ID: 1008270510

View in Genome Browser
Species Human (GRCh38)
Location 6:49483697-49483719
Sequence GGCCCCACACTTGGAGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1436
Summary {0: 7, 1: 82, 2: 338, 3: 434, 4: 575}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008270510_1008270519 25 Left 1008270510 6:49483697-49483719 CCAGCTGCTCCAAGTGTGGGGCC 0: 7
1: 82
2: 338
3: 434
4: 575
Right 1008270519 6:49483745-49483767 TACAGCTGACCTGCAAGCACCGG No data
1008270510_1008270520 26 Left 1008270510 6:49483697-49483719 CCAGCTGCTCCAAGTGTGGGGCC 0: 7
1: 82
2: 338
3: 434
4: 575
Right 1008270520 6:49483746-49483768 ACAGCTGACCTGCAAGCACCGGG No data
1008270510_1008270513 -1 Left 1008270510 6:49483697-49483719 CCAGCTGCTCCAAGTGTGGGGCC 0: 7
1: 82
2: 338
3: 434
4: 575
Right 1008270513 6:49483719-49483741 CTGCTAAACCCACGCCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008270510 Original CRISPR GGCCCCACACTTGGAGCAGC TGG (reversed) Intronic
900113291 1:1018593-1018615 GGCCCCGCACTTGGAGCAGCCGG - Intergenic
900151026 1:1179461-1179483 GGCCCCTCTCTCGGAGCAGCGGG - Intronic
900463654 1:2813349-2813371 GGCCCCACACTTGGAGTGGCCGG + Intergenic
900477758 1:2883838-2883860 GGACCAATACTGGGAGCAGCAGG + Intergenic
900534932 1:3172081-3172103 GCCCCCACACCTAGGGCAGCTGG - Intronic
900547541 1:3237025-3237047 GGCCCCACACTTGGGTCAGCAGG + Intronic
900683412 1:3931539-3931561 GGCCTCACCCTTGGGGCAGGAGG - Intergenic
901049198 1:6418009-6418031 GGCCCCTGCCATGGAGCAGCAGG - Exonic
901601493 1:10426641-10426663 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
901783325 1:11608836-11608858 GGCCCCGCACTCGGAGCAGCAGG + Intergenic
902033429 1:13439364-13439386 GGCCCCGCACTCTGAGCCGCGGG + Intergenic
902100445 1:13983444-13983466 GGCCCTGCACTCAGAGCAGCCGG - Intergenic
902791690 1:18773138-18773160 TGCTCCACTGTTGGAGCAGCAGG - Intergenic
903003321 1:20281889-20281911 TGCCCCACCCTTTGAACAGCTGG + Intergenic
903355777 1:22746522-22746544 GTCTTCACACTTGGAGCAACAGG + Intronic
903389656 1:22954881-22954903 AGCCCCACTCTGGGAGCAGTGGG - Intronic
903417438 1:23193605-23193627 GGCCCCACAGGTGGAGTAGATGG + Exonic
903594935 1:24486818-24486840 GGCCCCTCACAGGGAGCAGCTGG - Intergenic
903624590 1:24721603-24721625 GGCCCCGCACTGGGAGCCTCCGG + Intergenic
904883541 1:33718543-33718565 GGGATCACACTTGGAGTAGCAGG - Intronic
905742874 1:40387931-40387953 GGCCCCGCACTTGGAGCAGCCGG + Intronic
905761164 1:40559153-40559175 GGCCCCACACTCCAAGCGGCCGG - Intergenic
906563527 1:46778787-46778809 GGCCCCGCACTGGGAGCAGCCGG - Intronic
907759515 1:57343688-57343710 GACCCCACACTTGGAGCGGCCGG - Intronic
907889478 1:58623509-58623531 GGGCCCGCACTGGGAGCAGCCGG + Intergenic
907980045 1:59472207-59472229 GACCCCGCACTTGGAGCGGTCGG + Intronic
908027772 1:59969946-59969968 GGCCCCGCACTTGGAGCAGCCGG - Intergenic
908260547 1:62336793-62336815 GCCCCTACACCTGGAGGAGCCGG + Intergenic
908299909 1:62753510-62753532 GGTCCCGCACTTGGAGTGGCCGG + Intergenic
908888573 1:68817799-68817821 GGCCCCGCACTTGGAGCGGCCGG + Intergenic
909335221 1:74465342-74465364 GGCCCCATACTTGGAGTGGCCGG + Intronic
909608749 1:77532002-77532024 AGCCCCGCACTCGGAGCGGCCGG - Intronic
910478836 1:87636508-87636530 GGCCCCGCACTTGGACGGGCTGG - Intergenic
910609770 1:89128323-89128345 GGCCCAGCACTCGGAGCAGCCGG - Intronic
910685724 1:89914240-89914262 GGCCCCGCACTCGGAGCAGTTGG - Intronic
911001441 1:93170346-93170368 GGCCCCGCACTGGGAGCGGCCGG + Intronic
911259618 1:95669909-95669931 GGCCCCACACTCGGAGCAGCCGG - Intergenic
911305252 1:96224620-96224642 GGCCCCGCACTCAGAGCAGCCGG - Intergenic
911839268 1:102660294-102660316 GGTCCTGCACTCGGAGCAGCCGG - Intergenic
911853929 1:102853854-102853876 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
912058142 1:105631517-105631539 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
912166132 1:107044834-107044856 GGCCCCGCACTCCGAGCAGCCGG + Intergenic
912315912 1:108667554-108667576 GGGACCGCACTCGGAGCAGCCGG + Intergenic
912538775 1:110396619-110396641 GGCCCCGCACTCGGAGAGGCTGG - Intergenic
912819393 1:112854795-112854817 GGCCCGGCACTCGGAGCAGCCGG - Intergenic
913117562 1:115711112-115711134 GGCCCCACTCCTGGGGGAGCTGG + Intronic
914145425 1:144990728-144990750 GGCCCCGCACTCGGAGCAGCCGG + Intronic
914438460 1:147681048-147681070 GGCCCCACACTCGGAGCAGCCGG - Intergenic
915104110 1:153521865-153521887 GGCCCCACACTCGGAGCAGCCGG + Intergenic
915260034 1:154670829-154670851 GGCCCCACACTCGGAGCAGCCGG + Intergenic
915261204 1:154678116-154678138 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
915606036 1:156951526-156951548 TGACCCACTCTTCGAGCAGCTGG + Intronic
915865573 1:159494890-159494912 GGCCCTGCACTCGGAGCAGCTGG - Intergenic
916219846 1:162433232-162433254 GGCCCCGAACTCGGAGCAGCCGG + Intergenic
916606058 1:166343314-166343336 GGCCCCGCACTCGGAGGGGCCGG - Intergenic
916910127 1:169337359-169337381 GGCCCTGCACTGGGAGCAGTCGG - Intronic
916940055 1:169668133-169668155 GACCCCACACTCGGAGCGGCCGG + Intronic
916960263 1:169882190-169882212 GGCCCCCCACTTGGAGCAGCCGG + Intronic
917094008 1:171381966-171381988 GGCCCTGCACTTGGAGCAGCCGG - Intergenic
917197906 1:172485710-172485732 GGCTCCTAACTTGGACCAGCTGG - Intergenic
917406322 1:174711476-174711498 GACCCCGCACTCGGAGCGGCTGG + Intronic
917445426 1:175102582-175102604 GGCCCCGCACTCAGAGCAGCCGG - Intronic
917446381 1:175108739-175108761 GGCCCCGCACTCAGAGCAGCCGG - Intronic
917578567 1:176349552-176349574 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
917933018 1:179837212-179837234 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
918058988 1:181045913-181045935 GGCCCTGCACTGGGGGCAGCCGG + Intronic
918154559 1:181832494-181832516 GGCCCCGCATTCGGAGCAGCTGG + Intergenic
918542720 1:185649209-185649231 GGCCCCGCACTCGGAGTGGCTGG - Intergenic
918659776 1:187074098-187074120 GGCTCCGCACTCGAAGCAGCTGG - Intergenic
918720816 1:187850280-187850302 GGCCCTGCACTCAGAGCAGCCGG + Intergenic
918732311 1:188013565-188013587 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
918789955 1:188813165-188813187 GGGCCCGCACTCGGAGCTGCCGG + Intergenic
918792057 1:188841456-188841478 GGTCCCGCACTGGGAGCAGCCGG - Intergenic
918853231 1:189718580-189718602 GGCCCAGCACTCAGAGCAGCCGG - Intergenic
918993878 1:191731893-191731915 GGCCCCGCACTCGGAGCGGCCGG + Intergenic
919091884 1:192986989-192987011 GGCTCCGCACTCGGAGCAGCCGG + Intergenic
919174453 1:194001920-194001942 GGCCCTGCACTTGGAGCAGCCGG + Intergenic
919237022 1:194859145-194859167 GGCCACGCACTTGGAACAGCTGG + Intergenic
919297781 1:195723152-195723174 GCCCCCGCACTCGGAGCGGCCGG - Intergenic
920150211 1:203900315-203900337 GGCCCTGCACTCGGAGCGGCCGG + Intergenic
920479454 1:206307734-206307756 GGCCCCGCACTCGGAGCAGCCGG - Intronic
920604884 1:207371679-207371701 GGCCCCACACTCAGAGCAGCCGG - Intergenic
920878478 1:209858932-209858954 GGCCCCGCACTTGCAGCGGCCGG - Intergenic
920882050 1:209889221-209889243 GGCCCCGCACTCGGAACGGCCGG - Intergenic
921094445 1:211874574-211874596 GGCCCCACACTCGGAACAGCAGG - Intergenic
921096273 1:211889627-211889649 GGCCCCGCACTGGGAGCGGCAGG + Intergenic
921396405 1:214673428-214673450 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
921457935 1:215394695-215394717 GGCCCCGCACTTGGAGCGGCCGG - Intergenic
921897078 1:220412510-220412532 GGCCCCACCCTCGGAGCGGCCGG + Intergenic
921903859 1:220475951-220475973 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
921903866 1:220475976-220475998 GGCCCTGCACTCGGAGCAGCCGG - Intergenic
921931113 1:220755052-220755074 GGCTCCAGACATGGACCAGCTGG + Exonic
921983695 1:221285940-221285962 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
922180497 1:223229163-223229185 GGCCTCACCCTTGGAGGAGATGG - Intronic
922417059 1:225431444-225431466 GGCCCCGCACTCGGAGCGGCTGG + Intergenic
922423191 1:225472785-225472807 AGCCCCGCACTCGGAGCAGCCGG + Intergenic
922485409 1:225969848-225969870 GGCCCTGCACTGGGAGCAGCCGG + Intergenic
922546837 1:226464276-226464298 GGCCCTGCACTCTGAGCAGCCGG + Intergenic
922985858 1:229865535-229865557 GGCCCCGCACTCGGAGCGGCCGG + Intergenic
923157250 1:231289757-231289779 GGCTCCACACTCGGAGCAGCCGG - Intergenic
923172612 1:231431055-231431077 GGCCCCGCATTTGGAGTGGCTGG - Intergenic
923573792 1:235140363-235140385 GGCCCCGCACTCGGAGCAGCCGG + Intronic
923623242 1:235594664-235594686 GGCCCCGCACTGGGAGCGGCCGG - Intronic
923930095 1:238684912-238684934 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
924117501 1:240762568-240762590 GGCCCCGCACTCAGAGCAGCTGG + Intergenic
924219256 1:241855860-241855882 GGCCCCGCACTCAGAGCAGCCGG - Intronic
1063148974 10:3320110-3320132 GGGCCCACACTCTGAGCGGCTGG - Intergenic
1063288092 10:4712234-4712256 GTCCCCACACTTAGGGCATCAGG + Intergenic
1063300408 10:4845197-4845219 GGCCCGGCACTCGGAGCGGCTGG - Intronic
1063318750 10:5032800-5032822 GGGCCCGCACTCTGAGCAGCCGG - Intronic
1063322191 10:5060923-5060945 GGCCCTGCACTTGGAGCAGCTGG - Intronic
1064449228 10:15426357-15426379 GGCCCCGCACTTGGAGCGGCCGG - Intergenic
1064475983 10:15689853-15689875 GGGCCCACACTCTGAGTAGCTGG - Intronic
1065441317 10:25756077-25756099 GTCCGCGCACTCGGAGCAGCCGG + Intergenic
1065554885 10:26905624-26905646 GGCCCCACACTCGGATTGGCTGG + Intergenic
1065743299 10:28815955-28815977 GGCCCCGCACTCCGAGCAGCCGG - Intergenic
1065895878 10:30162933-30162955 GACCCCACACTCGGAGCTGCTGG + Intergenic
1065965860 10:30769701-30769723 GGCCCTGCACTCGGAGCGGCTGG - Intergenic
1065981584 10:30903080-30903102 GGCCCCGCACTGGGAGCGGCTGG - Intronic
1065995483 10:31055901-31055923 AGCCCCTCACTCGGAGCCGCTGG + Intergenic
1066234026 10:33468112-33468134 GGCCCCACACTCGGAGCAGCCGG + Intergenic
1066235483 10:33480746-33480768 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1066300420 10:34091103-34091125 GGTCCCAGGCTTGGAGCAGGAGG + Intergenic
1066544261 10:36482280-36482302 CGGCCCACACTCGGAGCAGCCGG - Intergenic
1067535227 10:47104554-47104576 GTCCCCACACTGGGAGCAGAGGG + Intergenic
1068374003 10:56155201-56155223 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
1068554975 10:58448538-58448560 GGCCCCGCACTCAGAGCAGCAGG - Intergenic
1068863151 10:61867723-61867745 GGCCCCAAACTCGGAGCAGCCGG + Intergenic
1068902096 10:62280456-62280478 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
1069186543 10:65429699-65429721 GGCCCCACACTCGGAGCAGCTGG - Intergenic
1069215366 10:65812335-65812357 GGCCCCCGACTCGGAGCAGCCGG - Intergenic
1069280858 10:66651745-66651767 GGCCCCGCACTCGGAGCCGCAGG - Intronic
1069602402 10:69716515-69716537 GGGGCCACACTTGGAGCACAAGG + Intergenic
1069766122 10:70861722-70861744 GGCCCCGCACTCGGAGCAGCCGG + Intronic
1070597208 10:77840898-77840920 TGCCTCACACTTGGTACAGCAGG + Intronic
1070937876 10:80315509-80315531 AGCCCCGCACTCGGAGCGGCAGG + Intergenic
1070942575 10:80359771-80359793 GGCCCCGCACTCGGATCAGCCGG - Intronic
1070968298 10:80543326-80543348 GACCCCGCACTCGGAGCGGCCGG + Intronic
1071387985 10:85141478-85141500 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
1071963797 10:90832458-90832480 GGGCCCGCACTCGGAGCAGCCGG - Intronic
1072278481 10:93845270-93845292 GGCTCCACACTCGGAGCGGCCGG + Intergenic
1072341869 10:94459779-94459801 AGCCCCACACTTGGAGCTGCTGG - Intronic
1073262509 10:102201150-102201172 GGCCCCGCACTCCGAGCGGCCGG - Intergenic
1073532500 10:104245252-104245274 GGCCCTGCACTCGGAGCGGCCGG + Intronic
1073589926 10:104747243-104747265 GGACAAACACTTTGAGCAGCTGG - Intronic
1074316992 10:112369866-112369888 GGCCCCGCACTCAGACCAGCAGG + Intergenic
1074525857 10:114262647-114262669 GGCCCCACAATGGGCACAGCAGG + Intronic
1074617913 10:115088868-115088890 GGCTCCAGACTTGGAACACCAGG - Intergenic
1075255601 10:120923903-120923925 GGCCCCGCACTTGGAGCAGCCGG + Intergenic
1075269397 10:121035621-121035643 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1075305704 10:121365655-121365677 GACCCCACGCTCGGAGCGGCCGG + Intergenic
1075505023 10:123013785-123013807 GGCCCTGCACTCGGAGCGGCCGG - Intronic
1076167382 10:128293407-128293429 AGCCATACACTTGGAACAGCTGG + Intergenic
1076261677 10:129071634-129071656 GGCCCCACACTCGGAGCAGCCGG - Intergenic
1076773595 10:132680740-132680762 GGCCCCGCACTCCGAGCAGCCGG + Intronic
1076796552 10:132801218-132801240 GGCCCCGCACTCCGAGCAGCCGG - Intergenic
1077167838 11:1151851-1151873 GGCCCCACAGCGGGAGCTGCTGG + Intergenic
1077486995 11:2843542-2843564 ACCCCCACCCTGGGAGCAGCGGG + Intronic
1077542172 11:3151879-3151901 GGCCCCTCTCCAGGAGCAGCCGG - Intronic
1077603228 11:3588805-3588827 GGCCCCGCACTAGGAGCTGCCGG + Intergenic
1077764573 11:5144493-5144515 GACCCCGCACTCGGAGCAGCCGG + Intergenic
1077805746 11:5589958-5589980 GGCCCCGCACTGGGAGCAGGCGG + Intronic
1077815600 11:5683026-5683048 GGCCCCGCACTCGGAGTGGCCGG + Intronic
1078042865 11:7884416-7884438 GGCCTCCCACTTCGTGCAGCAGG - Intergenic
