5:53837055-53837077 CCGCACTCGGAGCAGCTGGCTGG + Intergenic
990345246 5:54865160-54865182 CGGCACTCGGAGCAGCCGGCCGG + Intergenic
990512166 5:56498934-56498956 CCACACTCAGAGCAGCTTCCCGG - Intergenic
990869464 5:60415539-60415561 CCGCACTGGGAGCGGCAGGCCGG + Intronic
991505408 5:67318946-67318968 CCACACTTGGAGCTGCCAGCTGG + Intergenic
991567583 5:68020679-68020701 CCGCACTCGGAGCCGCCGGCCGG - Intergenic
991657780 5:68920952-68920974 CCGCACTCAGAGCAGCCGGCCGG + Intergenic
993320947 5:86466957-86466979 CCGCACTCGGAGCAGCCGGGCGG - Intergenic
993328595 5:86569800-86569822 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
993822018 5:92631417-92631439 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
994164082 5:96590435-96590457 CAACCCTTGGAGCAGATGGGTGG + Intronic
994229950 5:97301232-97301254 CTGCACTTGGAGCAGCCGGCCGG + Intergenic
994244885 5:97467741-97467763 CCACATTTGTAGCAGTTAGCAGG + Intergenic
994251534 5:97542156-97542178 CCACACTCGGAGCAGCCGGCTGG - Intergenic
994254806 5:97580270-97580292 CCACACTCAGAGCAGCTGGCCGG - Intergenic
994494165 5:100488811-100488833 CCACAGGTGGAGTAGCTGGGAGG + Intergenic
994507095 5:100656847-100656869 CCACACTCAGAGCAGCCGGCTGG + Intergenic
994509856 5:100689144-100689166 CCGCACTCGGAGCAGCTGGCTGG - Intergenic
994570284 5:101506111-101506133 CCGCACTTAGAGCAGCCGGCCGG + Intergenic
994669738 5:102752150-102752172 CCACACTCGGAGTGGCCGGCCGG + Intergenic
994841377 5:104929087-104929109 CCGCACTCGGAGCACCTGGCCGG + Intergenic
995032306 5:107494329-107494351 CTGCACTGGGAGCAGCCGGCCGG + Intronic
995326418 5:110894259-110894281 CCGCACTCGGAGCCGCCGGCTGG - Intergenic
995388359 5:111612437-111612459 CCACACTTGGAGTGGCGGGCCGG - Intergenic
995529119 5:113075119-113075141 CCGCACTTGGAGCAGCCGGCTGG + Intronic
995568663 5:113457228-113457250 CCACACTCGGAGCAGCTGGCTGG + Intronic
995582622 5:113617399-113617421 CCACACTTGGAGTGGCTGGCTGG + Intergenic
995678894 5:114695543-114695565 CCGCACTTGGAGCGGCCAGCCGG + Intergenic
995700348 5:114928920-114928942 CCACACTTGGAGCAGCCAGCTGG + Intergenic
995975795 5:118033863-118033885 CCGCACTCGGAGCAGCTGGCTGG + Intergenic
996107031 5:119517188-119517210 CGGCACTCAGAGCAGCTGGCCGG + Intronic
997760545 5:136444297-136444319 CCACACTCGGAGCAGCCGGCGGG + Intergenic
999406166 5:151309276-151309298 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
999855300 5:155587028-155587050 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
1000066019 5:157693922-157693944 CCTCACTGGGAGCAGCCGGCCGG + Intergenic
1000329206 5:160194173-160194195 CCGCACTGGGAGCAGCCGGCCGG - Intronic
1000547596 5:162621927-162621949 CCACACTCGGAGCAGCCGGCTGG + Intergenic
1000609130 5:163355941-163355963 CCGCACTCGGAGCAGCCAGCTGG + Intergenic
1000889328 5:166784774-166784796 CGGCACTCGGAGCGGCTGGCAGG - Intergenic
1001636432 5:173213529-173213551 CCACACTCTGAGCGGCCGGCCGG + Intergenic
1002221726 5:177688319-177688341 CCGCACTTGGAGCAGCCGGCCGG + Intergenic