1078405626 11:11067836-11067858 CACCCCTCACTTGGAGGAGCAGG - Intergenic
1078619946 11:12898164-12898186 AGGCCCACACTCTGAGCAGCTGG + Intronic
1078743710 11:14091609-14091631 GGCTCCGCACTCGGAGCAGGCGG - Intronic
1078795804 11:14591140-14591162 GGGCCTGCACTCGGAGCAGCCGG + Intronic
1078898479 11:15619486-15619508 GGCCCAGCACTTGGAGAAGCTGG - Intergenic
1079555432 11:21753380-21753402 GGCCCCGCACTCAGAGCGGCAGG - Intergenic
1079708689 11:23653431-23653453 GGCCCCACACTGGGAGCAGCCGG - Intergenic
1079726236 11:23883713-23883735 GGCTCCGCACTGGGAGCAGCCGG - Intergenic
1079731773 11:23942560-23942582 GGGCCCGCACTAGGAGCAGCCGG - Intergenic
1080195215 11:29600428-29600450 GGCCCCGCACTTGGAGCAGCCGG - Intergenic
1080557711 11:33432025-33432047 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1081046427 11:38278881-38278903 GGCCCCGCACTTCTAGCAGCCGG - Intergenic
1081106650 11:39078692-39078714 GGCCCCGCACTTGGTGCAGCTGG + Intergenic
1081115346 11:39192833-39192855 GACCCCGCACTCGGAGCTGCTGG - Intergenic
1081136166 11:39442344-39442366 GGCCCTGCACTTGGAGCGGCTGG - Intergenic
1081329729 11:41788508-41788530 GGCCCCACACTCGGAGCAGCTGG - Intergenic
1081420878 11:42873997-42874019 GGCCCTGCACTCGGAGCACCCGG + Intergenic
1082698779 11:56402201-56402223 GGCCCCCCACTCGGAGCAGCTGG - Intergenic
1083074313 11:60020499-60020521 TGCCCCACACTCGGAGCCGCCGG - Intergenic
1083625536 11:64070213-64070235 GACACCCCACTTGGTGCAGCAGG - Intronic
1083714506 11:64567864-64567886 GGCCCCACGCTCAGAGCAGTGGG - Intronic
1084024762 11:66441015-66441037 GACCCCGCACTCGGAGCGGCCGG - Intronic
1084107391 11:66988873-66988895 GGCCCCCCACTCGGAGCAGCCGG + Intergenic
1084179160 11:67438018-67438040 AGCCCCACCCTTGCAGCAGCAGG + Exonic
1084186634 11:67476171-67476193 GGCCCCGCACTCCGAGCGGCCGG + Intergenic
1084259124 11:67963347-67963369 GGCCCCGCACTAGGAGCTGCCGG + Intergenic
1084406095 11:68974522-68974544 GGCCCCGCACTCGGAGCAGCTGG - Intergenic
1084478686 11:69403965-69403987 GGCCCCACAGTTGGAGCTGGTGG + Intergenic
1084564373 11:69920900-69920922 GGCCCCGCTCCTGGGGCAGCAGG - Intergenic
1084569104 11:69949002-69949024 GCCCCCCCACTGGCAGCAGCAGG + Intergenic
1084840681 11:71843897-71843919 GGCCCCACACTTGGGGCGGCTGG - Intergenic
1085245581 11:75098285-75098307 GACCCCACACTCAGAGCAGCCGG + Intergenic
1085375866 11:76060643-76060665 GGCCCCGCACTCGGAGTGGCCGG + Intronic
1085447263 11:76609311-76609333 GGCCCGGCACTCGGAGTAGCCGG - Intergenic
1085464879 11:76716608-76716630 GGCCCCACACCAGCTGCAGCTGG + Intergenic
1085886977 11:80533025-80533047 GGCCCCACACTCGGAGTGGCCGG - Intergenic
1085982822 11:81744808-81744830 GGCCCCCCACTCAGAGCACCCGG - Intergenic
1086001105 11:81986957-81986979 GGCCCTGCACTTGGAGCAGCTGG - Intergenic
1086001626 11:81991160-81991182 GGGCCCGCACTTGGAGCAGCCGG - Intergenic
1086034888 11:82403978-82404000 GGCCCAGCACTCAGAGCAGCCGG + Intergenic
1086043015 11:82501237-82501259 GGGCCCGCACTCGGAGCGGCCGG + Intergenic
1086200387 11:84194877-84194899 GGCCCCGCGCTTGGAGCAGCTGG - Intronic
1086397766 11:86433803-86433825 GGCCACGCACTCAGAGCAGCCGG - Intergenic
1086807996 11:91268835-91268857 GGCCCCGCACTCGGAACAGCCGG + Intergenic
1087486409 11:98763692-98763714 GGGCCCGCACTCAGAGCAGCCGG - Intergenic
1087500273 11:98943371-98943393 GGCCACAAACTTGGAGCAAGAGG - Intergenic
1087966578 11:104422711-104422733 GGCCCCGCACTCAGAGCGGCCGG - Intergenic
1088481721 11:110301181-110301203 GGCCCCGCACTTGGAGCCGCAGG - Intergenic
1088570858 11:111222057-111222079 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
1088843985 11:113649616-113649638 GGGCCCCCACTCGGAGCAGCCGG - Intergenic
1089062139 11:115634175-115634197 GGCCCTGCACTCGGAGCAGCCGG - Intergenic
1089159866 11:116429060-116429082 GGTCCCACACTTGGGACAGCAGG - Intergenic
1089244755 11:117110734-117110756 GGGCCCGCACTCAGAGCAGCCGG - Intergenic
1089666843 11:120025977-120025999 GGCCCCACACTCGGAGCAGCCGG + Intergenic
1089800221 11:121021738-121021760 GGCCGCGCACTCGGAGCAGCCGG + Intergenic
1090229204 11:125089575-125089597 GGGCCTGCACTCGGAGCAGCCGG + Intronic
1090588244 11:128237169-128237191 GACCCCGCGCTCGGAGCAGCCGG + Intergenic
1090782709 11:130021751-130021773 GACCCCGCGCTCGGAGCAGCCGG + Intergenic
1090805291 11:130198607-130198629 GGCCTCACCCTTGGGGCAGGAGG - Exonic
1091233470 11:134003144-134003166 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1092133946 12:6132697-6132719 GGCCCCCCACTCGGAGCGGCCGG + Intergenic
1092135183 12:6142275-6142297 GGCCCCACACTCAGAGCAGCCGG + Intergenic
1092137411 12:6159555-6159577 GGCCCTGCACTCGGAGCAGCCGG + Intergenic
1092142125 12:6191152-6191174 GGCCCCGCACTCAGAGCAGCCGG - Intergenic
1092272910 12:7037503-7037525 GGGCCGGCACTTGGAGCAGCCGG + Intronic
1092336657 12:7639918-7639940 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
1092350540 12:7752355-7752377 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1092366532 12:7881357-7881379 GGCCCCGCACTCGGAGCGGCCGG + Intronic
1092430435 12:8404353-8404375 AGCCCCGCACTAGGAGCTGCCGG + Intergenic
1092471752 12:8787345-8787367 GGCCCTGCACTCGGAGCAGCCGG + Intergenic
1092545871 12:9450666-9450688 GGCCCCGCACTCGGAGCGGCCGG - Intergenic
1092572440 12:9739858-9739880 GGCTCCGCACTCGGAGCAGCCGG - Intergenic
1092583826 12:9876322-9876344 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1093034474 12:14320173-14320195 GGGCCCCCACTCGGAGCAGCCGG + Intergenic
1093172342 12:15874707-15874729 TGGCCCACACTTGGAGTGGCTGG + Intronic
1093189382 12:16057461-16057483 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
1093381549 12:18500225-18500247 GGCCCCGCACTCGGAGCGGCCGG + Intronic
1093527108 12:20115511-20115533 GGCCCCGCACTCGGAGCGGCCGG - Intergenic
1093580177 12:20777693-20777715 GGCCCTGCACTCAGAGCAGCAGG - Intergenic
1093652531 12:21661608-21661630 GGCCCCGCACTCGGAGCAGCCGG + Intronic
1093741394 12:22693326-22693348 GGCCCCGCACTCCGAGCCGCCGG - Intergenic
1093921647 12:24866155-24866177 GGCCCCACATTCGGAGCGACCGG + Intronic
1093970194 12:25369445-25369467 GGCCCCGCACTCGGAGCAGGCGG + Intergenic
1093972942 12:25391507-25391529 GGCCCCGCACTCCGAGTAGCTGG + Intergenic
1094108767 12:26839254-26839276 GGACCCGCACCCGGAGCAGCCGG + Intergenic
1094338630 12:29386522-29386544 GGCCCCACACTTGGAGCAGCCGG - Intergenic
1094405369 12:30110730-30110752 GGCCCCACACTTGGAGCGGCCGG - Intergenic
1094409818 12:30156949-30156971 GGGCCCGCACTGGGAGCAGCCGG + Intergenic
1094507084 12:31071407-31071429 GGCCCCGCAATCGGAGCAGCCGG + Intergenic
1094718214 12:33034213-33034235 GGCCCCACACTCGGAGCAGCCGG - Intergenic
1094722044 12:33075424-33075446 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
1095304137 12:40620735-40620757 GACCCCGCACTCGGAGCGGCAGG + Intergenic
1095444973 12:42273984-42274006 GGCCCCACACTCGGAGGGGCCGG - Intronic
1095587394 12:43863977-43863999 GGCCCCACACTCGGAGCTGCCGG + Intronic
1095642365 12:44500476-44500498 GGCCCTGCACTCGGAGCAGCCGG + Intergenic
1095898788 12:47306401-47306423 GGCCCCGCACTCCGGGCAGCAGG + Intergenic
1095901524 12:47333463-47333485 GGCCCTGCACTCTGAGCAGCTGG + Intergenic
1097017945 12:56000425-56000447 GGCCCCGCACACGGAGCAGCCGG - Intronic
1097490924 12:60269820-60269842 TGCCCCGCACTCGGAGCGGCCGG + Intergenic
1097863755 12:64543002-64543024 GGCCCCGCACTTGGAGTGGCGGG + Intergenic
1097863762 12:64543023-64543045 GGCCCCGCACTTGGAGTGGCGGG + Intergenic
1097863769 12:64543044-64543066 GGCCCCGCACTTGGAGTGGCGGG + Intergenic
1097863776 12:64543065-64543087 GGCCCCGCACTTGGAGTGGCGGG + Intergenic
1097863783 12:64543086-64543108 GGCCCCGCACTTGGAGTGGCGGG + Intergenic
1097863790 12:64543107-64543129 GGCCCCGCACTTGGAGTGGCGGG + Intergenic
1097863797 12:64543128-64543150 GGCCCCGCACTTGGAGTGGCGGG + Intergenic
1097863804 12:64543149-64543171 GGCCCCGCACTTGGAGTGGCGGG + Intergenic
1097863811 12:64543170-64543192 GGCCCCGCACTTGGAGTGGCGGG + Intergenic
1097863818 12:64543191-64543213 GGCCCCGCACTTGGAGTGGCGGG + Intergenic
1097863824 12:64543212-64543234 GGCCCCGCACTTGGAGTGGCCGG + Intergenic
1097981998 12:65744437-65744459 GGCCCCGCACTAGGAGCAGCTGG + Intergenic
1098168240 12:67719514-67719536 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1098498782 12:71166491-71166513 GGCCCCACACTCGGAGTGGCCGG - Intronic
1098759223 12:74403025-74403047 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
1099190218 12:79554286-79554308 GGCCCCGCACTGGGAGCGGCGGG - Intergenic
1099190940 12:79561618-79561640 AGCCCCGCACCTGGAGCAGCCGG + Intergenic
1099228180 12:79993506-79993528 GGCCCAGCACTCGGAGCGGCCGG - Intergenic
1099413725 12:82361699-82361721 GGCCCAGCACTCAGAGCAGCCGG - Intronic
1099478654 12:83140198-83140220 GGCCCTGCACTAGGAGCAGCCGG + Intergenic
1099559637 12:84155403-84155425 AGCCCTGCACTCGGAGCAGCCGG - Intergenic
1099716251 12:86296684-86296706 GGCCCCGCACTCGGAGCCGCTGG - Intronic
1099790694 12:87330294-87330316 GGCCCAGCACTCGCAGCAGCCGG + Intergenic
1100166631 12:91924171-91924193 GGTCCCGCACTCGGAGCGGCCGG - Intergenic
1100211904 12:92406800-92406822 GGCTCCGCACTCGGAGCAGCCGG - Intergenic
1100521443 12:95379686-95379708 GGGCCCGCACTTCGAGCAGCCGG + Intronic
1100584679 12:95969213-95969235 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
1100600627 12:96108983-96109005 GACCCCGCACTCGGAGCGGCCGG + Intergenic
1100734636 12:97513019-97513041 GACCCCGCAGTTGGAGCGGCCGG - Intergenic
1100771331 12:97925784-97925806 GGAACCACACTTGGAGAATCAGG + Intergenic
1101008971 12:100430380-100430402 GGCCCGGCACTCGGAGCAGCCGG + Intergenic
1101021605 12:100559460-100559482 GGCCCCTCACTCGGAGCAGCCGG + Intronic
1101573992 12:105980770-105980792 GGCCCCATCCTTGGAGGAGGAGG - Intergenic
1101603829 12:106233100-106233122 GACCCCGCACTCGGAGCAGCCGG + Intergenic
1102309738 12:111835733-111835755 GTCCCCACACTTGGAGTGGCCGG + Intergenic
1102387254 12:112520171-112520193 GACCCCACACTTGGAGCGGCAGG - Intergenic
1102698442 12:114818002-114818024 GGCCTCTCTCCTGGAGCAGCTGG + Intergenic
1102904005 12:116660804-116660826 GTCCCCGCACTCGGAGCCGCCGG + Intergenic
1103146167 12:118597457-118597479 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1103239118 12:119398319-119398341 GGCCACGCACTAGGAGCGGCTGG - Intronic
1103439252 12:120950622-120950644 GGCCCCACACTCGGAGCAGCCGG - Intergenic
1103459679 12:121093789-121093811 GGCCCTGCACTCGGAGCGGCCGG - Intergenic
1103668525 12:122592103-122592125 GGCCCTGCACTCGGAGCGGCCGG + Intronic
1103678727 12:122676878-122676900 GCCCCCGCACTCGGAGCGGCCGG - Intergenic
1103783414 12:123414395-123414417 GGCCCCGCACTCGGAGCAGCTGG - Exonic
1104198739 12:126567130-126567152 GCTCCTGCACTTGGAGCAGCCGG + Intergenic
1104277025 12:127338607-127338629 GGATCAACACTTGTAGCAGCTGG + Intergenic
1104344474 12:127983460-127983482 GGCCCCACACTCCGAGCGGCCGG + Intergenic
1104614537 12:130256936-130256958 GGCCCCGCACCCGGAGCAGCCGG - Intergenic
1104721765 12:131048418-131048440 CGCCCCACAGCTGTAGCAGCGGG - Intronic
1104749218 12:131227890-131227912 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
1105425624 13:20292495-20292517 GGCCCCGCACTCGGAGCGGCCGG + Intergenic
1105477407 13:20740210-20740232 GGCCCCGCACTCGGAGCAGCCGG - Intronic
1105701560 13:22938919-22938941 GGCCCCACACTCCCAGCAGCCGG - Intergenic
1105876704 13:24560987-24561009 GGCCCCGCACTCAGAGCGGCGGG - Intergenic
1106017278 13:25881746-25881768 GGGACCACACTTTGAGTAGCAGG - Intronic
1106221347 13:27748596-27748618 GGCCCCGCACTCAGAGCAGCCGG - Intergenic
1106340276 13:28820356-28820378 GCCCCCGCACCTGGAGCCGCCGG - Exonic
1106543363 13:30709999-30710021 GAACCCACTCTTGGAGCTGCAGG + Intergenic
1106600564 13:31183290-31183312 GGCCCCGCACTCGGAGCGGCAGG - Intergenic
1107590484 13:41898861-41898883 GGGCCCACACTCGGAGCAGCCGG - Intronic
1107652572 13:42559848-42559870 GGGCCCGCACTCGGAGCGGCCGG + Intergenic
1107836093 13:44413654-44413676 GACCCCGCACTCGGAGCAGCCGG + Intergenic
1108435321 13:50396673-50396695 GGCCCCGCATTCGGAGCAGCCGG + Intronic
1108643995 13:52408358-52408380 GGGCCCGCACTCGGAGCGGCCGG - Intergenic
1108856542 13:54799960-54799982 GACCCCGCACTCGGAGCAGCTGG - Intergenic
1108995996 13:56735687-56735709 GGCCCCGCACTGGGAGCGGCTGG + Intergenic
1109145389 13:58773396-58773418 GACCCCACACTGGGAGCAGCTGG + Intergenic
1109159891 13:58958464-58958486 GGCCCTGCACTGGGAGCAGCCGG - Intergenic
1109201851 13:59439989-59440011 GGTCCCACACTTGGAGTAGCCGG + Intergenic
1109446632 13:62448180-62448202 GGCCCCGCACTGCGAGTAGCCGG - Intergenic
1109506137 13:63305825-63305847 GGCCCGGCACTCGGAGCGGCGGG + Intergenic
1109563177 13:64077776-64077798 GACCCCGCACTTGGAGCGGCCGG - Intergenic
1109741514 13:66561144-66561166 GGCCCCGCACTCGGAGCGGCCGG + Intronic
1109745799 13:66622027-66622049 GGCCCCGCACTCGGAGCAGCCGG + Intronic
1109854318 13:68107998-68108020 GGCCCCGCACTCGGAGAGGCCGG - Intergenic
1110368846 13:74718470-74718492 GGCCCTGCACTCGGAGCAGCCGG + Intergenic