1002789392 6:426477-426499 CCGCACTCGGAGCATCAGGCCGG - Intergenic
1002907039 6:1457247-1457269 CCGCACTCGGAGCATCAGGCCGG - Intergenic
1002915807 6:1526828-1526850 CCACACTTGGAACGGCTGCTTGG - Intergenic
1003069655 6:2935892-2935914 CCGCACTCGGAGCCGCCGGCCGG + Intergenic
1003070208 6:2939714-2939736 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
1003100175 6:3170850-3170872 CCGCACTCGGAGCAGCCAGCCGG + Intergenic
1003178472 6:3771721-3771743 CCGCACTCGGAGCGGCTGGCTGG + Intergenic
1003224480 6:4191565-4191587 CCACACTCCGAGCAGCCGGCTGG - Intergenic
1003581429 6:7344301-7344323 CCGCACTCGGAGCAGCCAGCCGG + Intronic
1003587234 6:7402957-7402979 CCACACTGGGATCTGCTGGGAGG - Intronic
1003589593 6:7425866-7425888 CCGCACTCGGAGCAGCCAGCTGG + Intergenic
1003749567 6:9040843-9040865 CCGCACTCGGAGCGGCAGGCCGG + Intergenic
1003908114 6:10720678-10720700 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
1003982482 6:11402858-11402880 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
1004053167 6:12108666-12108688 CCGCACTCGGAGCAGCCGGCCGG - Intronic
1004220596 6:13743285-13743307 CCGCACTAGGAGCAGCCGGCCGG + Intergenic
1004224384 6:13772574-13772596 CCGCACTCGCAGCAGCCGGCCGG + Intergenic
1004233721 6:13854992-13855014 CAGCACTCGGAGCAGCCGGCCGG - Intergenic
1004234251 6:13860218-13860240 CCGCACTCGGAGTGGCTGGCTGG + Intergenic
1004250305 6:14018119-14018141 CCGCACTCGGAGCGGCCGGCCGG + Intergenic
1004503221 6:16227172-16227194 CCGCACTCGGAGCGCCTGGCCGG - Intergenic
1004811812 6:19270860-19270882 TCACACTTGGCACAGCTGGCCGG + Intergenic
1004866071 6:19854703-19854725 CCGCACTCGGAGCAACCGGCCGG - Intergenic
1004883687 6:20032421-20032443 CGACACTTGGAACGGCCGGCCGG + Intergenic
1004906199 6:20239147-20239169 CCACAGTCGGAGCGGCCGGCCGG + Intergenic
1005600889 6:27425104-27425126 CCGCGCTCGGAGCAGCCGGCCGG - Intergenic
1005707460 6:28469629-28469651 CCGCACTCGGAGCAACCGGCCGG - Intergenic
1005758909 6:28950069-28950091 TCGCACTCGGAGCAGCCGGCAGG - Intergenic
1005766303 6:29015179-29015201 CCACACTCGGAGCGGCCGGCCGG + Intergenic
1005870591 6:29971975-29971997 CCTCACTTGGAACTGCTGGGTGG - Intergenic
1005978254 6:30816574-30816596 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
1006116418 6:31778263-31778285 CCACATTTTGGGCAGCTGGGTGG + Intronic
1006127953 6:31852140-31852162 CCGCTCTTGGAGCGGCAGGCTGG + Intergenic
1006351116 6:33521775-33521797 CCACACTCGGAGCAGCCGGCTGG - Intergenic
1006434144 6:34017458-34017480 CCGCACTGGGAGCCGCCGGCTGG - Intergenic
1006748916 6:36364508-36364530 CCGCACTCGGAGCAGCCGGCCGG - Intronic
1008005607 6:46406042-46406064 CCGCATTCGGAGCAGCCGGCCGG - Intronic
1008038767 6:46774683-46774705 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
1008230884 6:48984028-48984050 CCACACTCGGAGCCGCCAGCTGG + Intergenic
1008270202 6:49482100-49482122 CCACACTCGGAGCAGCTGGCTGG - Intronic
1008270506 6:49483693-49483715 CCACACTTGGAGCAGCTGGCTGG - Intronic
1008284360 6:49629825-49629847 CCGCACTCGGAGCAGCCGGCTGG - Intronic
1008567821 6:52786599-52786621 CCACACTCAGAGTGGCTGGCCGG + Intergenic
1008669567 6:53753674-53753696 CCTGACTTGGAGGAGCAGGCAGG - Intergenic
1009530289 6:64803818-64803840 CCAAAATTGGAGCAGGTGCCAGG + Intronic
1009615508 6:65999642-65999664 CTGCACTCGGAGCCGCTGGCCGG - Intergenic
1009685321 6:66949299-66949321 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
1009800711 6:68533517-68533539 CTGCACTTGGAGCAGCCGGCCGG + Intergenic
1010199329 6:73269150-73269172 CCATACTCGGAGCAGCCGGCCGG - Intronic
1010235665 6:73572812-73572834 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
1010269330 6:73903243-73903265 CCACACTCGGAGCAGCTGGCTGG + Intergenic
1010277958 6:73990906-73990928 CAGCACTGGGAGCGGCTGGCGGG - Intergenic
1010617367 6:78029883-78029905 CCGCACTCGGAGCGGCCGGCCGG + Intergenic
1011620103 6:89234722-89234744 CCGCACTCGGAGCGGCCGGCTGG - Intergenic
1011879945 6:92012021-92012043 CTGCACTCGGAGCGGCTGGCTGG - Intergenic
1012189356 6:96261221-96261243 CCGCTCTCGGAGCAGCCGGCCGG - Intergenic
1012789685 6:103677391-103677413 CCACACTCGGTGCAGCTGGCTGG - Intergenic
1013025737 6:106269682-106269704 CCGCACTCGGAGCAGCCGGCCGG - Intronic
1013651543 6:112200086-112200108 CAACACTGCGAGCAGCTGGCAGG + Intronic
1013694815 6:112689599-112689621 CCGCACTAGGAGCGGCCGGCGGG - Intergenic
1013853352 6:114541959-114541981 CCTCACTTGGAGCAGCCAGCCGG - Intergenic
1014240725 6:119015408-119015430 CCACACTCAGAGCGGCCGGCCGG + Intronic
1014256253 6:119162180-119162202 GCACACTTGGACCAACTGGTGGG + Intergenic
1014280796 6:119441084-119441106 CCGCACTCGGAGCGGCCGGCTGG + Intergenic
1014882690 6:126743207-126743229 CCACACTGGGAGAATCTGCCTGG - Intergenic
1015572269 6:134633821-134633843 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
1015600331 6:134904815-134904837 CCGCACTCGGAGCAGCCGACCGG + Intergenic
1016067385 6:139698191-139698213 CCGCACTCGGAGCAGCCGGCTGG - Intergenic
1016092846 6:139999860-139999882 CCGCACTCGGAGCAGCCGGCGGG - Intergenic
1016183515 6:141175181-141175203 CCAGACTCAGCGCAGCTGGCTGG + Intergenic
1016217181 6:141618296-141618318 CGGCACTCGGAGCAGCCGGCAGG + Intergenic
1016482333 6:144495425-144495447 CCGCACTCGGAGCAGCAGGCTGG - Intronic
1016858933 6:148698320-148698342 CCGCACTTGGAGCAGCCGGTGGG - Intergenic
1017325072 6:153133706-153133728 CCGCACTCGGAGCAGCCGGCAGG + Intergenic
1017383533 6:153857215-153857237 CCGCACTCAGAGCAGCTGGCTGG - Intergenic
1017581238 6:155867031-155867053 CCGCACTTGGAGCAGCCGGCCGG - Intergenic
1017839525 6:158210064-158210086 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
1018064255 6:160114777-160114799 CCGCACTCAGAGCAGCCGGCCGG - Intergenic
1018216642 6:161534463-161534485 CCACACGTGGAGCTGCTGTGGGG - Intronic
1018545660 6:164933383-164933405 CCGCACTGGGAGCAGCTGGCTGG + Intergenic
1018624662 6:165765562-165765584 CCGCACTCGGAGCAGCCAGCCGG - Intronic
1018700540 6:166422684-166422706 CCCCGCTCGGAGCAGCTAGCAGG - Intronic