1110440176 13:75518631-75518653 GGACCCACACTCGGAGCGGCTGG + Intergenic
1110792415 13:79600440-79600462 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1110862114 13:80355625-80355647 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
1110874387 13:80490844-80490866 GGCCCTGCACTGGGAGCAGCCGG - Intergenic
1110940317 13:81341052-81341074 GGCCCCGCACCCGGAGCAGCCGG - Intergenic
1110999861 13:82165232-82165254 GGCTCCACACTCGGAGCAGCTGG - Intergenic
1111138800 13:84086658-84086680 GGCCCCGCACTCGGAGCGGCCGG - Intergenic
1111220888 13:85204991-85205013 GGGCCCGCACTTGGAGTGGCCGG + Intergenic
1111333551 13:86792343-86792365 GGCCCCACACTCCGAGCGGCCGG + Intergenic
1111441887 13:88291898-88291920 GGACCCGCACTCGGAGCAGCTGG + Intergenic
1111591004 13:90348677-90348699 CGGCCCGCACTCGGAGCAGCCGG + Intergenic
1111841433 13:93455067-93455089 GGCCCTGCACTCGGAGCAGCCGG - Intronic
1112075046 13:95904050-95904072 GGCCCCTGACTTGGAGGAGTTGG + Intronic
1112533189 13:100224331-100224353 GGCCCCGCACTCGGAGCAGCCGG - Intronic
1112538255 13:100282525-100282547 GGCCCCACACTCAGAGCAGCCGG + Intronic
1112613077 13:100975775-100975797 GGCCCCGCACTCGGAGCAGCGGG + Intergenic
1112842683 13:103600060-103600082 GGCCCAGCACTCGGAGCGGCCGG + Intergenic
1113371971 13:109732936-109732958 GGCCCCGCACTCGGAGCGGCCGG - Intergenic
1113482704 13:110633311-110633333 GGCCCCGCACTCGGAGCAGCCGG - Intronic
1113487323 13:110663730-110663752 AGCCCCACACTGAGAGCAGATGG + Intronic
1113609485 13:111633126-111633148 GGAGCCACTCTGGGAGCAGCCGG - Intronic
1114401739 14:22416418-22416440 GGCCCCACACTGGGACCACCGGG - Intergenic
1114593516 14:23891835-23891857 GGCCCCGCACTTGGAGCAGCGGG + Intergenic
1115118264 14:29909075-29909097 GGCCCCACACTCAGAGTGGCTGG + Intronic
1115174615 14:30547799-30547821 GGCCCCACACTCAGAGCCTCCGG - Intergenic
1115256295 14:31406348-31406370 GGCATTACATTTGGAGCAGCAGG - Intronic
1115268651 14:31527368-31527390 GGCCCCGCACTCGGAGCAGCCGG - Intronic
1115284234 14:31700624-31700646 GGCCCTGCACTTCGAGCGGCCGG + Intronic
1116152145 14:41154521-41154543 GGCCCCACACTCAGAGCGGCCGG - Intergenic
1116223208 14:42113748-42113770 GGCCCCGCACTCAGAGCGGCCGG - Intergenic
1116251051 14:42482671-42482693 GGTCCCGCACTCAGAGCAGCCGG - Intergenic
1116310992 14:43326683-43326705 GGCCCCACACTTGGAGTGGCCGG + Intergenic
1116390509 14:44384821-44384843 GGCCCTGCACTCGGAGCAGCTGG + Intergenic
1116437583 14:44912248-44912270 GGGCCCGCACTCGGAGCGGCCGG + Intergenic
1116594365 14:46820513-46820535 GGCTCCGCACTCGGAGCGGCCGG + Intergenic
1116653760 14:47626636-47626658 GGCCCCGCACTGGGAGCGGCCGG + Intronic
1117077848 14:52122322-52122344 GGCCCCGCACTCCGAGCAGCTGG + Intergenic
1117302490 14:54443130-54443152 GGACCCTCACTCGGAGCAGCCGG + Intergenic
1117727354 14:58687535-58687557 GGCCCCACACTTGGAGCGGCCGG - Intergenic
1117742608 14:58833997-58834019 GGCCACTCACTTGGAGTGGCTGG + Intergenic
1117837268 14:59819850-59819872 GGCCCCGCACTCGGAGCGGCTGG - Intronic
1118215387 14:63803545-63803567 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1118306316 14:64658258-64658280 GGCCCCGCACTTGGAGCCGCCGG + Intergenic
1119027766 14:71167618-71167640 GGCCCCGCACTCGGAGCGGCCGG + Intergenic
1119303690 14:73590716-73590738 GGCCCCGCACTTGGAGCGGCCGG - Intergenic
1119436482 14:74600822-74600844 GGGACCACACTTTGAGTAGCAGG - Intronic
1119673469 14:76537032-76537054 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1119695063 14:76706946-76706968 GGCCCTGCACTGGGAGCGGCCGG - Intergenic
1119870721 14:78014263-78014285 GGCCCCACACTCAGAGCAGCCGG - Intergenic
1120030112 14:79631520-79631542 GGCCCCGCACTGGGCGCAGCCGG + Intronic
1120169665 14:81236177-81236199 GGCCCCACACTCAGAGCAGCCGG + Intergenic
1120209888 14:81624048-81624070 GGCCCCGCACTCGGAGCGGCCGG - Intergenic
1120215753 14:81679448-81679470 GGCCCCACACTCCGAGCGGCCGG - Intergenic
1120229786 14:81829737-81829759 GGCCCCACACTCCGAGCAGCTGG - Intergenic
1120330961 14:83092463-83092485 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
1120429771 14:84399646-84399668 GGCCCCGCACTCAGAGCGGCCGG - Intergenic
1120704792 14:87735042-87735064 GGCCCCGCACTCGGGGCGGCGGG - Intergenic
1120844143 14:89111726-89111748 GGCCCCGCACTCGGAACAGCCGG + Intergenic
1121145363 14:91578048-91578070 GGTCCCGCACTCGGAGCGGCTGG + Intergenic
1121970812 14:98354425-98354447 GTCCCCCGACTTGTAGCAGCAGG - Intergenic
1123051864 14:105547909-105547931 GGCCCCGCACTCGGAGTGGCAGG + Intergenic
1123799121 15:23802992-23803014 GGCCCCGCACTTGGAGCAGCCGG + Intergenic
1123949150 15:25253475-25253497 GGCCCCACACTCGGAGCAGCGGG - Intergenic
1124387864 15:29225029-29225051 GGCCCCGCACTCAGAGCGGCCGG - Intronic
1125112196 15:36047033-36047055 GGCCCCGCACTCGGAGCGGCCGG + Intergenic
1125609682 15:40961696-40961718 GGCCCCGCACTCGGAGCAGTCGG + Intergenic
1125717094 15:41825570-41825592 GGCCCCCCACGAGGAGCGGCTGG - Exonic
1125869505 15:43086135-43086157 GGACCCAGACTTGGAAAAGCAGG - Exonic
1125914572 15:43474160-43474182 GGTCCTGCACTCGGAGCAGCCGG - Intronic
1125921309 15:43527432-43527454 GAGCCTCCACTTGGAGCAGCTGG + Exonic
1126088971 15:45034913-45034935 GGCCCCGCACTCAGAGCAGCCGG + Intronic
1126128055 15:45314171-45314193 GGCCCTGCACTCGGAGCCGCCGG + Intergenic
1126165548 15:45651286-45651308 GGCCCCGCACTTGGAGTGGCAGG - Intronic
1126997564 15:54462533-54462555 GGGCCCACACTTTGAGCAACTGG + Intronic
1127479673 15:59367178-59367200 GGCCCCACACTTGGCTCATGAGG + Intronic
1127984757 15:64060962-64060984 GGCCCCGCACTCAGAGCCGCTGG + Intronic
1128813329 15:70587456-70587478 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1129196919 15:73973827-73973849 GGCCCCGCACTCGGTGCGGCCGG + Intergenic
1129280414 15:74480627-74480649 GGCCCCGCACTCGGAGCAGTCGG - Intergenic
1129724408 15:77894255-77894277 GGCCCCGCACTCGGAGCAGCTGG - Intergenic
1129777519 15:78246419-78246441 GGCCCTGCACTCAGAGCAGCCGG - Intergenic
1130132842 15:81158701-81158723 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
1131012721 15:89031935-89031957 GGCCCCACACTCGTAGCGGCCGG - Intergenic
1131335185 15:91542250-91542272 GGACCCACAGAAGGAGCAGCCGG - Intergenic
1131472841 15:92711299-92711321 GGCTCCGCACTTGGAGCGGCCGG - Intronic
1131846140 15:96492119-96492141 GGCTCCGCACTCGGAGCAGCTGG - Intergenic
1131912574 15:97224326-97224348 GGCCCCGCACTTGGAGCCGCTGG + Intergenic
1132097693 15:99000128-99000150 GGCCCCGCACTGGGAGTGGCCGG + Intronic
1132510999 16:341342-341364 GGCCCGGCACTCAGAGCAGCCGG + Intronic
1132549353 16:547974-547996 GGCCCCACAGTCGGGGCAGTGGG - Exonic
1133014761 16:2934204-2934226 TGCCCCACAGTAGCAGCAGCAGG + Intronic
1133362662 16:5186604-5186626 GACCCCGCACTCGGAGCGGCCGG - Intergenic
1133363345 16:5191478-5191500 GGCCTCACAATTGCAGCAGAAGG - Intergenic
1134023082 16:10934789-10934811 GGCCCCAAGCTTGGAGTGGCGGG - Intronic
1134196927 16:12166458-12166480 GGCTCTCCACTTGGAGGAGCTGG + Intronic
1134633727 16:15776721-15776743 GACCCCACTCTTGGAACAGAGGG - Intronic
1135024617 16:18989550-18989572 GTCCCCACCCTTGGAGGAGGAGG + Intronic
1135089501 16:19501875-19501897 GGCCTCACACTTGCAGCAGCTGG - Exonic
1135262143 16:20989922-20989944 GGCCCCGCACTCGGAGCAGCCGG - Intronic
1135751088 16:25059192-25059214 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1135797757 16:25461754-25461776 GGCTCCATGCTTTGAGCAGCAGG + Intergenic
1135942706 16:26836337-26836359 GGCCCCGCACTCGGAGTGGCCGG - Intergenic
1136398825 16:30006936-30006958 TGCCCCGCAGTTGGAGCAGGCGG - Exonic
1137624927 16:49901539-49901561 GGGCACACACTAGGAGCAGCAGG - Intergenic
1138693622 16:58791067-58791089 GGCTCCACACTCGGAACAGCCGG - Intergenic
1139125557 16:64072610-64072632 GGCCCGGCACTCGGAGCAGCCGG - Intergenic
1139596430 16:67960956-67960978 GGGCCAACACTGCGAGCAGCAGG + Intronic
1140224030 16:73064647-73064669 AGCCCCAAACTTGGAGCGCCCGG + Intergenic
1140599430 16:76457610-76457632 GGACCCATACTTTGAGTAGCAGG - Intronic
1140722541 16:77784660-77784682 GGGCCCTCACTCGGAGCGGCCGG - Intergenic
1140917997 16:79510786-79510808 GGCCCCACACATTGGGTAGCTGG + Intergenic
1141680733 16:85542200-85542222 GAACCCACATTTGGATCAGCAGG + Intergenic
1141702381 16:85648445-85648467 GGGGCCTCACTTGGAGCAGGGGG + Intronic
1142049094 16:87946388-87946410 GGCCCCACTCCTGGAGGTGCAGG + Intergenic
1142828825 17:2532378-2532400 GGCCCGGCACTCTGAGCAGCCGG - Intergenic
1143128001 17:4656790-4656812 GACCCCGCACTCGGAGCGGCTGG - Intergenic
1143532204 17:7512067-7512089 GGGCACACACTTTGGGCAGCTGG + Intronic
1143664295 17:8347401-8347423 GGCCCTGCACTCGGAGCAGCCGG - Intergenic
1144128068 17:12220984-12221006 GGCCCCGCCCTCGGAGCGGCCGG + Intergenic
1144425207 17:15134915-15134937 GGCCCCACCCTTGTACCATCAGG + Intergenic
1144467137 17:15505776-15505798 GGCCCCGCACTCGGAGCAGCCGG + Intronic
1144723193 17:17486432-17486454 AGCCCCGCACTCGGAGCAGCCGG + Intronic
1145050329 17:19654597-19654619 GGCCCCACACTCGGAGCAGCTGG - Intronic
1145094827 17:20016545-20016567 GGCCCCGCACTGGGAGCGGCCGG + Intronic
1146166186 17:30591051-30591073 TGCACCACACTTGGAAGAGCAGG + Intergenic
1146740488 17:35279195-35279217 GGCCCCAAACTCAGAGCAGCCGG - Intergenic
1146797820 17:35795323-35795345 GGCCCCACAGTAGCAGCTGCAGG + Exonic
1147256637 17:39185707-39185729 GCCCCCACACCTGGGGCAGCAGG - Intronic
1147373605 17:40011012-40011034 GGCCCCGCACTCGGAGCAGCGGG + Intergenic
1147508215 17:41041341-41041363 GGTCCCACTGGTGGAGCAGCTGG + Exonic
1148016849 17:44528044-44528066 GGCCCTGCACTCGGAGCAGCCGG + Intergenic
1148366198 17:47057564-47057586 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1148755320 17:49970012-49970034 AACCCCCCACCTGGAGCAGCGGG + Intronic
1148991232 17:51668850-51668872 GCGCCCACACTTGGAGCGGCCGG + Intronic
1150377647 17:64695147-64695169 TGCACCACACTTTGAGGAGCAGG - Intergenic
1150772263 17:68051951-68051973 GGGCCCGCACTCGGAGCGGCCGG + Intergenic
1150777021 17:68089348-68089370 TGCACCACACTTTGAGGAGCAGG + Intergenic
1150778259 17:68099361-68099383 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
1150786769 17:68169639-68169661 AGCCCCGCACTCAGAGCAGCCGG - Intergenic
1150788247 17:68179927-68179949 GGCCCCGCACTCAGAGCGGCTGG + Intergenic
1150792229 17:68207936-68207958 GGGCACGCACTTGGAGCAGCCGG + Intergenic
1151438523 17:74113597-74113619 GGTCCCGCACTCGGAGCGGCCGG - Intergenic
1151840665 17:76615191-76615213 GGCCCCACACTCAGAGCGGCTGG - Intergenic
1151983188 17:77526333-77526355 GGCCCCACACTCTGATCCGCTGG - Intergenic
1152549181 17:81020889-81020911 GGCCTCACGTTGGGAGCAGCCGG + Intergenic
1152619072 17:81352329-81352351 GGCTCCGCACTCGGAGCAGCCGG - Intergenic
1153667958 18:7383218-7383240 GGCCTCTCACTTCCAGCAGCTGG - Intergenic
1153832483 18:8935704-8935726 GGCCCCACACTCGGAGCAGCCGG - Intergenic
1153868689 18:9297015-9297037 GGCCCCACACTCAGAGCGGCCGG + Intergenic
1154128769 18:11717193-11717215 GACCCCGCACTGGGAGCGGCCGG - Intronic
1154231169 18:12557425-12557447 GGCCCCACATTTGGAGTGGCTGG - Intronic
1154255335 18:12777135-12777157 GGCCCCACACTCGGAGCGGCCGG - Intergenic
1154294128 18:13134951-13134973 GGCCCTGCACTCGGAGCGGCCGG - Intergenic
1155271976 18:24149835-24149857 GGCCCCGCATTCCGAGCAGCGGG - Intronic
1155295052 18:24376861-24376883 GGCCCCGCACTGGGAGCAGCCGG - Intronic
1155852264 18:30788523-30788545 GGCCCCGCACTCGGAGCAGTCGG + Intergenic
1155856397 18:30839440-30839462 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1156038649 18:32794654-32794676 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
1156079492 18:33316305-33316327 GGCCCCACACTCGAAGCGGCCGG + Intronic
1156243062 18:35271928-35271950 GGCCCCGCACTTGGAGCGGCCGG - Intronic
1156575209 18:38306838-38306860 GGCCCTACACTAGAATCAGCTGG + Intergenic
1156629073 18:38944684-38944706 GGCCCCGCACTCGGAGCAGCAGG - Intergenic
1156863638 18:41865836-41865858 GGCCCCACACTCGGAGCAGCCGG + Intergenic
1157085950 18:44580812-44580834 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
1157313267 18:46568239-46568261 AGCCACACCCTGGGAGCAGCAGG + Intronic
1157979820 18:52367185-52367207 GGCCCCGCACTCAGAGCAGTCGG - Intronic
1158351897 18:56572369-56572391 GGCCCCGCACTCCGAGCAGCCGG + Intergenic
1158697281 18:59714374-59714396 GGGCCTGCACTCGGAGCAGCCGG - Intergenic
1158705773 18:59790732-59790754 GGTCCCGCACTCGGAGCAGCCGG - Intergenic
1158866715 18:61644533-61644555 GGCCCCAAACATGCAGCACCTGG + Intergenic
1159167974 18:64725911-64725933 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1159230777 18:65605333-65605355 GGCCCTGCACTCGGAGCAGCCGG + Intergenic
1159472969 18:68880276-68880298 GGCCCCGCACTCGGAGCAGCTGG - Intronic
1159656226 18:71031987-71032009 GGCCCCGCACTGGGAGCGGCCGG - Intergenic
1160176642 18:76600411-76600433 GGCCCCTAACTCGGAGCAGCCGG - Intergenic
1160198534 18:76777324-76777346 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
1160484484 18:79276559-79276581 GGGCACACACATGGAGCAGGCGG - Intronic