1018982049 6:168608419-168608441 CCACACGGGGAGCACCTGGGGGG + Intronic
1019000280 6:168744061-168744083 CCGCACTCGGAGCAGCCAGCCGG - Intergenic
1019086211 6:169480120-169480142 CCACACTTGGAGCAGCCAGCCGG + Intronic
1019557823 7:1641366-1641388 CCACACATGGGGCAGGGGGCAGG - Intergenic
1019965769 7:4497206-4497228 CTGCACTCGGAGCAGCAGGCCGG - Intergenic
1020375362 7:7478820-7478842 CCGCACTTGGAGCAGCCGACTGG - Intronic
1021133858 7:16943073-16943095 CTGCACTCAGAGCAGCTGGCCGG + Intergenic
1021174994 7:17440146-17440168 CCACAGCTGGAGCAGCTGGGAGG + Intergenic
1021567375 7:22028763-22028785 CCACACTCGGAGCGGCTGGCCGG + Intergenic
1021686777 7:23194003-23194025 CCACACTCAGAGCTGCCGGCTGG - Intronic
1021760022 7:23894504-23894526 CCAAGCTTGGAGGAGCTGACAGG + Intergenic
1023396218 7:39754215-39754237 CCGCACTCGGAGCGGCGGGCCGG - Intergenic
1023685272 7:42727782-42727804 CCACAGTGGGAGCAGAAGGCAGG + Intergenic
1023767895 7:43529071-43529093 CCACTGTGGGAGCAGGTGGCTGG - Intronic
1024269060 7:47628561-47628583 CCGCACCCGGAGCAGCCGGCCGG + Intergenic
1024335653 7:48203189-48203211 CCGCACTCGGAGCAGCCGGCCGG - Intronic
1024348013 7:48333167-48333189 CCACACATTGATCAGCTGTCAGG + Intronic
1024691261 7:51805919-51805941 CCGCACTCGGAGCAGCAGGCCGG + Intergenic
1024834029 7:53495105-53495127 CCGCACTCAGAGCAGCCGGCCGG + Intergenic
1025962087 7:66231616-66231638 CCGCACTCGGAGCAGCTGGCTGG - Intronic
1026202930 7:68231115-68231137 CCGCACTCGGAGCAGCCAGCTGG + Intergenic
1026335881 7:69393911-69393933 CCGCACTCAGAGCAGCCGGCCGG + Intergenic
1026444674 7:70473942-70473964 CCACGCTTGAAGAAGCTGGGAGG - Intronic
1026512324 7:71037678-71037700 CCACATTGAGAGCAGCCGGCCGG + Intergenic
1026516550 7:71078073-71078095 CCACACTGGGAGCAGCAGGCCGG + Intergenic
1026596574 7:71738355-71738377 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
1027238025 7:76309713-76309735 CCGCACTTGGAGCAGCCGGCCGG - Intergenic
1027340353 7:77201243-77201265 GCAAACTTGGAGCACTTGGCTGG + Intronic
1027476681 7:78640671-78640693 CCTCACGGGGAGCAACTGGCTGG + Intronic
1027561653 7:79739384-79739406 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
1027564056 7:79768240-79768262 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
1027667547 7:81057759-81057781 CTGCACTCGGAGCAGCCGGCTGG - Intergenic
1027674455 7:81141822-81141844 CCACACTCTGAGCGGCCGGCCGG + Intergenic
1027698303 7:81437365-81437387 ACGCACTCGGAGCAGCCGGCCGG - Intergenic
1027868082 7:83673402-83673424 CCGCACTCGGAGCGGCCGGCTGG + Intergenic
1028303307 7:89229004-89229026 CCACACTCGGAGCAGCCGGCCGG - Intronic
1028392651 7:90334504-90334526 CCGCACTCGGAGCAGCCAGCCGG + Intergenic
1028852536 7:95552742-95552764 CCACACTCGGAGCGGCCGGCCGG - Intergenic
1029065360 7:97843142-97843164 CCGCACTCTGAGCAGCCGGCTGG - Intergenic
1029076138 7:97936013-97936035 CCGCACTAGGAGCTGCCGGCTGG + Intergenic
1029202216 7:98846781-98846803 CCACCTCGGGAGCAGCTGGCAGG + Exonic
1029483711 7:100827181-100827203 CCACACTTGGCGCCGCCGCCCGG - Exonic