1161401814 19:4069178-4069200 TCCCCCACACCAGGAGCAGCAGG + Intergenic
1161518536 19:4710633-4710655 GGTCCCATGCTTTGAGCAGCAGG + Intronic
1162018287 19:7857233-7857255 GGCGCCATGCATGGAGCAGCTGG + Intronic
1162020562 19:7866558-7866580 GGACCCACACTGGGTGCAGAGGG - Intergenic
1162230125 19:9259593-9259615 GGCCCCGCACTCGGAGCAGCAGG + Intergenic
1162233134 19:9283735-9283757 GGCCCCGCACTCCGAGCAGCCGG - Intergenic
1162263032 19:9547886-9547908 GGCCCTGCACTTGGAGCAGTCGG + Intergenic
1162315413 19:9935880-9935902 TGCCCCACACTGGGGGCTGCAGG + Intronic
1162418629 19:10553186-10553208 GGCCCCAGACTGGTTGCAGCTGG - Exonic
1162632722 19:11941577-11941599 GGCCCCGCACTCGGAGCAGCCGG - Intronic
1162814750 19:13186990-13187012 GGCCCTGCACTTGGAGCAGCCGG - Intergenic
1162987085 19:14277704-14277726 GGCCCCGCACTCGGAGCAGCAGG + Intergenic
1163218825 19:15899762-15899784 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
1163701563 19:18789123-18789145 GGCCCCATTTTTGGAGCAGAAGG - Intronic
1164599002 19:29548678-29548700 TGCCCCACCCTGGGAGCATCTGG - Intronic
1164608678 19:29617820-29617842 GGCCCCACTCTTTGAGCAGTGGG - Intergenic
1164975773 19:32571667-32571689 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
1165038844 19:33054605-33054627 GGTTCCCCACTTGGAGCACCAGG - Intronic
1165266917 19:34668273-34668295 GGCCCCGCACTCCGAGCTGCCGG + Intronic
1165898157 19:39155688-39155710 AGCCTCATGCTTGGAGCAGCTGG + Intronic
1166036243 19:40170422-40170444 GGCCCCGCACTTGGAGCAGCCGG - Intergenic
1166045930 19:40231191-40231213 GGTCCCACAGCTGCAGCAGCTGG - Exonic
1166487032 19:43222213-43222235 GGCCTCGCACTCGGAGCAGCCGG - Intronic
1168404390 19:56103205-56103227 GGACCCAGACATGGAGCTGCGGG - Exonic
1168649741 19:58085561-58085583 GGTCCCACATCTGCAGCAGCAGG - Intronic
925044152 2:758536-758558 CGCCCCATCCTTGAAGCAGCTGG + Intergenic
925098992 2:1229876-1229898 GGCTCCGCACTCGGAGCAGCCGG - Intronic
925537827 2:4935595-4935617 GGCTCTGCACTTGGAGCAGCCGG - Intergenic
925561748 2:5203612-5203634 GGCCCCACACTCAAGGCAGCAGG + Intergenic
925814302 2:7732678-7732700 GGTTCCACACATGGAGCCGCTGG + Intergenic
926474788 2:13308573-13308595 GGCCCTGCACTCGGAGCAGCCGG - Intergenic
927148180 2:20180382-20180404 GGCCCCTCCCTGGGAGCATCCGG + Intergenic
927522340 2:23706851-23706873 GGCACCGCGCTTGGAGCCGCAGG + Exonic
927942204 2:27111749-27111771 GGCCCAGCACTCGGAGCTGCCGG - Intronic
928599211 2:32886849-32886871 GGGCCCGCACTTGAAGCAGCCGG - Intergenic
928617962 2:33057709-33057731 GGCCCCGCACTCAGAGCTGCCGG - Intronic
928701557 2:33903793-33903815 GGCCCCACACTCGGAGAGGCCGG - Intergenic
928936874 2:36688340-36688362 GGCCCCGCACTCCGAGCAGCCGG + Intergenic
929138040 2:38643342-38643364 GGCCCCGCACTCCGAGCAGCCGG - Intergenic
929379666 2:41335669-41335691 GGCCCCGCACTCGGAGCAGCAGG + Intergenic
929437864 2:41941921-41941943 TGGACCACACTTGGAGCAGCTGG - Intronic
929890894 2:45917955-45917977 GGCCCCGCACTCGGAGCAGCCGG - Intronic
930037993 2:47099811-47099833 GGCCCCACACTCAGAGCAGCTGG + Intronic
930039191 2:47107359-47107381 GGCCCCGCACTCGGAGCAGCTGG + Intronic
930338779 2:50084489-50084511 GGCCCTGCACTTGCAGCGGCCGG - Intronic
930485485 2:52006878-52006900 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
931106951 2:59067007-59067029 GGCCCCGCCCTCGGAGCGGCTGG + Intergenic
931499890 2:62854820-62854842 GGCCACACACTCCAAGCAGCTGG + Intronic
931708672 2:64969083-64969105 GGCCCTGCACTCGGAGCAGCCGG + Intergenic
932340943 2:70962360-70962382 GCACCCACACTTGGGTCAGCTGG - Intronic
932359539 2:71092768-71092790 GGCCCCACACTCGGAGCAACCGG - Intergenic
932521753 2:72421906-72421928 GGCCCCGCACTCAGAGCAGCCGG + Intronic
932902029 2:75711653-75711675 GGGCCTGCACTCGGAGCAGCCGG + Intergenic
933487279 2:82938726-82938748 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
933700022 2:85248413-85248435 GGGAACACACTTGGAGTAGCAGG + Intronic
934085109 2:88503217-88503239 GGCCCCGCACTCGGAGCGGCCGG + Intergenic
934898472 2:98139082-98139104 GGCCCCGCACTCGGAGCAGCCGG + Intronic
935670916 2:105556607-105556629 GGCCCCACACTAGGAGCCTCTGG + Intergenic
935878380 2:107536371-107536393 GGCCCAGCACTCAGAGCAGCTGG - Intergenic
935890797 2:107675526-107675548 GCCCCCACGATTGGAGCAACAGG - Intergenic
935896876 2:107747620-107747642 GGCCCCGCACTTGGAGCAGCCGG - Intergenic
935922535 2:108031643-108031665 GGCCCCGCACTCGGAGTGGCTGG + Intergenic
936346866 2:111681929-111681951 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
936581545 2:113704686-113704708 GGCCCCGCACTCGGAGCGGCCGG - Intergenic
937181118 2:119997062-119997084 GGCCCCGCACTCGGAGCCGCCGG + Intergenic
937596828 2:123683852-123683874 GACCCTGCACTCGGAGCAGCCGG + Intergenic
938126100 2:128672406-128672428 GGCCCGGCACTCAGAGCAGCCGG - Intergenic
938153152 2:128903800-128903822 GGCCCCACCCTCAGCGCAGCCGG - Intergenic
938237971 2:129722058-129722080 GGCCCCACCCCCGCAGCAGCTGG + Intergenic
938401007 2:130991524-130991546 GGCCCGGCACTCGGAGCAGCCGG + Intronic
938728758 2:134130017-134130039 GGCCCCGCACTCGGAGCGGCCGG + Intronic
939053237 2:137331889-137331911 GGGCCCGCACTTGGAGCAGCCGG - Intronic
939229735 2:139410419-139410441 GGCCCCACACTCGGAGCAGCCGG + Intergenic
939281732 2:140073868-140073890 GGCCCTGCACTCGGAGCAGCCGG + Intergenic
939465109 2:142546140-142546162 GGCCCCGCACTCGGAGCGGGCGG + Intergenic
939777375 2:146403973-146403995 AGCCCTGCACTCGGAGCAGCCGG - Intergenic
939886448 2:147686529-147686551 GGCCCTGCACTGGGAGCGGCCGG - Intergenic
939898893 2:147826939-147826961 GGGCCCGCACTCGGAGCGGCCGG + Intergenic
939972558 2:148678669-148678691 AGCCCTGCACTCGGAGCAGCCGG - Intronic
940112666 2:150171308-150171330 GGCCCCGCACTCTGAGCGGCCGG - Intergenic
940215083 2:151296088-151296110 GGCCCCGCACTGAGAGCGGCGGG + Intergenic
940784621 2:157968152-157968174 GACCCCGCACTCGGAGCCGCCGG - Intronic
941240063 2:163026354-163026376 GGCCCCGCACTCAGAGCAGACGG + Intergenic
941397953 2:164995036-164995058 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
941476607 2:165957349-165957371 CGCCCCGCACTTGGAGCGGCGGG - Intergenic
941712144 2:168725179-168725201 GGCCCTGCACTTGAAGCAGCCGG - Intronic
941916237 2:170815819-170815841 GAGCCCACACCTGGAGCTGCTGG - Intronic
942170276 2:173282869-173282891 GGCCCCGCACTCGGAGCAGTCGG - Intergenic
942867266 2:180691466-180691488 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
943134418 2:183892613-183892635 GGCCCCACACTTGGAGTGGCCGG + Intergenic
943166092 2:184327934-184327956 GGCCCCGCACTCGGAGCTGCCGG - Intergenic
943222819 2:185132678-185132700 GGCCCCGGACTCGGAGCAGCCGG + Intergenic
943494776 2:188606675-188606697 GGCCCCGCACTCAGAGGAGCCGG - Intergenic
943680371 2:190761245-190761267 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
943941458 2:194003019-194003041 GGGCCCACACTCAGAGCAGCTGG - Intergenic
943954895 2:194176392-194176414 GGCCCCACACTTGGAGCCGCCGG + Intergenic
944237124 2:197450789-197450811 GGCCCCGCACTCGGCGCGGCCGG + Intergenic
944252503 2:197591824-197591846 GGGCCCACACTCAGAGCGGCCGG - Intronic
944482787 2:200174862-200174884 GGGCCCGCACTCGGAGCAGCCGG + Intergenic
944728577 2:202496989-202497011 GGCCCCGCACTCGGAGCAGCCGG + Intronic
944843152 2:203643109-203643131 GGCCCCGCACTCGGAGCGGTCGG - Intergenic
944857955 2:203785855-203785877 AGCCCTGCACTCGGAGCAGCCGG - Intergenic
945302581 2:208227965-208227987 GGCCCTACACTTGGAGCAGCCGG - Intergenic
945575499 2:211524658-211524680 GGCCCCGCACTCGGAGCAGCCGG - Intronic
945870197 2:215219137-215219159 GGCCCCACACTCAGAGCAGCAGG + Intergenic
946053979 2:216885327-216885349 GGGCCCGCACTCGGAGCTGCCGG + Intergenic
946376489 2:219312899-219312921 GGCCCCGCACTCGGAGCGGCCGG + Intergenic
946982190 2:225229730-225229752 GGCCCCGCACTCGGAGCAGCAGG - Intergenic
947026605 2:225744208-225744230 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
947103775 2:226648086-226648108 GGCCCCACACTCCGAGTGGCTGG + Intergenic
947720400 2:232366419-232366441 GGCCCCGCACTCTGAGCAGGCGG + Intergenic
947932079 2:233972749-233972771 GGCCCCGCACTGGGAGCAGCCGG - Intronic
1169849174 20:10031760-10031782 GGCCCCGCACTCGGAGCAGCCGG + Intronic
1170246448 20:14226587-14226609 GGCCGCGCACTCGGAGCAGCCGG + Intronic
1170471782 20:16675048-16675070 AGTACCACATTTGGAGCAGCTGG + Intergenic
1170806873 20:19639915-19639937 GCCCCCGCACTCGGAGCAGCCGG - Intronic
1170989863 20:21291950-21291972 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
1171318872 20:24221002-24221024 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1171431540 20:25085952-25085974 GGCCCCACACTCACAACAGCTGG - Intergenic
1171973448 20:31578842-31578864 GGCCCCGCACTTGGAGCGGCTGG - Intergenic
1172205322 20:33159179-33159201 GGCCACACACAGGGAGCAGCAGG + Intergenic
1172431880 20:34899084-34899106 GGCCCCGCACTCGGAGCAGCCGG - Intronic
1172956743 20:38765401-38765423 GACCCCTGACCTGGAGCAGCTGG + Exonic
1173195546 20:40910751-40910773 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1173601575 20:44299212-44299234 GGCCCCGCACTCGGAACAGCCGG + Intergenic
1173778745 20:45735976-45735998 GGCCCTGCACTTGGAGTGGCCGG + Intergenic
1173831491 20:46091930-46091952 GGCCCCACACTCGGAGCGGCCGG + Intergenic
1174162897 20:48564345-48564367 GGGCCCGCACTCGGAGCGGCTGG - Intergenic
1174743711 20:53040778-53040800 GGCCCCACTGTGGGATCAGCTGG - Intronic
1174858386 20:54067998-54068020 GGGCACACACATGGAGCTGCAGG - Intronic
1175210045 20:57348475-57348497 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
1175254131 20:57628873-57628895 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
1175321910 20:58094266-58094288 GGGACCACACTTTGAGCAGCCGG + Intergenic
1175810180 20:61853523-61853545 GGCCCCACACATGAAAAAGCAGG - Intronic
1176145220 20:63562452-63562474 GGCCCCTCACTTGCAGGAGGGGG - Intronic
1176304972 21:5118553-5118575 GGCCCCACAGGGAGAGCAGCAGG + Intronic
1176332309 21:5559888-5559910 GACCCCACACTCGGAGCCGCCGG - Intergenic
1176395448 21:6261063-6261085 GACCCCACACTCGGAGCCGCCGG + Intergenic
1176441709 21:6728041-6728063 GACCCCACACTCGGAGCCGCCGG - Intergenic
1176465971 21:7055110-7055132 GACCCCACACTCGGAGCCGCCGG - Intronic
1176489532 21:7436888-7436910 GACCCCACACTCGGAGCCGCCGG - Intergenic
1177182410 21:17757868-17757890 GGCCCTGCACTTGGAGCAGCGGG - Intergenic
1177318708 21:19493676-19493698 GGCCCGGCACTCGGAGCGGCCGG + Intergenic
1177565849 21:22819121-22819143 GGCCCCACACTCGGAGCAGCCGG - Intergenic
1177637597 21:23807096-23807118 GGCCCCGCACGTGGAGCAGCCGG + Intergenic
1178054513 21:28783835-28783857 GGCCCTGCACTCGGAGCGGCCGG + Intergenic
1178326978 21:31654272-31654294 GGGCCCGCACTCGGAGCAGCCGG + Intergenic
1178585665 21:33868598-33868620 TGCCCCGCACTCGGAGCAGCCGG - Intronic
1179434465 21:41350655-41350677 GGCCCCACCCTCTGAGAAGCTGG - Intronic
1179535562 21:42049340-42049362 GGGGCCACACTTTGAACAGCCGG + Intergenic
1179557409 21:42188828-42188850 GGCCCAACACTTGCATCTGCTGG + Intergenic
1179727568 21:43348835-43348857 GGCGCCACCCTTGGAGCCCCTGG - Intergenic
1179852083 21:44143477-44143499 GGCCCCACAGGGAGAGCAGCAGG - Intronic
1180741067 22:18053638-18053660 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1181432919 22:22893993-22894015 GCCTCCACAGTGGGAGCAGCCGG + Intronic
1181485001 22:23225005-23225027 GACCCGGCATTTGGAGCAGCTGG + Intronic
1181880507 22:25975819-25975841 GAGACCCCACTTGGAGCAGCTGG + Intronic
1182338043 22:29598303-29598325 GGCCCCGCACTTAGAGCGGCCGG - Intergenic
1183136646 22:35895385-35895407 GGCTCCACAATTGGGGCAGAGGG - Intronic
1183259853 22:36787693-36787715 GGCCCAAGACCTGGAGAAGCTGG + Intergenic
1183422145 22:37718121-37718143 GGCCCCGCACTCGGAGCGGCCGG - Intronic
1183685193 22:39357616-39357638 GGCCCCGCCCTCGGAGCAGCCGG + Intronic
1183685218 22:39357678-39357700 GGCCCCGCCCTCGGAGCAGCCGG + Intronic
1183858695 22:40653505-40653527 GACCCAAGACTTGCAGCAGCTGG + Intergenic
1183990341 22:41593605-41593627 GGCCCCGCACTCAGAGCGGCAGG + Intergenic
1184069330 22:42138361-42138383 GGCCCTGCACTCGGAGCGGCCGG + Intergenic
1184073515 22:42161676-42161698 GGCCCCACTTGTGGGGCAGCTGG + Intronic
1184584238 22:45436807-45436829 GGCCGCGCACTCGGAGCAGCCGG + Intergenic
1184906270 22:47488588-47488610 GGCCGCGCACTCGGAGCAGACGG - Intergenic
1184922662 22:47616452-47616474 GGCCCCACCCTTGGAGGCTCCGG + Intergenic
1184945641 22:47801979-47802001 GGCCCCATACCTGGAGGGGCAGG - Intergenic
949281472 3:2352471-2352493 GGCCCCACACTCAGAGTGGCAGG + Intronic
949769971 3:7568675-7568697 GGCCCAGCACTCAGAGCAGCGGG + Intronic
950203581 3:11061461-11061483 GGCCCCACACTCAGAGCGGCCGG + Intergenic
950256981 3:11513524-11513546 GGCCCCGCACTGGGAGCGGCCGG - Intronic
950418541 3:12882970-12882992 GGCCCCGCACTCGGAGCTGCTGG + Intergenic
950600396 3:14029776-14029798 GCTCCTGCACTTGGAGCAGCTGG - Intronic
950632623 3:14293286-14293308 GGCCCCGCACTCGGAGCGGCCGG + Intergenic
951024958 3:17818277-17818299 GGCCCCGCACTCGGAGCAGCCGG - Intronic