1030215735 7:107042594-107042616 CCGCACTCGGAGCGGCCGGCCGG - Intergenic
1030367028 7:108657493-108657515 CCGCACTCGGAGCGGCCGGCGGG - Intergenic
1030599999 7:111582219-111582241 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
1030733464 7:113017427-113017449 CCGCACTCGGAGCAGCCGGCAGG + Intergenic
1030772240 7:113488421-113488443 CCACACTCGGAGCAGCTGGCCGG - Intergenic
1030780397 7:113593403-113593425 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
1030819330 7:114077119-114077141 CCGCACTCGGAGCAGCCAGCCGG - Intergenic
1031109959 7:117596229-117596251 CCGCACTCGGAGCAGCCGGCCGG + Intronic
1031378781 7:121060054-121060076 CTGCACTCGGAGCAGCCGGCCGG + Intronic
1031902850 7:127429250-127429272 CCATACTTGGAGCGGCCGGCTGG + Intronic
1032248059 7:130230106-130230128 CTGCACTCGGAGCAGCCGGCCGG + Intergenic
1032252527 7:130270479-130270501 GCACACCTGCAGCATCTGGCTGG + Intronic
1032339635 7:131058847-131058869 CCGCACTCGGAGCAGCTGTCTGG + Intergenic
1032561622 7:132898883-132898905 CTGCACTCGGAGCAGCCGGCCGG - Intronic
1033394101 7:140957221-140957243 CCTCACTCGGAGCAACTCGCCGG - Intergenic
1033664119 7:143424673-143424695 CCGCACTCGGAGCGGCCGGCCGG - Intergenic
1033866651 7:145697645-145697667 CCGCACTTGGAGCGGCCGGCCGG - Intergenic
1034097894 7:148426492-148426514 CCGCACTCGGAGCAGCCAGCCGG + Intergenic
1034100371 7:148445501-148445523 CCACACTCGGAGCCGCCAGCGGG - Intergenic
1034492704 7:151402498-151402520 CCCCACTGGCAGCGGCTGGCTGG + Intronic
1034821214 7:154217916-154217938 CCAGATCTGGAGCAGCTGGCGGG + Intronic
1034948695 7:155281744-155281766 CCACATTTGGAGCAGCCCACAGG + Intergenic
1035151201 7:156874280-156874302 CCGCACTCGGAGCAGCCAGCCGG - Intronic
1035366989 7:158355453-158355475 ACACAGTGTGAGCAGCTGGCAGG - Intronic
1035463917 7:159063416-159063438 CCGCACTTGGAGCGGCCGGCCGG - Intronic
1035553183 8:545128-545150 CCACACTGGGAGGAGGGGGCCGG - Intronic
1035734875 8:1880946-1880968 CCTCACATGCAGCATCTGGCTGG + Intronic
1035833899 8:2727919-2727941 CCCCACTCGGAGCGGCAGGCCGG + Intergenic
1035999228 8:4582911-4582933 CCACACTCGGAGCAGCTGGCCGG + Intronic
1036123834 8:6045294-6045316 CAGCACTTGGAGCAGCCGGCTGG - Intergenic
1036135046 8:6152791-6152813 TCCCACTCGGAGCAGCAGGCCGG + Intergenic
1036441050 8:8781668-8781690 CCGCACTAGGAGCAGCCGGCCGG - Intergenic
1036554665 8:9848032-9848054 CCGCACTTGGAGCCACCGGCCGG - Intergenic
1036801356 8:11794887-11794909 CCGCACTTGGAGCGGGCGGCCGG + Intergenic
1036837648 8:12088844-12088866 CCACACTTGAGGCGGCTGGCCGG + Intergenic
1036859441 8:12335092-12335114 CCACACTTGAGGCGGCTGGCCGG + Intergenic
1036907546 8:12720074-12720096 CCAGAATTGGAGCAGGTGTCAGG - Intergenic
1036914961 8:12796379-12796401 CCGCACTCGCAGCAGCTGGCCGG + Intergenic
1036928667 8:12931581-12931603 CCGCACTCGGAGCGGCCGGCCGG - Intergenic
1036952532 8:13154474-13154496 CCGCACTCGGAGCAGCTGGCCGG - Intronic
1037064998 8:14566910-14566932 CCACACTCAGAGCGGCCGGCTGG + Intronic
1037417591 8:18667960-18667982 CCACACTTGGAGCGGCCGGCCGG - Intronic
1037810957 8:22086638-22086660 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
1037957572 8:23071062-23071084 CTGCACTCGGAGCAGCCGGCCGG - Intergenic
1038638263 8:29304337-29304359 CCACACTCGGAGCAGCCGGCCGG + Intergenic
1038639388 8:29311549-29311571 CCACACTCGGAGCAGCTGGCTGG + Intergenic
1039637284 8:39180198-39180220 CCGCACTCGGAGCAGCGGGCCGG + Intronic
1040014438 8:42689577-42689599 CCGCACTGGGAGCGGCCGGCTGG + Intergenic
1040583430 8:48716262-48716284 CCGCACTTGGAGCGGCCGGCTGG - Intronic
1040701767 8:50074945-50074967 CCACACTTGGAGCGGCCTGCCGG + Intronic
1040804325 8:51377600-51377622 ACACACTGAGAGCAGCTCGCCGG + Intronic
1040954939 8:52970124-52970146 CCGCACTAGGAGCAGCTGGCCGG - Intergenic
1040965589 8:53077904-53077926 CCACACTTGGAGCAGCTGGCTGG - Intergenic
1041034674 8:53776175-53776197 CCAAACTCGGAGCAGCCGGCCGG - Intronic
1041588356 8:59547181-59547203 CTGCACTTGGAGCGGCTGGCGGG + Intergenic
1042182182 8:66101868-66101890 CCACTCTTGGACCAGCTTCCTGG - Intergenic
1042772617 8:72395939-72395961 CTACACTTGGAGCTTCTAGCTGG - Intergenic
1043073366 8:75665741-75665763 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
1043102237 8:76060683-76060705 CCACACTTGGAGAAGCCGGCCGG - Intergenic
1043346444 8:79303578-79303600 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
1043352506 8:79377481-79377503 CCGCACTCGGAGCAGCCAGCCGG - Intergenic
1043621045 8:82192527-82192549 CCACACTCGGAGCGGCCGGCGGG - Intergenic
1043701111 8:83290436-83290458 CCGCACTCGGAGCGGCCGGCTGG + Intergenic
1043857148 8:85276146-85276168 CCGCACTCGGAGCGGCGGGCCGG + Intronic
1044075807 8:87820918-87820940 CCGCACTCGGAGCAGCCGGCTGG + Intergenic
1044088474 8:87971231-87971253 CCGCACTCGGAGTGGCTGGCCGG + Intergenic
1044633492 8:94300610-94300632 CCGCACTCGGAGAAGCCGGCCGG - Intergenic
1045272171 8:100671135-100671157 CAGTGCTTGGAGCAGCTGGCCGG + Intergenic
1045306035 8:100957386-100957408 CCGCACTTGGCGCAGCTGGCCGG - Intergenic
1046149365 8:110202847-110202869 CCGCACTCGGAGCAGCCGGCAGG - Intergenic
1046288886 8:112132775-112132797 CCGCACTCAGAGCAGCCGGCAGG + Intergenic
1046445319 8:114311435-114311457 CCGCACTGGGAGCAGCCGACCGG + Intergenic
1046641151 8:116733253-116733275 AAACACTTGGAGGAGCTGGGAGG - Intronic
1046661214 8:116950012-116950034 CCGCACTCGGAGCCGCCGGCCGG - Intergenic
1047505628 8:125477211-125477233 TGTCACTTGGAGCAGCTGGGAGG - Intergenic
1047631722 8:126714913-126714935 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
1047835176 8:128681581-128681603 ACACACTTGGAGGAGCAGGCAGG - Intergenic
1048186899 8:132249933-132249955 CTTCACTTGGAGCGGCCGGCCGG - Intronic
1048286728 8:133147400-133147422 CTGCACGTGGAGCAGCTGACAGG - Intergenic
1048441342 8:134461864-134461886 CCACACGTGGCGCAGCATGCAGG - Intergenic
1048676978 8:136794067-136794089 CCGCACTCGGAGCGGCCGGCCGG - Intergenic
1048757518 8:137755397-137755419 CCGCACTGGGAGCAGCCGGCCGG - Intergenic