951323223 3:21271903-21271925 GGCCCCGCACTCGGAGCAGCTGG - Intergenic
951332965 3:21387491-21387513 GACCCCACCCTCAGAGCAGCCGG - Intergenic
951491252 3:23272285-23272307 GGCCCCACACTCAGAGAAGCCGG - Intronic
951551900 3:23882817-23882839 AGCCCCGCACTCGGAGCAGCCGG - Intronic
952058110 3:29473783-29473805 GGCCCCACACTTGGAGGGGCTGG - Intronic
952171390 3:30810877-30810899 AGCCCCACCCTTGTAGCAGGAGG - Intronic
952275225 3:31870200-31870222 GGCCCCGCACTCCGAGCAGCCGG + Intronic
952355368 3:32578833-32578855 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
952453677 3:33453528-33453550 GGCCCCAGACTCGGAGCGGCTGG + Intergenic
952530139 3:34254870-34254892 CAGCCCACACTTGCAGCAGCTGG - Intergenic
952730620 3:36633986-36634008 GGCCCCGCACTCGGAGCGGCCGG + Intergenic
952936730 3:38404476-38404498 GGGCCTACTCTTGGTGCAGCTGG - Intronic
953002870 3:38951231-38951253 GGCGCCGCACTCGGAGCAGCCGG + Intergenic
953522513 3:43656707-43656729 GGCCCCACACTCAGAGCAGCCGG - Intronic
954089345 3:48272204-48272226 GCCCCCACACTCGGAGCGGCCGG - Intronic
954460328 3:50622972-50622994 AGCCTCACCCTTGGAGCAGTGGG - Intronic
954755894 3:52839613-52839635 AGACCCAAGCTTGGAGCAGCTGG - Exonic
954854902 3:53635563-53635585 GCCCCCACATTTGGAGCACCTGG - Intronic
955183328 3:56691958-56691980 GGCCCCACACTCGGAGCAGCCGG + Intergenic
955186406 3:56719012-56719034 TGGCCCGCACTCGGAGCAGCCGG + Intergenic
955266480 3:57449627-57449649 GGCCCCGCACTCTGAGCAGCCGG - Intronic
955432223 3:58858501-58858523 GGCCACCTACTTGGAGCAGATGG + Intronic
955449464 3:59050937-59050959 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
956195726 3:66651650-66651672 GACCCCGCACTCCGAGCAGCCGG + Intergenic
956392205 3:68785547-68785569 GGCCCCGCATTAGGAGCGGCCGG - Intronic
956479603 3:69660746-69660768 GGCCCAGCACTCGAAGCAGCTGG + Intergenic
956481440 3:69677532-69677554 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
956938973 3:74135504-74135526 GGTACCACATTTGGAGTAGCAGG - Intergenic
956986951 3:74712135-74712157 GGCCCCCCACTGAGAGCGGCTGG + Intergenic
957002283 3:74900215-74900237 GACCCCGCACTCGGAGCCGCCGG - Intergenic
957009204 3:74985407-74985429 GGCCCCATACTCGGAGCAGCTGG - Intergenic
957074069 3:75587877-75587899 TGGCCCACACTAGGAGCGGCTGG + Intergenic
957229666 3:77495639-77495661 TGCCCCAAACTTGGATTAGCCGG + Intronic
957270992 3:78030011-78030033 GGCCCCGCCCTCGGTGCAGCCGG + Intergenic
957362059 3:79173416-79173438 GGGCCCGCACTCCGAGCAGCTGG + Intronic
957419690 3:79951652-79951674 GGCCCCACACTCGGAGCAGCCGG - Intergenic
957446117 3:80314572-80314594 GACGCTGCACTTGGAGCAGCCGG + Intergenic
957556318 3:81767668-81767690 GGCCCCGCACTCGGAGCATCCGG - Intergenic
957560186 3:81812289-81812311 GGCCCGGCACTGGGAGCAGCCGG - Intergenic
957630927 3:82715409-82715431 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
957665204 3:83217892-83217914 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
957804929 3:85134142-85134164 GACCCCGCACTCAGAGCAGCCGG - Intronic
957830040 3:85504957-85504979 GGCCCCGCACGCGAAGCAGCCGG - Intronic
957919678 3:86731720-86731742 GGCCCCACACTTGGAGCGGCCGG - Intergenic
957921797 3:86757672-86757694 GGCTCCGCACTCGGAGCAGCCGG + Intergenic
958022615 3:88015768-88015790 GGGCCGGCACTCGGAGCAGCCGG + Intergenic
958419856 3:93917666-93917688 GGGCCGGCACTCGGAGCAGCCGG + Intronic
959422718 3:106148706-106148728 GGCCCCACACTCAGAGCAGCCGG + Intergenic
960149826 3:114238571-114238593 GGCCCCACACTCGGAGCAGCCGG - Intergenic
960199422 3:114812935-114812957 GACCCCGCACTCGGAGCGGCCGG - Intronic
960227553 3:115185167-115185189 GGGCCCGCACTGGGAGCAGCCGG - Intergenic
960282116 3:115791641-115791663 GACCCCGCACTCGGAGCAGCCGG + Intergenic
960479526 3:118171477-118171499 GGTCCCGCACTTGGAGCAGCCGG + Intergenic
960560061 3:119073683-119073705 GGCCCCACACTTGGAGCAGCCGG - Intronic
960669185 3:120140328-120140350 GGGCCCGCACTTGGAGCCGCCGG + Intergenic
960761693 3:121078835-121078857 GGCCCCGCACTCAGAGCAGCCGG - Intronic
960868606 3:122227458-122227480 GGCCCTGCACTTGGAGCAGCTGG - Intronic
961368806 3:126417513-126417535 GGCCCCACAGTTGGAGAGGCAGG + Intronic
961460443 3:127046756-127046778 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
961461977 3:127056388-127056410 GGCCCCGCACTTGGAGCAGCCGG - Intergenic
961465059 3:127076522-127076544 AGCCCCGCACTGGGAGTAGCTGG - Intergenic
961668383 3:128508542-128508564 GTCCCCACACGTGGGGCACCCGG + Intergenic
961688778 3:128653474-128653496 GGCCCCGCACTCGGAGCGGCCGG + Intronic
961700814 3:128743203-128743225 GGCCCCACACTCGGAGTGGCCGG - Intronic
961874383 3:130010719-130010741 GGCCCCGCACTAGGAGCTGCCGG + Intergenic
961932336 3:130547341-130547363 GCCCCCGCACTTGGAGTGGCTGG - Intergenic
962106615 3:132396501-132396523 GGCCCCGCACTGGGCGCAGCCGG + Intergenic
962177264 3:133167673-133167695 GGCCCCACACTCCGAGCGGTCGG - Intronic
962383785 3:134916641-134916663 GGCCCCACACTCAGAGCTGCCGG - Intronic
962600525 3:136987868-136987890 GGCCCCGCACTCGGAGCAGCCGG - Intronic
962758231 3:138484728-138484750 GGCCCCACACTCGGAGCAGCCGG + Intergenic
962998120 3:140651503-140651525 GGCCCTGCACTGGGAGCAGCCGG + Intergenic
963121530 3:141780824-141780846 TGCCCCGCACTTGGGGCAGGTGG - Intronic
963397191 3:144749891-144749913 GGCCCCGCACTGGGAGCAGCAGG + Intergenic
963397863 3:144756961-144756983 GGCCCTGCACTTGGAGCAGCTGG + Intergenic
963440389 3:145333472-145333494 GGCCCCGCACTCGGAGCGGCCGG + Intergenic
963509171 3:146225713-146225735 GGCCCCACACTCGGAGCAGTCGG - Intronic
963533246 3:146497377-146497399 AGGCCCGCACTCGGAGCAGCTGG + Intergenic
963554645 3:146772425-146772447 GGCCCCACACTCAGAGTGGCCGG + Intergenic
963589995 3:147245847-147245869 GACCCCGCACTCGGAGCGGCCGG - Intergenic
963651846 3:147989662-147989684 AGCCCCACACTTGGAGTGGTCGG - Intergenic
963743023 3:149098131-149098153 GACCCCGCACTTGGAGCCGCTGG - Intergenic
963760575 3:149284100-149284122 GGCCCCACACTGGGAGCAGCCGG + Intergenic
963862148 3:150323047-150323069 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
964014353 3:151928234-151928256 GGCCCCGCCCCCGGAGCAGCGGG + Intergenic
964032302 3:152152495-152152517 GGCCGCGCACTCTGAGCAGCCGG + Intergenic
964037522 3:152217382-152217404 GGCCCCACACTCGGAGCAGCTGG + Intergenic
964265398 3:154889521-154889543 GGCCCCGCACTCCGAGCGGCCGG - Intergenic
964376244 3:156051857-156051879 GGCCCCACAGTCAGAGCGGCCGG + Intronic
964443982 3:156740657-156740679 GACCCCGCACTTGGAACAGCCGG + Intergenic
964751841 3:160060603-160060625 GGTCCCACATTCGGAGCAGCTGG + Intergenic
964974150 3:162599777-162599799 AGCCCCACACTTGGAGCTGCTGG + Intergenic
964982523 3:162703205-162703227 GGCCCCACACTCGGAGCGGCCGG - Intergenic
965040275 3:163499102-163499124 GGCCCCGTACTGGGAGCAGCCGG + Intergenic
965044156 3:163552603-163552625 GGGCCCGCACTCAGAGCAGCGGG - Intergenic
965092230 3:164179327-164179349 GGCCCTGCACTCAGAGCAGCCGG + Intergenic
965139240 3:164814329-164814351 GGCCCCACACTCGGTGTGGCTGG + Intergenic
965200364 3:165649598-165649620 GGCCCTGCACTCGGAGCAGCCGG - Intergenic
965245262 3:166258749-166258771 GGCCCCGCACTCAGAGCAGCCGG - Intergenic
965288022 3:166842891-166842913 GGCCCCGCACTCGGGGCAGCCGG + Intergenic
965298110 3:166975913-166975935 GGCCCCGCACTCGTAGCGGCCGG + Intergenic
965392315 3:168119875-168119897 GGACACACACCTTGAGCAGCTGG - Intergenic
965652339 3:170947302-170947324 GGCCCCACACTTGGAGTGGCCGG + Intergenic
965691117 3:171357958-171357980 AGCCCCACACTTGGAGCTCCAGG - Intronic
965698970 3:171439939-171439961 GGCCCTTCCCTCGGAGCAGCTGG - Intronic
965744227 3:171907331-171907353 GGCCCCGCACTCAGAGCTGCTGG - Intronic
965837349 3:172866860-172866882 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
965943506 3:174212253-174212275 GGCCCCGCACTCAGAGCAGCCGG - Intronic
966096815 3:176213709-176213731 GGCCCTGCACTCGGAGCAGCCGG - Intergenic
966191037 3:177272009-177272031 GGGCCCGCACTCAGAGCAGCCGG - Intergenic
966246091 3:177809179-177809201 GGCCCCACACTCAGAGTGGCCGG - Intergenic
966252378 3:177880701-177880723 GGGAACACACTTGGAGTAGCAGG + Intergenic
966725456 3:183104027-183104049 GGCCTCGCACTCGGAGTAGCCGG - Intronic
966855330 3:184189745-184189767 GGCCCCACACCTGGATGTGCTGG - Exonic
967181813 3:186911697-186911719 GGCCCCACCCTGGGTCCAGCAGG + Intergenic
967234119 3:187367850-187367872 GGCCCTGCACTCGGAGCGGCCGG - Intergenic
967265573 3:187688254-187688276 GTCCCCACACTCAGAGCATCTGG + Intergenic
967499172 3:190177330-190177352 GGCTCTGCACTCGGAGCAGCGGG - Intergenic
967953928 3:194862715-194862737 TGCCCCCAACTTGGAGGAGCTGG - Intergenic
968067435 3:195766480-195766502 GGCACCACCCAGGGAGCAGCTGG - Intronic
968181618 3:196599318-196599340 GGCCCCGCACTCGGAGCAGCTGG - Intergenic
968412820 4:404240-404262 GGCCCTGCACTTAGAGCAGCCGG - Intergenic
968832356 4:2939519-2939541 GCACCCACACTTTGACCAGCCGG + Exonic
968934663 4:3603768-3603790 TGCCCCACACCTGGAGGAGCTGG + Intergenic
969362335 4:6672803-6672825 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
969415042 4:7052484-7052506 GTCCCCTCTCATGGAGCAGCCGG - Intronic
969654993 4:8491691-8491713 GGGCCTGCACTCGGAGCAGCCGG - Intronic
969664272 4:8548125-8548147 GGCCCCACACATGGAGATGGGGG + Intergenic
969781778 4:9409890-9409912 GGCCCCACACTTGGGGCGGCTGG - Intergenic
970391196 4:15614993-15615015 GGCCCCGCACTCAGAGCAGCCGG + Intronic
970615775 4:17767088-17767110 GGCCCCGCACTCGGAGGGGCCGG - Intronic
970649348 4:18159550-18159572 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
970673187 4:18418619-18418641 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
970803505 4:20004091-20004113 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
971043369 4:22778876-22778898 GGCCCCACACTCGGAACAGCCGG - Intergenic
971281700 4:25246896-25246918 GGCCCCACACTGGGAGCAGCCGG - Intronic
971377135 4:26064260-26064282 GGCCCGGCACTCGGAGCAGCCGG - Intergenic
971905214 4:32716506-32716528 GGCCCCTCACTCGGAGCAGCCGG - Intergenic
972022803 4:34335922-34335944 GGCCCCGCACTCGGAGCAGTCGG - Intergenic
972173355 4:36375023-36375045 GGCCCTGCACTTGGAGCGACCGG + Intergenic
972360961 4:38325197-38325219 GGCCCTGCACTCGGAGCGGCTGG - Intergenic
972392532 4:38626982-38627004 CGGCCCGCACTCGGAGCAGCCGG + Intergenic
972778595 4:42266019-42266041 GGCCCCACACTGGGAGCAGCTGG + Intergenic
972913285 4:43846249-43846271 GGCCCCGCACTTGGAGCAGCCGG + Intergenic
973037081 4:45420242-45420264 GGCCCCACACTCGGAGCAGCCGG + Intergenic
973039959 4:45457396-45457418 TGCCCCACACTCAGAGCGGCCGG - Intergenic
973041820 4:45477631-45477653 GGCCCTGCACTTGGAGCGGTTGG - Intergenic
973190332 4:47378335-47378357 AGCCCCGCACTTGGAGCGGCCGG - Intronic
973308063 4:48675420-48675442 GGCCCGGCACTCGGAGCAGACGG + Intronic
973684368 4:53354356-53354378 CGCCCCACACTTGGAGTGGCCGG - Intronic
973764324 4:54149580-54149602 GGCCCCGCACTTGGAGCGGCCGG - Intronic
973765114 4:54155405-54155427 GGCCCCGCACTCGGAGCAGCCGG - Intronic
974172118 4:58280379-58280401 GGCCCCACACTTGACACATCGGG - Intergenic
974207432 4:58724215-58724237 GGCCCTGCACTTGGAGCGGTGGG + Intergenic
974484810 4:62492177-62492199 GGCCCCGCACTCAGAGCAGCCGG - Intergenic
974792788 4:66712694-66712716 GGCCCCACACGCGGAGCAGCCGG - Intergenic
974804364 4:66860248-66860270 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
974827736 4:67151959-67151981 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
974839359 4:67283101-67283123 GGCCCCACACTTGGAGCGGCTGG - Intergenic
974992892 4:69115524-69115546 GGCCTCGCACTCGGAGCAGCCGG - Intronic
975028066 4:69576611-69576633 GGCCCCACACTTGGAGCTGCTGG - Intergenic
975160686 4:71121007-71121029 GGTCCCGCACTTGGAGTGGCAGG + Intergenic
975298802 4:72765978-72766000 GACCCTGCACTGGGAGCAGCGGG + Intergenic
975595206 4:76043567-76043589 GGCCCCGCACTCGGAACAGCTGG - Intronic
975654056 4:76623226-76623248 GCCCACAGACTTGGTGCAGCAGG - Intronic
975744938 4:77466465-77466487 GGCCCCACACTTGGAGTGGCTGG + Intergenic
976102476 4:81580530-81580552 GGCCCCACACTCAGAGCAGCCGG + Intronic
976646884 4:87396227-87396249 GGCCCCACACTCGGAGCAGTCGG - Intergenic
976690624 4:87863948-87863970 GGCCCCACACTCGGAGCAGCCGG - Intergenic
977206498 4:94169924-94169946 GGCCCCGCACTCGGAGCCGCCGG + Intergenic
977470723 4:97438366-97438388 GGCCCCGCACTCAGAGCAGCTGG - Intronic
977717367 4:100196801-100196823 GGCCCGGCACTAGGAGCAGCCGG - Intergenic
977750984 4:100609046-100609068 GGCCCCGCACTCGGAGCCGCCGG - Intronic
977906463 4:102483206-102483228 GGCCCCGCACTCAGAACAGCCGG + Intergenic
978030577 4:103936857-103936879 GGCCCCCCACTGGGAGCGGCTGG + Intergenic
978080231 4:104582062-104582084 GGCCCTGCACTCGGAGCAGCCGG + Intergenic
978207211 4:106092673-106092695 GGCCCCGCACTGGGAGCAGCCGG - Intronic
978241906 4:106525625-106525647 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
978466235 4:109012552-109012574 GGGCCCACACTTGGAGCGGCCGG + Intronic
978886535 4:113772421-113772443 GGCCCTGCACTTGGAGCAGCTGG + Intergenic
978917991 4:114148823-114148845 GGCCCCACACTCGGAGCGGCCGG - Intergenic
978944756 4:114481985-114482007 GGCCCTGCACTGGGCGCAGCCGG - Intergenic
979033242 4:115678758-115678780 GGCCCTGCACTTGGAGAGGCCGG - Intergenic
979290837 4:118977330-118977352 GGCCCCGCACTCGGAGCAGCTGG - Intronic
979445686 4:120808847-120808869 GGCCCCTCACTTGAAGCAGCCGG - Intronic
979579791 4:122343583-122343605 GGCCTCACACCTGGATCAGGAGG + Exonic
979755852 4:124339133-124339155 GACCCCGCACTCGGAGCAGCCGG + Intergenic
979825725 4:125229872-125229894 GGCCCTGCACTCGGAGCAGCCGG - Intergenic
979865200 4:125745071-125745093 GGTCCCACACTAGGAGCGGCCGG + Intergenic
979899729 4:126201571-126201593 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
980043401 4:127964518-127964540 GGCCCCGCACTGGGAGCAGCAGG - Intronic
980051953 4:128047839-128047861 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
980227960 4:130012860-130012882 GGCCCCGCACTCGGAGCAGCAGG + Intergenic
980230273 4:130038823-130038845 GGCCCCGCACTCTGAGCAGCCGG - Intergenic
980470247 4:133240689-133240711 GGCCCTGCACTCGCAGCAGCTGG - Intergenic
980698732 4:136395425-136395447 CGCCCCAGACTCGGAGCAGCTGG + Intergenic
980774472 4:137421100-137421122 GGCCCCGCACTCTGAGCGGCCGG + Intergenic
980799741 4:137733815-137733837 GGCCCCGCACTCGAAGCAGCTGG + Intergenic
980827336 4:138088850-138088872 GGCCTCGCACTCGGAGCAGCCGG - Intergenic
981146744 4:141333299-141333321 GGCCCTGCACTCGGAGCAGCCGG - Intergenic
981146751 4:141333324-141333346 GGCCCTGCACTCGGAGCAGCCGG - Intergenic
981146758 4:141333349-141333371 GGCCCTGCACTCGGAGCAGCCGG - Intergenic
981146765 4:141333374-141333396 GGCCCTGCACTCGGAGCAGCCGG - Intergenic
981146772 4:141333399-141333421 GGCCCTGCACTCGGAGCAGCCGG - Intergenic
981146779 4:141333424-141333446 GGCCCTGCACTCGGAGCAGCCGG - Intergenic
981146786 4:141333449-141333471 GGCCCTGCACTCGGAGCAGCCGG - Intergenic
981146793 4:141333474-141333496 GGCCCTGCACTCGGAGCAGCCGG - Intergenic
981170300 4:141615589-141615611 GGCCCTGCACTTGGTGCAGCTGG + Intergenic
981275803 4:142897579-142897601 GGCCATGCACTTGGAGCAGTCGG + Intergenic
981606460 4:146546072-146546094 TTCCCCAGACTTGGAGCAGCAGG + Intergenic
982024334 4:151236312-151236334 GGCCCCGCACTTGGCACAGCTGG + Intronic
982408207 4:155044382-155044404 GGGCCCGCACTCGGAGCAGCCGG + Intergenic
982678958 4:158407399-158407421 GGCCCTGGACTTGGAGAAGCTGG + Intronic
982728170 4:158927781-158927803 GGCCCCGCACTCGGAGCAGCCGG + Intronic
982768917 4:159378177-159378199 GGCCCCACACTTGGAGCCGCTGG + Intergenic
982770125 4:159390038-159390060 GGCCCCACACTCGGAGCAGCCGG + Intergenic
982868830 4:160550398-160550420 GGCCCCGCACTCGGAGCAGCTGG - Intergenic
982921248 4:161277322-161277344 GGCCCCGCACTGGGAGCGGCCGG + Intergenic
982985743 4:162203667-162203689 GGCCCCGCACTGGGAGCGGCCGG + Intergenic
983026079 4:162739620-162739642 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
983060319 4:163152925-163152947 GGCCCCGCACTCAGAGCAGCCGG + Intronic
983230678 4:165126218-165126240 GGCCCTGCACTCGGAGCAGCCGG - Intronic
983369784 4:166843097-166843119 GGCCCCGCACTCAGAGCGGCTGG - Intronic
983752825 4:171298354-171298376 GGCCCCGCACTCGGAGCAGCAGG + Intergenic
983930947 4:173452685-173452707 GGCCCCGGATTTTGAGCAGCAGG - Intergenic
984069273 4:175092191-175092213 CGCCCCGCACCTGGAGCAGCCGG + Intergenic
984192857 4:176625445-176625467 GGGCCCGCACTCGGAGCAGCCGG - Intergenic
984238838 4:177193476-177193498 GGGCCCGCACTCGGAGCAGCCGG - Intergenic
984265634 4:177495671-177495693 GGCCCCACACTTGGAGCAGCCGG + Intergenic
984662231 4:182386640-182386662 GGCCCCGCACTCGGAGCTGCCGG + Intronic
984901730 4:184591988-184592010 GACCCCACACTCGGAGCGGCCGG + Intergenic
984948742 4:184990369-184990391 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
985087078 4:186324663-186324685 GGCCCCACACTCGGAGCAGCCGG + Intergenic
985145415 4:186890194-186890216 GGCCTCACACTGGGAGCCGCAGG + Intergenic
985203232 4:187505710-187505732 GGCACTGCACTCGGAGCAGCCGG + Intergenic
985324690 4:188754578-188754600 GGCCCCACACTTGGAGTGGCCGG + Intergenic
985366380 4:189236387-189236409 GGCCCCACACTCGCAGCAGCTGG + Intergenic
985403619 4:189615498-189615520 GGCCCCACACTCGGAGTGGCTGG - Intergenic
985403889 4:189616926-189616948 GGCACTGCACTCGGAGCAGCCGG - Intergenic
985590869 5:764441-764463 GGCCCTGCACTCAGAGCAGCCGG + Intronic
986007210 5:3677993-3678015 AGCCCCACAGTCTGAGCAGCTGG - Intergenic
986151982 5:5137865-5137887 GGCCCCGCACTCAGAGCAGCCGG + Intergenic
986240771 5:5957695-5957717 GGCATCACACTAAGAGCAGCAGG - Intergenic
986626144 5:9725388-9725410 GGCCCCGCACTTGGAGCAGCCGG + Intergenic
986661725 5:10065569-10065591 GGCCCCCCACTCTGAGCGGCCGG + Intergenic
986697978 5:10375237-10375259 GGGCCTGCACTCGGAGCAGCCGG + Intronic
986912406 5:12574225-12574247 GGCCCCGCACTCGGAGCGGCCGG - Intergenic
986963576 5:13244268-13244290 GGCCGCGCACCTGGAGCGGCCGG + Intergenic
986993263 5:13578591-13578613 GGCCCCGCCCTCGGAGCGGCCGG + Intergenic
987099158 5:14577327-14577349 GGCCCCACACTCGGAGCGGCCGG + Intergenic
987146270 5:14994086-14994108 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
987156808 5:15096836-15096858 GGACCCGCACTCGGAGCAGCCGG - Intergenic
987299902 5:16588037-16588059 GGCCTCAGACTGGGAGCAGTGGG - Intronic
987347448 5:16991219-16991241 GGCCCCGCACTCCGAGCGGCAGG - Intergenic
987384032 5:17312053-17312075 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
987476717 5:18399953-18399975 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
987543810 5:19287824-19287846 GGCCCGGCACTTGGAGCAGCCGG + Intergenic
987896275 5:23951376-23951398 GGCCCTGCACTCGGAGCAGCCGG + Intronic
988020539 5:25614836-25614858 GGCCCCGCACTTGGAGCCGCGGG - Intergenic
988073470 5:26324501-26324523 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
988087010 5:26485561-26485583 GGCCCCGCACTCTGAGCAGCCGG - Intergenic
988132139 5:27119978-27120000 GCCCCCGCACTCGGAGCAGCCGG + Intronic
988143075 5:27267478-27267500 GGCCCGGCACTCGGAGCAGCCGG - Intergenic
988177243 5:27743541-27743563 GGCCCTGCACTCCGAGCAGCCGG + Intergenic
988684753 5:33515667-33515689 GGCCCCACACTCGGAGCAGCGGG - Intergenic
988883568 5:35531706-35531728 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
989757641 5:44975092-44975114 AGCCCCACACTCGGCGCAGCTGG + Intergenic
989956828 5:50369518-50369540 GGCCCTGCACTTGGAGCAGCCGG + Intergenic
990243241 5:53837051-53837073 GGCCCCGCACTCGGAGCAGCTGG + Intergenic
990345243 5:54865156-54865178 GGCCCGGCACTCGGAGCAGCCGG + Intergenic
990418948 5:55613431-55613453 GGCCCTGCACTCGGAGCAGCTGG + Intergenic
990665727 5:58069391-58069413 GGCCCCGCACTGGGGGCAGCCGG - Intergenic
990869461 5:60415535-60415557 GGGCCCGCACTGGGAGCGGCAGG + Intronic
991214928 5:64150159-64150181 GGCCCTGCACTTGGAGCAGCTGG + Intergenic
991567588 5:68020683-68020705 GCCCCCGCACTCGGAGCCGCCGG - Intergenic
991617954 5:68516806-68516828 CGTCCCACACCTGGATCAGCAGG + Intergenic
991657776 5:68920948-68920970 GGCCCCGCACTCAGAGCAGCCGG + Intergenic
992947432 5:81823802-81823824 GGCCCTGCACTCGGAGCAGCGGG + Intergenic
993320952 5:86466961-86466983 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
993328599 5:86569804-86569826 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
993770267 5:91917357-91917379 GGCCCCGCACAGGGAGCGGCGGG + Intergenic
993822016 5:92631413-92631435 GGTGCCGCACTCGGAGCAGCCGG + Intergenic
994229947 5:97301228-97301250 GGCCCTGCACTTGGAGCAGCCGG + Intergenic
994239854 5:97407258-97407280 GGCCCCGCACTCGGAGCCGCCGG + Intergenic
994251538 5:97542160-97542182 GGCCCCACACTCGGAGCAGCCGG - Intergenic
994254810 5:97580274-97580296 GGCCCCACACTCAGAGCAGCTGG - Intergenic
994507091 5:100656843-100656865 GGCCCCACACTCAGAGCAGCCGG + Intergenic
994509859 5:100689148-100689170 GGGCCCGCACTCGGAGCAGCTGG - Intergenic
994570280 5:101506107-101506129 GGCCCCGCACTTAGAGCAGCCGG + Intergenic
994605620 5:101962726-101962748 GGCCCCGCACTGGGAGCAGCCGG - Intergenic
994669735 5:102752146-102752168 GGGCCCACACTCGGAGTGGCCGG + Intergenic
994701717 5:103142311-103142333 GGCCCCGCACTCGGAGCAGCCGG - Intronic
994769806 5:103966606-103966628 AGGCCCCCACTCGGAGCAGCTGG - Intergenic
994841373 5:104929083-104929105 GGCCCCGCACTCGGAGCACCTGG + Intergenic
994928801 5:106154386-106154408 GGCCCGGCACTCGGAGCGGCAGG + Intergenic
994935272 5:106246333-106246355 GACCCCACGCTCGGAGCGGCAGG + Intergenic
995032303 5:107494325-107494347 GGCCCTGCACTGGGAGCAGCCGG + Intronic
995239810 5:109873063-109873085 ATCCCCACGCTTGGAACAGCAGG + Intergenic
995314119 5:110748211-110748233 GGAGTCACACTTGGAGCAGAAGG + Exonic
995326422 5:110894263-110894285 GACCCCGCACTCGGAGCCGCCGG - Intergenic
995388363 5:111612441-111612463 CACCCCACACTTGGAGTGGCGGG - Intergenic
995529115 5:113075115-113075137 GGCCCCGCACTTGGAGCAGCCGG + Intronic
995568659 5:113457224-113457246 GGCCCCACACTCGGAGCAGCTGG + Intronic
995582619 5:113617395-113617417 CGGCCCACACTTGGAGTGGCTGG + Intergenic
995679888 5:114704569-114704591 GGCCCCGCACTGGGAGCAGCCGG - Intergenic
995920379 5:117304741-117304763 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
995975791 5:118033859-118033881 GGCCCCGCACTCGGAGCAGCTGG + Intergenic
996107028 5:119517184-119517206 GGCCCGGCACTCAGAGCAGCTGG + Intronic
996298575 5:121954232-121954254 GGCCTCACACTTGGAGCGGCCGG - Intergenic
996435672 5:123430627-123430649 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
996681170 5:126229183-126229205 GGCCCCACACTTGGTGCGTCTGG + Intergenic
996747118 5:126854810-126854832 GCCCCCGCACTCCGAGCAGCCGG - Intergenic
996815558 5:127569535-127569557 GGCCCTGCACTCGGAGCTGCCGG + Intergenic
997158215 5:131580314-131580336 GGCCCCACACTCGGAGTGACCGG - Intronic
997760540 5:136444293-136444315 GGCCCCACACTCGGAGCAGCCGG + Intergenic
998117519 5:139549424-139549446 GGCCCCGCACTCCGAGCGGCCGG + Intronic
999269796 5:150290077-150290099 GGCCCCACAGTTGGAGGTGGGGG - Intronic
999406162 5:151309272-151309294 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
999855303 5:155587032-155587054 AGGCCCGCACTCGGAGCAGCCGG - Intergenic
1000013418 5:157255568-157255590 GGGACCACACTTTGAGTAGCAGG - Intergenic
1000066015 5:157693918-157693940 GGCCCCTCACTGGGAGCAGCCGG + Intergenic
1000212348 5:159119253-159119275 GGCCCCGCACTCAGAGCGGCGGG + Intergenic
1000329209 5:160194177-160194199 GGTCCCGCACTGGGAGCAGCCGG - Intronic
1000547592 5:162621923-162621945 GGCCCCACACTCGGAGCAGCCGG + Intergenic
1000889331 5:166784778-166784800 GGCCCGGCACTCGGAGCGGCTGG - Intergenic
1000891837 5:166810476-166810498 GGCCCCACATTCGGAGTGGCCGG - Intergenic
1001636428 5:173213525-173213547 GGCCCCACACTCTGAGCGGCCGG + Intergenic
1002040175 5:176507717-176507739 TGCACCCCACTTGGAGCAGTGGG + Exonic
1002221722 5:177688315-177688337 TGCCCCGCACTTGGAGCAGCCGG + Intergenic
1002433797 5:179219501-179219523 CGCCCCACACTGGGAGGTGCAGG - Intronic
1002789396 6:426481-426503 GGCCCCGCACTCGGAGCATCAGG - Intergenic
1002907043 6:1457251-1457273 GGCCCCGCACTCGGAGCATCAGG - Intergenic
1003060706 6:2860224-2860246 GGCCGCGCACTCGGAGCAGCCGG + Intergenic
1003069652 6:2935888-2935910 GGGCCCGCACTCGGAGCCGCCGG + Intergenic
1003070204 6:2939710-2939732 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
1003081893 6:3027782-3027804 GGCCCCGCACTCAGAGCAGCCGG + Intergenic
1003170866 6:3721045-3721067 GGCCCCGCACTGGGAGCAGCCGG - Intergenic
1003178469 6:3771717-3771739 GGGCCCGCACTCGGAGCGGCTGG + Intergenic
1003213734 6:4090222-4090244 GGCCCTGCACTGGGAGCTGCAGG + Intronic
1003224484 6:4191569-4191591 GGCCCCACACTCCGAGCAGCCGG - Intergenic
1003490042 6:6613528-6613550 GGCCCCGCACTCGGAGCGGCCGG - Intronic
1003508855 6:6762760-6762782 GGCCCCGCACTTGGAGCAGCCGG - Intergenic
1003531355 6:6940172-6940194 GGCCCCGCACTCGGAGCGGCCGG + Intergenic
1003593698 6:7456440-7456462 GGCCCCTCACTCAGAGCGGCCGG + Intergenic
1003643041 6:7891662-7891684 GGCTCCAACCTGGGAGCAGCTGG - Exonic
1003671521 6:8164417-8164439 GGTCCCGCACTCGGAGCAGCCGG + Intergenic
1003747992 6:9024358-9024380 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
1003749563 6:9040839-9040861 GGCCCCGCACTCGGAGCGGCAGG + Intergenic
1003770176 6:9290716-9290738 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1003836228 6:10074958-10074980 GGCCCCGCACTCGGAGCGGCTGG - Intronic
1003845712 6:10171803-10171825 GGCCCCGCACTCAGAGCAGCCGG + Intronic
1003862772 6:10337491-10337513 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
1003901574 6:10659966-10659988 GGCCCCGCACTCGGAGCGGCCGG + Intergenic
1003908110 6:10720674-10720696 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
1003914737 6:10776131-10776153 GGCCCAACCCTTGGTGTAGCAGG + Intronic
1003947262 6:11087297-11087319 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