1048789155 8:138084219-138084241 CCGCACTTGGAGCAGCCGGCCGG + Intergenic
1048920511 8:139225746-139225768 CCAGATTTGGAGCTGCTGGTAGG + Intergenic
1049087656 8:140490791-140490813 CCACACTCGGAGCAGCCGGCCGG - Intergenic
1049251085 8:141589315-141589337 CCAGACTTGCAGAAGCTGGTGGG + Intergenic
1049500295 8:142959560-142959582 CCGCACTCGGAGCAGACGGCCGG + Intergenic
1049598062 8:143493474-143493496 CCACACCTGGAGAAGGTGGAAGG + Intronic
1049857924 8:144875254-144875276 CCGCGCTCGGAGCTGCTGGCCGG + Intergenic
1050360950 9:4830577-4830599 CCACCATTGGAGCAGCTTGTTGG - Intronic
1051305108 9:15700318-15700340 CCACACTCAGAGCAGCCGGCCGG - Intronic
1051314209 9:15810680-15810702 CCGCACTCGGAGCAGCCAGCCGG - Intronic
1051383287 9:16480592-16480614 CCACACTTGGAGCAGCAGGCCGG + Intronic
1051439842 9:17072689-17072711 CCACACTTGGAGCAGCAGGCTGG + Intergenic
1051715637 9:19980307-19980329 CCACACTTGAAGAAGCAAGCAGG + Intergenic
1051853314 9:21534360-21534382 CCACACTTGAAGAAGCTAACAGG + Intergenic
1052122776 9:24738611-24738633 CCACAGTTGGAGCTGCTGGCCGG + Intergenic
1052979529 9:34438008-34438030 CCGCACTCGGAGCAGCCGGCTGG + Intronic
1053027304 9:34740513-34740535 CTGCACTCGGAGCAGCCGGCTGG - Intergenic
1054160706 9:61670557-61670579 CCACATCTGGAGAGGCTGGCAGG + Intergenic
1054161000 9:61671966-61671988 CCACAATTGGAGGGGCTGGCAGG + Intergenic
1054722430 9:68617107-68617129 CCACACTCGGAGCAGCCCGCCGG + Intergenic
1055557595 9:77490659-77490681 CCGCACTCGGAGCGGCCGGCCGG - Intronic
1055654918 9:78442154-78442176 CCGCACTGGGAGCGGCTGGCCGG + Intergenic
1055985526 9:82054611-82054633 CCGCACTCGGAGCAGCCAGCTGG - Intergenic
1056080983 9:83093583-83093605 CCACACTCGGAGCAGCCGACCGG - Intergenic
1056547389 9:87624158-87624180 CCACAGCTGGAGCAGATGCCTGG + Intronic
1056735927 9:89209486-89209508 CCGCACTTGGAGCGGCCAGCTGG + Intergenic
1057511121 9:95680414-95680436 CCGCACTAGGAGCAGCTGGCGGG + Intergenic
1058174887 9:101724392-101724414 CCGCACTCGGAGCAGCGGGCCGG - Intronic
1058235700 9:102487216-102487238 CCGCGCTTGGAGCGGCTGGCAGG - Intergenic
1058727508 9:107817877-107817899 CCACACTGGGAGCGGCCGGCCGG + Intergenic
1058960636 9:109989735-109989757 CCACAGTAGGAGAAGCTGGCAGG - Intronic
1059667794 9:116465349-116465371 CCAGAATGGGAGCAACTGGCTGG + Intronic
1059791169 9:117643004-117643026 CCGCACTCGGAGCGGCCGGCCGG - Intergenic
1060305389 9:122406431-122406453 CCACACTCGGAGCGGCCAGCCGG - Intergenic
1061299654 9:129697366-129697388 GCACCCTCGGAGCAGCTGGGCGG + Intronic
1061801099 9:133113807-133113829 CCACATCTGGACCAGCTGGGAGG + Intronic
1062399643 9:136366747-136366769 CCTCACTTGGGGAAGCTGGGAGG + Intronic
1062402031 9:136376963-136376985 GCCCACTTGCAGCAGCTGGGAGG - Intronic
1203429790 Un_GL000195v1:80448-80470 CCACACTCGGAGCCGCCGGCTGG + Intergenic
1203460441 Un_GL000220v1:31263-31285 CCGCACTTGGAGCGGCCAGCTGG - Intergenic
1186152616 X:6690784-6690806 CCGCACTTGGAGCGGCCGGCCGG - Intergenic
1186293175 X:8121672-8121694 CCGCACTCGGAGAGGCTGGCCGG + Intergenic