1003982486 6:11402862-11402884 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1004036947 6:11933161-11933183 GGCCCCACACTCGGAGCAGCCGG + Intergenic
1004053171 6:12108670-12108692 GGCCCCGCACTCGGAGCAGCCGG - Intronic
1004220592 6:13743281-13743303 GACCCCGCACTAGGAGCAGCCGG + Intergenic
1004224380 6:13772570-13772592 GGCCCCGCACTCGCAGCAGCCGG + Intergenic
1004233724 6:13854996-13855018 GGCCCAGCACTCGGAGCAGCCGG - Intergenic
1004234247 6:13860214-13860236 GGCCCCGCACTCGGAGTGGCTGG + Intergenic
1004235559 6:13872202-13872224 GGCCCCGCACTGGGAGCAGCCGG - Intergenic
1004248441 6:14002507-14002529 GGCCCCGCAGTCGGAGCGGCCGG + Intergenic
1004250301 6:14018115-14018137 GGCCCCGCACTCGGAGCGGCCGG + Intergenic
1004354052 6:14916063-14916085 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
1004472945 6:15945451-15945473 AGGCCCACATTTGGAACAGCAGG + Intergenic
1004499689 6:16198371-16198393 GGGCCCGCACTGGGAGCAGCCGG - Intergenic
1004503225 6:16227176-16227198 GGCCCCGCACTCGGAGCGCCTGG - Intergenic
1004511630 6:16288334-16288356 GGCCCTGCACTCGGAGCGGCCGG + Intronic
1004665544 6:17745587-17745609 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1004693321 6:18011469-18011491 AGCCCCGCACTCGGAGCGGCCGG - Intergenic
1004811810 6:19270856-19270878 GGCCTCACACTTGGCACAGCTGG + Intergenic
1004866075 6:19854707-19854729 GGCCCCGCACTCGGAGCAACCGG - Intergenic
1004883686 6:20032417-20032439 GGCTCGACACTTGGAACGGCCGG + Intergenic
1004906195 6:20239143-20239165 CGCCCCACAGTCGGAGCGGCCGG + Intergenic
1004906952 6:20245051-20245073 GGGCCCGCACTCGGAGCCGCCGG - Intergenic
1004914433 6:20318999-20319021 GGCCCCGCACTCGGAGCGGCTGG + Intergenic
1005600893 6:27425108-27425130 GGCCCCGCGCTCGGAGCAGCCGG - Intergenic
1005707464 6:28469633-28469655 GGCCCCGCACTCGGAGCAACCGG - Intergenic
1005722452 6:28616467-28616489 GGGCCCCGACTTGAAGCAGCGGG - Intergenic
1005758911 6:28950073-28950095 GGCCTCGCACTCGGAGCAGCCGG - Intergenic
1005766299 6:29015175-29015197 GGCCCCACACTCGGAGCGGCCGG + Intergenic
1005977024 6:30807722-30807744 GGCCCCGCACTCAGAGCAGCCGG - Intergenic
1005978258 6:30816578-30816600 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1006007808 6:31016872-31016894 GGCCCCACACTCTGAGCCTCGGG + Intronic
1006033619 6:31195541-31195563 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
1006127949 6:31852136-31852158 TGCCCCGCTCTTGGAGCGGCAGG + Intergenic
1006227085 6:32548204-32548226 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1006348454 6:33502770-33502792 GGCCCCACACTCGGAGTGGCCGG + Intergenic
1006351120 6:33521779-33521801 GACCCCACACTCGGAGCAGCCGG - Intergenic
1006434148 6:34017462-34017484 GACCCCGCACTGGGAGCCGCCGG - Intergenic
1006497909 6:34437278-34437300 GGCCTCGCACTCGGAGCGGCTGG - Intergenic
1006748919 6:36364512-36364534 GGTCCCGCACTCGGAGCAGCCGG - Intronic
1007630345 6:43269909-43269931 GGGCCCACACCTGCTGCAGCTGG - Intronic
1008005611 6:46406046-46406068 GGCCCCGCATTCGGAGCAGCCGG - Intronic
1008038763 6:46774679-46774701 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
1008254053 6:49275522-49275544 GGCCCTGCACTCAGAGCAGCCGG + Intergenic
1008270206 6:49482104-49482126 GGCCCCACACTCGGAGCAGCTGG - Intronic
1008270510 6:49483697-49483719 GGCCCCACACTTGGAGCAGCTGG - Intronic
1008284364 6:49629829-49629851 GGCCCCGCACTCGGAGCAGCCGG - Intronic
1008567817 6:52786595-52786617 GGCCCCACACTCAGAGTGGCTGG + Intergenic
1008631149 6:53363732-53363754 CGCCCCACACTGGGAGCTGCCGG - Intergenic
1009510812 6:64547961-64547983 GGTCCCGCACTTGGAGCTGCCGG - Intronic
1009587636 6:65627622-65627644 GGCCCCACACTCGGAACAGCTGG + Intronic
1009615511 6:65999646-65999668 GGCCCTGCACTCGGAGCCGCTGG - Intergenic
1009685318 6:66949295-66949317 GAGCCCGCACTCGGAGCAGCCGG + Intergenic
1009769002 6:68121077-68121099 GGCCTCACAATTGCAGCAGAAGG + Intergenic
1009800709 6:68533513-68533535 AGGCCTGCACTTGGAGCAGCCGG + Intergenic
1010199333 6:73269154-73269176 GGCCCCATACTCGGAGCAGCCGG - Intronic
1010235669 6:73572816-73572838 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1010269326 6:73903239-73903261 TGCCCCACACTCGGAGCAGCTGG + Intergenic
1010277962 6:73990910-73990932 GGCCCAGCACTGGGAGCGGCTGG - Intergenic
1010617363 6:78029879-78029901 GGCCCCGCACTCGGAGCGGCCGG + Intergenic
1011246506 6:85326059-85326081 GGCCCTGCACTCGGAGCGGCCGG + Intergenic
1011346223 6:86372000-86372022 GGTCCCACAATTGTAGCAGAAGG + Intergenic
1011620107 6:89234726-89234748 GACCCCGCACTCGGAGCGGCCGG - Intergenic
1011974750 6:93282727-93282749 GGCCCCTCACTCAGAGCCGCGGG + Intronic
1012189360 6:96261225-96261247 GGCCCCGCTCTCGGAGCAGCCGG - Intergenic
1012601735 6:101106628-101106650 GGCCCCATGCTTGGTACAGCGGG - Intergenic
1012789689 6:103677395-103677417 GGCCCCACACTCGGTGCAGCTGG - Intergenic
1012970806 6:105728393-105728415 GGTCCCAGATTTGGAGCACCTGG + Intergenic
1013025741 6:106269686-106269708 GACCCCGCACTCGGAGCAGCCGG - Intronic
1013410794 6:109881423-109881445 CGGGCCGCACTTGGAGCAGCCGG - Intergenic
1013694820 6:112689603-112689625 GACCCCGCACTAGGAGCGGCCGG - Intergenic
1014088396 6:117373566-117373588 GGCCCCGCACTCAGAGCGGCTGG - Intronic
1014240721 6:119015404-119015426 GGCCCCACACTCAGAGCGGCCGG + Intronic
1014280793 6:119441080-119441102 GGACCCGCACTCGGAGCGGCCGG + Intergenic
1014507745 6:122280661-122280683 GGCCCTGCACTCGGAGCAGCTGG + Intergenic
1014718545 6:124892053-124892075 GGCCCCACACTCGGAGCAGTCGG + Intergenic
1014758532 6:125328902-125328924 GGCCCCATACTTGTACCAACAGG + Intergenic
1014921091 6:127214870-127214892 GGCCCTGCACTCAGAGCAGCCGG - Intergenic
1015339269 6:132079286-132079308 GGTCCCACAGTTGCTGCAGCAGG + Intergenic
1015572273 6:134633825-134633847 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1016067389 6:139698195-139698217 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1016069906 6:139726628-139726650 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1016092851 6:139999864-139999886 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1016104749 6:140148401-140148423 GGCCCCTCACTCGGAGCAGCTGG - Intergenic
1016183511 6:141175177-141175199 GGCCCCAGACTCAGCGCAGCTGG + Intergenic
1016217178 6:141618292-141618314 GGCCCGGCACTCGGAGCAGCCGG + Intergenic
1016482337 6:144495429-144495451 GGCCCCGCACTCGGAGCAGCAGG - Intronic
1016738583 6:147506936-147506958 GGCCCCAAACTTGGGTCACCCGG - Intergenic
1016858938 6:148698324-148698346 GGCCCCGCACTTGGAGCAGCCGG - Intergenic
1017298965 6:152834424-152834446 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
1017325068 6:153133702-153133724 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
1017383537 6:153857219-153857241 GGCCCCGCACTCAGAGCAGCTGG - Intergenic
1017537351 6:155363149-155363171 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
1017581242 6:155867035-155867057 GGCCCCGCACTTGGAGCAGCCGG - Intergenic
1017642049 6:156503950-156503972 GGCACCACACTAGGAGCAGCAGG + Intergenic
1017839529 6:158210068-158210090 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1017901740 6:158723965-158723987 GGCCTTCCACCTGGAGCAGCTGG - Intronic
1018000119 6:159571552-159571574 AGCCACTCACTTGGAGCAGAGGG - Intergenic
1018022897 6:159778689-159778711 GGCCACCCTCTTGGAGCATCTGG + Exonic
1018064259 6:160114781-160114803 GACCCCGCACTCAGAGCAGCCGG - Intergenic
1018545657 6:164933379-164933401 AGGCCCGCACTGGGAGCAGCTGG + Intergenic
1018633920 6:165843910-165843932 AAGCCCACACCTGGAGCAGCAGG + Intronic
1018786646 6:167113569-167113591 GGCCCCATTCGTGGAGCCGCTGG - Intergenic
1019171686 6:170136526-170136548 GGCCCCGCACACGCAGCAGCAGG - Intergenic
1019605682 7:1909077-1909099 GTGCCCAGACTCGGAGCAGCGGG + Intronic
1019618371 7:1977396-1977418 GGCCCCACACTCCGAGCAGCTGG - Intronic
1019944289 7:4314218-4314240 GGCCCGGCAGTCGGAGCAGCCGG - Intergenic
1019965772 7:4497210-4497232 GGCCCTGCACTCGGAGCAGCAGG - Intergenic
1020008267 7:4793608-4793630 GGCCCCGCACTCGGAGCCGCCGG + Intronic
1020784456 7:12556438-12556460 GGCCCTGCACTTGGAGCGGCGGG - Intergenic
1021133855 7:16943069-16943091 GGCCCTGCACTCAGAGCAGCTGG + Intergenic
1021513830 7:21461525-21461547 GGCCCTGCACTTGGAGCGGCTGG - Intronic
1021520715 7:21536815-21536837 GGCCCCGCACTCAGAGCGGCTGG - Intergenic
1021567372 7:22028759-22028781 GGTCCCACACTCGGAGCGGCTGG + Intergenic
1021567904 7:22032604-22032626 GGCCCCCCACTCAGAGCCGCCGG - Intergenic
1021686781 7:23194007-23194029 GGCCCCACACTCAGAGCTGCCGG - Intronic
1021761299 7:23904995-23905017 GGCCCCGCACTTGGAGCCGCCGG - Intergenic
1022750417 7:33219054-33219076 GGCCCCGCACTCGGAGCAGCCGG + Intronic
1023127922 7:36973822-36973844 CGGCCCGCACTCGGAGCAGCCGG + Intronic
1023377975 7:39577492-39577514 GGCCCTGCACTTGGAGTGGCCGG + Intronic
1023396222 7:39754219-39754241 GGCCCCGCACTCGGAGCGGCGGG - Intergenic
1024269056 7:47628557-47628579 GGCCCCGCACCCGGAGCAGCCGG + Intergenic
1024443838 7:49453775-49453797 GGCCCCGCACTCGGAGTGGCCGG + Intergenic
1024465887 7:49711333-49711355 GGGCCCGCACTTGGAGCGGCCGG + Intergenic
1024551464 7:50566014-50566036 AGCCCCACGCTTGGAGCTGCTGG - Intergenic
1024691257 7:51805915-51805937 GGCCCCGCACTCGGAGCAGCAGG + Intergenic
1024700656 7:51901175-51901197 GGCCCTGCACTTGGAGCAGCCGG - Intergenic
1024825443 7:53385442-53385464 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1024834025 7:53495101-53495123 GGCCCCGCACTCAGAGCAGCCGG + Intergenic
1025962091 7:66231620-66231642 GGCCCCGCACTCGGAGCAGCTGG - Intronic
1026187109 7:68090694-68090716 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1026415767 7:70179028-70179050 GGCCCCACCTTTGGCTCAGCTGG + Intronic
1026512321 7:71037674-71037696 GGGCCCACATTGAGAGCAGCCGG + Intergenic
1026516546 7:71078069-71078091 CGCCCCACACTGGGAGCAGCAGG + Intergenic
1026596578 7:71738359-71738381 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1026916114 7:74121208-74121230 GGGCCCACAGCTGGAGCAGCTGG + Exonic
1027238029 7:76309717-76309739 GGCCCCGCACTTGGAGCAGCCGG - Intergenic
1027561649 7:79739380-79739402 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
1027564060 7:79768244-79768266 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1027579735 7:79977883-79977905 GGCCCCGCACTCAGAGCTGCCGG - Intergenic
1027667550 7:81057763-81057785 GGCCCTGCACTCGGAGCAGCCGG - Intergenic
1027674451 7:81141818-81141840 GGCCCCACACTCTGAGCGGCCGG + Intergenic
1027698305 7:81437369-81437391 GGCCACGCACTCGGAGCAGCCGG - Intergenic
1027853112 7:83473976-83473998 TGCCTCACCCTTGGAGCAGCTGG - Intronic
1027868078 7:83673398-83673420 GGCCCCGCACTCGGAGCGGCCGG + Intergenic
1028070072 7:86440647-86440669 GGCCCCGCCCCCGGAGCAGCCGG + Intergenic
1028142484 7:87288804-87288826 GGCCCTGCACTGGGAGCGGCAGG + Intergenic
1028303311 7:89229008-89229030 GGCCCCACACTCGGAGCAGCCGG - Intronic
1028455465 7:91033595-91033617 TGGACCACACTTTGAGCAGCAGG + Intronic
1028511240 7:91627673-91627695 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1028558050 7:92143606-92143628 GGCCCCGCACTCGGAGCGGCCGG - Intronic
1028852540 7:95552746-95552768 GGCCCCACACTCGGAGCGGCCGG - Intergenic
1028857189 7:95605486-95605508 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
1029065363 7:97843146-97843168 GGGCCCGCACTCTGAGCAGCCGG - Intergenic
1029076134 7:97936009-97936031 AGCCCCGCACTAGGAGCTGCCGG + Intergenic
1029407073 7:100381808-100381830 GGCCCCGCACTCGGAGTGGCCGG + Intronic
1029567492 7:101348655-101348677 GGCCCTGCACTCGGAGCAGTCGG + Intergenic
1030215739 7:107042598-107042620 GACCCCGCACTCGGAGCGGCCGG - Intergenic
1030367033 7:108657497-108657519 GACCCCGCACTCGGAGCGGCCGG - Intergenic
1030600002 7:111582223-111582245 GGTCCCGCACTCGGAGCAGCCGG - Intergenic
1030733462 7:113017423-113017445 GGCTCCGCACTCGGAGCAGCCGG + Intergenic
1030772244 7:113488425-113488447 GACCCCACACTCGGAGCAGCTGG - Intergenic
1030780394 7:113593399-113593421 GGGCCCGCACTCGGAGCAGCCGG + Intergenic
1030950925 7:115790012-115790034 GGCCCCACACTGGGCGTGGCTGG - Intergenic
1031109955 7:117596225-117596247 GGCCCCGCACTCGGAGCAGCCGG + Intronic
1031378778 7:121060050-121060072 GGCCCTGCACTCGGAGCAGCCGG + Intronic
1031902846 7:127429246-127429268 GGCCCCATACTTGGAGCGGCCGG + Intronic
1032248056 7:130230102-130230124 GGCCCTGCACTCGGAGCAGCCGG + Intergenic
1032437100 7:131909407-131909429 GGCCCCGCACTCGGAGGGGCCGG + Intergenic
1032561625 7:132898887-132898909 GGCCCTGCACTCGGAGCAGCCGG - Intronic
1033312442 7:140271585-140271607 GGCCCCGCACTCGGAGGGGCCGG - Intergenic
1033664123 7:143424677-143424699 GGCCCCGCACTCGGAGCGGCCGG - Intergenic
1033779306 7:144650500-144650522 GGCCCCGCATTTGGAGTGGCCGG + Intronic
1033866655 7:145697649-145697671 GGCCCCGCACTTGGAGCGGCCGG - Intergenic
1034167776 7:149038978-149039000 GGCCCCGCACTCGCAGCAGTCGG - Intergenic
1034490256 7:151389467-151389489 CGCCCCACACTTGGCCCACCAGG + Intronic
1034656062 7:152730556-152730578 GGCCCCGCACTCGGAGCAACCGG - Intergenic