1187139028 X:16575536-16575558 CGGCAGTCGGAGCAGCTGGCCGG + Intergenic
1188078261 X:25805919-25805941 CCGCACTCCGCGCAGCTGGCTGG - Intergenic
1188242547 X:27809222-27809244 CGGCACTCAGAGCAGCTGGCAGG + Intronic
1190045890 X:47111281-47111303 CCGCACTCGGAGCAGCCGGCTGG - Intergenic
1191188554 X:57640109-57640131 CCACAGCTGGAGCAGCTGGGAGG - Intergenic
1191618655 X:63192849-63192871 CCACACTCGGAGCAGCCGGCCGG - Intergenic
1192251385 X:69416851-69416873 CAACACTCGGAGCAGCCGGCTGG + Intergenic
1192282593 X:69701395-69701417 CCACACTTGAAACAGGTGCCAGG + Intronic
1192661884 X:73050260-73050282 CCTCACTTGGGGCAGTTGCCAGG - Intergenic
1194118049 X:89926812-89926834 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
1194890497 X:99372313-99372335 CAGCACTCGGAGCAGCAGGCCGG - Intergenic
1195259373 X:103117336-103117358 CCACACTCGGAGCAGCCGGCTGG - Intergenic
1195460275 X:105115986-105116008 CCGCACTCAGAGCTGCTGGCTGG - Intronic
1196152716 X:112392496-112392518 ACACACTTGTAGGAGGTGGCTGG + Intergenic
1196319551 X:114270837-114270859 CCGCACTGGGAGCAGCCGGCCGG - Intergenic
1196582674 X:117394764-117394786 CCACACTCCGAGCAGCCGGCCGG + Intergenic
1196761994 X:119208750-119208772 CCGCGCTCGGAGCAGCTGGCCGG - Intergenic
1196775487 X:119333678-119333700 CCGCACTCGGAGCAGACGGCTGG + Intergenic
1196827297 X:119751106-119751128 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
1196845039 X:119890674-119890696 CCGCACTCGGAGCAGCCGGCCGG + Intergenic
1197331195 X:125155738-125155760 CCACACTCGGAGTGGCCGGCCGG - Intergenic
1197340032 X:125255730-125255752 CCACACTCGGAGCAGCCGGCCGG + Intergenic
1197607909 X:128606688-128606710 CCGCACTCGGAGCGGCCGGCGGG + Intergenic
1198299964 X:135325537-135325559 CCGCACTCGGAGCAGCCGGCCGG + Intronic
1198972611 X:142298523-142298545 CCGCACTCGGAGCAGCCGGCTGG - Intergenic
1198989141 X:142490812-142490834 CCACACTTGTAAAAGCTGGACGG + Intergenic
1199353437 X:146832087-146832109 CCACTCTTGGAGCAGCCATCTGG + Intergenic
1199356269 X:146867160-146867182 CCACACTCGGAGCAGCCGGCTGG - Intergenic
1199443695 X:147897252-147897274 CCACACTGGGTGCAGCTGGCTGG - Intergenic
1200244831 X:154517360-154517382 GCGCACTTGGGGCAGCCGGCAGG - Intergenic
1200470926 Y:3584375-3584397 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
1200748405 Y:6922850-6922872 CCGCACTTGGCGCAGCTGGCCGG - Intronic
1201285503 Y:12375286-12375308 CCGCACTCGGAGCAGCCGGCCGG - Intergenic
1201423063 Y:13820482-13820504 CCACACCCGGAGCAGCCAGCCGG - Intergenic
1201556306 Y:15267382-15267404 TCACACTTGGAGCAGCCGCCCGG + Intergenic
1201729945 Y:17192538-17192560 CCACACTCGGAAGGGCTGGCCGG - Intergenic
1202090494 Y:21183504-21183526 CCACACTCGGTGCGGCCGGCTGG + Intergenic
1202165894 Y:21987348-21987370 TCACACTGGGAGCTGCAGGCTGG + Intergenic
1202225464 Y:22599024-22599046 TCACACTGGGAGCTGCAGGCTGG - Intergenic
1202317649 Y:23596637-23596659 TCACACTGGGAGCTGCAGGCTGG + Intergenic
1202553117 Y:26073421-26073443 TCACACTGGGAGCTGCAGGCTGG - Intergenic