1035463921 7:159063420-159063442 GGCCCCGCACTTGGAGCGGCCGG - Intronic
1035683591 8:1507431-1507453 GGCCCCGCACTTGGAGCGGCCGG - Intronic
1035833897 8:2727915-2727937 GGCGCCCCACTCGGAGCGGCAGG + Intergenic
1035999224 8:4582907-4582929 GGCCCCACACTCGGAGCAGCTGG + Intronic
1036123837 8:6045298-6045320 GACCCAGCACTTGGAGCAGCCGG - Intergenic
1036135045 8:6152787-6152809 GGCGTCCCACTCGGAGCAGCAGG + Intergenic
1036306157 8:7603745-7603767 GGCCCTGCACTAGGAGCTGCCGG - Intergenic
1036441054 8:8781672-8781694 GGCCCCGCACTAGGAGCAGCCGG - Intergenic
1036554669 8:9848036-9848058 GTCCCCGCACTTGGAGCCACCGG - Intergenic
1036837644 8:12088840-12088862 GGCCCCACACTTGAGGCGGCTGG + Intergenic
1036859437 8:12335088-12335110 GGCCCCACACTTGAGGCGGCTGG + Intergenic
1036901569 8:12673532-12673554 GGCCCTGCACTAGGAGCTGCTGG + Intergenic
1036914958 8:12796375-12796397 GGACCCGCACTCGCAGCAGCTGG + Intergenic
1036928670 8:12931585-12931607 GGTCCCGCACTCGGAGCGGCCGG - Intergenic
1036952536 8:13154478-13154500 GGCCCCGCACTCGGAGCAGCTGG - Intronic
1037064994 8:14566906-14566928 GGCCCCACACTCAGAGCGGCCGG + Intronic
1037239522 8:16760790-16760812 CGGCCCACACTGGGAGCAGCTGG - Intergenic
1037263863 8:17037098-17037120 GGCCCCGCAGTCGGAGCAGCCGG - Intronic
1037417595 8:18667964-18667986 GGCCCCACACTTGGAGCGGCCGG - Intronic
1037810953 8:22086634-22086656 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
1037925348 8:22839786-22839808 GGCCCCTCACGTGGAAGAGCTGG - Intronic
1037957575 8:23071066-23071088 GGCCCTGCACTCGGAGCAGCCGG - Intergenic
1037971361 8:23174082-23174104 GGGCCCGCACTCGGAGCAGTCGG - Intergenic
1038638259 8:29304333-29304355 GGCCCCACACTCGGAGCAGCCGG + Intergenic
1038639384 8:29311545-29311567 GGCCCCACACTCGGAGCAGCTGG + Intergenic
1038847616 8:31244386-31244408 GGCCCCGCACTTGGAGCTGCCGG - Intergenic
1039069134 8:33634113-33634135 GGCCCCGCACTGGGAGCAGCCGG - Intergenic
1039349235 8:36743137-36743159 GGCCCCACACTGAGAGCACTTGG - Intergenic
1039637280 8:39180194-39180216 GGCCCCGCACTCGGAGCAGCGGG + Intronic
1039770869 8:40685665-40685687 TGGTGCACACTTGGAGCAGCAGG - Intronic
1039969092 8:42306472-42306494 AGCCCCACAAATGCAGCAGCAGG - Intronic
1040003714 8:42600342-42600364 GGCCCCACACTTGGAGTAGCTGG - Intergenic
1040014434 8:42689573-42689595 GACCCCGCACTGGGAGCGGCCGG + Intergenic
1040026532 8:42786854-42786876 GGCCCCGCACTCGGAGCACCTGG + Intronic
1040027676 8:42796683-42796705 GGCCCCGCACTCAGAGCAGCCGG + Intergenic
1040583434 8:48716266-48716288 GGCCCCGCACTTGGAGCGGCCGG - Intronic
1040952872 8:52953893-52953915 GGCCCTGCACTCGGAGCGGCCGG + Intergenic
1040953986 8:52961473-52961495 GGCCCCGCACTCAGAGCGGCCGG + Intergenic
1040954943 8:52970128-52970150 GGCCCCGCACTAGGAGCAGCTGG - Intergenic
1040964602 8:53071418-53071440 GGCCCTGCACTTGGAGCGGCTGG - Intergenic
1040965593 8:53077908-53077930 GGCCCCACACTTGGAGCAGCTGG - Intergenic
1041034678 8:53776179-53776201 GGCCCCAAACTCGGAGCAGCCGG - Intronic
1041588352 8:59547177-59547199 GGCCCTGCACTTGGAGCGGCTGG + Intergenic
1041830182 8:62144621-62144643 GGCCCCACACATAGCGCTGCCGG + Intergenic
1041914509 8:63126189-63126211 GACCCCGCACTCGGAGCAGCTGG + Intergenic
1042169502 8:65978072-65978094 GGCCCCGCACTTGGAGCCACTGG - Intergenic
1042512587 8:69626752-69626774 GGCCCCACACTCGCAGAGGCCGG - Intronic
1042948776 8:74179797-74179819 GGCCCCGCACTCGGAGCCGCTGG - Intergenic
1043073370 8:75665745-75665767 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1043102241 8:76060687-76060709 TACCCCACACTTGGAGAAGCCGG - Intergenic
1043346440 8:79303574-79303596 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
1043435303 8:80231888-80231910 GGCCCCGCGCTCGGAGCGGCCGG + Intergenic
1043621050 8:82192531-82192553 GGCCCCACACTCGGAGCGGCCGG - Intergenic
1043701107 8:83290432-83290454 GGCCCCGCACTCGGAGCGGCCGG + Intergenic
1043857145 8:85276142-85276164 GGTCCCGCACTCGGAGCGGCGGG + Intronic
1044075803 8:87820914-87820936 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
1044088470 8:87971227-87971249 GGCCCCGCACTCGGAGTGGCTGG + Intergenic
1044459668 8:92429511-92429533 GGCCCCACGCTCGGAGTGGCCGG - Intergenic
1044633496 8:94300614-94300636 GGCCCCGCACTCGGAGAAGCCGG - Intergenic
1044726653 8:95199962-95199984 AGCTGCACACTTGGAGCAGCTGG + Intergenic
1044788662 8:95823718-95823740 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
1044880682 8:96719367-96719389 GGGCCCGCACTTGGAGCAGCCGG - Intronic
1045232344 8:100317055-100317077 GGCCCCGCACTCAGAGTAGCCGG - Intronic
1045281906 8:100756804-100756826 TGGACCACACTTGGAGTAGCAGG - Intergenic
1045306038 8:100957390-100957412 GGGCCCGCACTTGGCGCAGCTGG - Intergenic
1045407406 8:101880279-101880301 GGCCCCGCACTCCGAGCGGCTGG - Intronic
1045467782 8:102485792-102485814 GGCCCCGCACTCGGAGCAGCTGG - Intergenic
1045678430 8:104633165-104633187 GGCCCAGCACTGGGAGCGGCCGG - Intronic
1046030308 8:108775382-108775404 GTCCCCAAACTTGTAGCAGTAGG - Intronic
1046149369 8:110202851-110202873 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1046208911 8:111041118-111041140 GGCCCCGCACTCCGAGCGGCCGG - Intergenic
1046285059 8:112083215-112083237 GGCCCCGCACTGGAAGCAGCCGG - Intergenic
1046288882 8:112132771-112132793 GGCCCCGCACTCAGAGCAGCCGG + Intergenic
1046450694 8:114386236-114386258 GGCCCTGCACCCGGAGCAGCCGG + Intergenic
1046661218 8:116950016-116950038 GGCCCCGCACTCGGAGCCGCCGG - Intergenic
1047631726 8:126714917-126714939 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1048186901 8:132249937-132249959 GGTCCTTCACTTGGAGCGGCCGG - Intronic
1048676982 8:136794071-136794093 GGCCCCGCACTCGGAGCGGCCGG - Intergenic
1048757522 8:137755401-137755423 GGCCCCGCACTGGGAGCAGCCGG - Intergenic
1048789151 8:138084215-138084237 GGCCCCGCACTTGGAGCAGCCGG + Intergenic
1049087660 8:140490795-140490817 GGCCCCACACTCGGAGCAGCCGG - Intergenic
1049231871 8:141488782-141488804 GGCCACACAGTAAGAGCAGCTGG - Intergenic
1049428304 8:142547432-142547454 GGCCCATCACTCCGAGCAGCTGG - Intergenic
1049435874 8:142586029-142586051 GGGGCCACACTTGGAGGAGCTGG + Intergenic
1049500291 8:142959556-142959578 GGCCCCGCACTCGGAGCAGACGG + Intergenic
1049758637 8:144321888-144321910 GTCCCCACACTTGGACGTGCAGG + Intronic
1049857920 8:144875250-144875272 GGCCCCGCGCTCGGAGCTGCTGG + Intergenic
1049944524 9:581040-581062 GGCCCCACACTTGGAGCGGCCGG - Intronic
1050044627 9:1529924-1529946 GGCCACACACTTCCTGCAGCAGG - Intergenic
1050891988 9:10836035-10836057 GCCTCCACACTCGGAGCGGCTGG + Intergenic
1050920600 9:11196958-11196980 GGCCTGGCACTTGGAGCAGCTGG + Intergenic
1051305112 9:15700322-15700344 GGCCCCACACTCAGAGCAGCCGG - Intronic
1051309776 9:15757772-15757794 AGCCCCACAGCTGGAGCAGCTGG - Intronic
1051383283 9:16480588-16480610 GGCCCCACACTTGGAGCAGCAGG + Intronic
1051439838 9:17072685-17072707 GGCCCCACACTTGGAGCAGCAGG + Intergenic
1051449421 9:17178665-17178687 GTCCCCGCACTTGGAGCGGCCGG - Intronic
1051549793 9:18315610-18315632 GGCCCCGCACTCAGAGCGGCCGG - Intergenic
1052075434 9:24135165-24135187 GGGCCCGCACTCAGAGCAGCGGG + Intergenic
1052122773 9:24738607-24738629 GGTCCCACAGTTGGAGCTGCTGG + Intergenic
1052979525 9:34438004-34438026 GGCCCCGCACTCGGAGCAGCCGG + Intronic
1053027307 9:34740517-34740539 GGCCCTGCACTCGGAGCAGCCGG - Intergenic
1053547936 9:39042638-39042660 GGCCCCGCACTGGGAGCAGCCGG - Intergenic
1053812057 9:41862679-41862701 GGCCCCACACTGGGAGCAGCCGG - Intergenic
1054455503 9:65428210-65428232 TGCCCCACACCTGGAGGAGCTGG - Intergenic
1054618538 9:67324760-67324782 GGCCCCACACTGGGAGCAGCCGG + Intergenic
1055461471 9:76523972-76523994 GACCCCGCACTTGGAGGGGCCGG - Intergenic
1055557599 9:77490663-77490685 GGCCCCGCACTCGGAGCGGCCGG - Intronic
1055651353 9:78410077-78410099 GGCCCCGCACTGGGAGTGGCCGG + Intergenic
1055654914 9:78442150-78442172 GGCCCCGCACTGGGAGCGGCTGG + Intergenic
1055814185 9:80185577-80185599 GGCCCTGCACTTGGAGAGGCCGG - Intergenic
1056216252 9:84408559-84408581 GGCCCCATACTCAGAGCCGCCGG + Intergenic
1056305742 9:85289125-85289147 CGCCCCACACTCGGAGCGGCTGG + Intergenic
1057201063 9:93140246-93140268 TGCCCCAGACTTGGAGAAGGAGG - Intergenic
1057262386 9:93592280-93592302 GTCCCCACTGTGGGAGCAGCGGG + Intronic
1057511116 9:95680410-95680432 GGCCCCGCACTAGGAGCAGCTGG + Intergenic
1057726898 9:97574298-97574320 GGCCCCGCACTCGGAGCGGCCGG + Intronic
1058174891 9:101724396-101724418 GGCCCCGCACTCGGAGCAGCGGG - Intronic
1058309490 9:103483792-103483814 GGCCCCACACTGGGAGCGGCTGG + Intergenic
1058727504 9:107817873-107817895 GGCCCCACACTGGGAGCGGCCGG + Intergenic
1058960639 9:109989739-109989761 GGACCCACAGTAGGAGAAGCTGG - Intronic
1060807227 9:126585521-126585543 GGCACCAGACTTGGAGAAGGAGG + Intergenic
1061388408 9:130303751-130303773 GGCCCCACATGAGGGGCAGCAGG - Intronic
1062048830 9:134436939-134436961 GGCCCCAGCCCTGGAGCTGCAGG + Exonic
1062092061 9:134683530-134683552 GGCCACACAGTTTGAGTAGCTGG - Intronic
1062146231 9:134991313-134991335 GGCCCCGCACTCGGAGCAGTCGG - Intergenic
1062524360 9:136972310-136972332 TCCCCCACACCTGGAGCAGTTGG - Intergenic
1203429786 Un_GL000195v1:80444-80466 GACCCCACACTCGGAGCCGCCGG + Intergenic
1186152620 X:6690788-6690810 GGCCCCGCACTTGGAGCGGCCGG - Intergenic
1186282098 X:8003552-8003574 GGCCCCGCTCTCGGAGCGGCCGG - Intergenic
1186293171 X:8121668-8121690 GGCCCCGCACTCGGAGAGGCTGG + Intergenic
1186323275 X:8452772-8452794 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1186926337 X:14336838-14336860 GGCCTCACAATTGGGGCAGAAGG + Intergenic
1187005865 X:15232012-15232034 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1187139025 X:16575532-16575554 GGCCCGGCAGTCGGAGCAGCTGG + Intergenic
1188166974 X:26873941-26873963 GACCCCGCGCTTGGAGCGGCCGG - Intergenic
1188242544 X:27809218-27809240 GGCCCGGCACTCAGAGCAGCTGG + Intronic
1188881794 X:35499356-35499378 GGCCCCGCACTGGGAGCTGCCGG + Intergenic
1189187909 X:39070101-39070123 GGCCCCGCACTCGGTGCGGCAGG - Intergenic
1189416136 X:40815428-40815450 GGCTCCACACTTAGTGGAGCTGG + Intergenic
1189724330 X:43953490-43953512 GTGCCCACACTTTGAGTAGCAGG + Intronic
1190045894 X:47111285-47111307 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1191053926 X:56222833-56222855 GGCCCCGCACTCGGAGCCGCCGG - Intergenic
1191618659 X:63192853-63192875 AGCCCCACACTCGGAGCAGCCGG - Intergenic
1192251382 X:69416847-69416869 CACCCAACACTCGGAGCAGCCGG + Intergenic
1192869681 X:75173879-75173901 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1193538181 X:82738485-82738507 GGCCCCACACACGGAGCAGCCGG - Intergenic
1193804067 X:85972639-85972661 GGCCCCGCACTCGGAGCGGCCGG - Intronic
1194118053 X:89926816-89926838 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1194384361 X:93235810-93235832 GGCCCCACACTCAGAGCAGCGGG + Intergenic
1194890500 X:99372317-99372339 GGCCCAGCACTCGGAGCAGCAGG - Intergenic
1195256296 X:103094193-103094215 GGCCCCACACTCGTAGCAGCCGG + Intergenic
1195259377 X:103117340-103117362 GGCCCCACACTCGGAGCAGCCGG - Intergenic
1195460279 X:105115990-105116012 GGCCCCGCACTCAGAGCTGCTGG - Intronic
1195754979 X:108191446-108191468 CGTACCACAATTGGAGCAGCTGG - Exonic
1196319555 X:114270841-114270863 GGCCCCGCACTGGGAGCAGCCGG - Intergenic
1196582670 X:117394760-117394782 GGCCCCACACTCCGAGCAGCCGG + Intergenic
1196705939 X:118717221-118717243 GGCCCCGCACTACGAGCGGCCGG - Intergenic
1196741499 X:119029593-119029615 GGCCCCGCACTCAGAGCAGCTGG + Intergenic
1196761998 X:119208754-119208776 GGCCCCGCGCTCGGAGCAGCTGG - Intergenic
1196762365 X:119211161-119211183 GGCCCTGCACTCGGAGCAGCCGG - Intergenic
1196775182 X:119331953-119331975 GGCCCTGCACTCGGAGCATCTGG + Intergenic
1196775483 X:119333674-119333696 GGCCCCGCACTCGGAGCAGACGG + Intergenic
1196781486 X:119387866-119387888 GGCCCCGCACTGGGAGCAGCCGG - Intergenic
1196794004 X:119488145-119488167 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1196827301 X:119751110-119751132 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1196845035 X:119890670-119890692 GGCCCCGCACTCGGAGCAGCCGG + Intergenic
1197000313 X:121431810-121431832 GGCCCTGCACTCGGAGCAGCCGG - Intergenic
1197331199 X:125155742-125155764 TGCCCCACACTCGGAGTGGCCGG - Intergenic
1197340028 X:125255726-125255748 GGCCCCACACTCGGAGCAGCCGG + Intergenic
1197376824 X:125690861-125690883 GGCCCCGCACTCTGAGCGGCCGG - Intergenic
1197533794 X:127663251-127663273 GGCCCCACACTCAGAGCGGCCGG - Intergenic
1197607904 X:128606684-128606706 GGCCCCGCACTCGGAGCGGCCGG + Intergenic
1197978737 X:132194165-132194187 GGCCCCACACTCGGAGTGGCTGG + Intergenic
1198299960 X:135325533-135325555 GGCCCCGCACTCGGAGCAGCCGG + Intronic
1198664334 X:139004307-139004329 GGCCCCGCACTCAGAACAGCCGG - Intronic
1198972615 X:142298527-142298549 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1199009965 X:142746005-142746027 GGCCCCGCACTCAGAGCAGCCGG - Intergenic
1199028821 X:142972418-142972440 GGCCCCACACTCGGAGCAGCTGG - Intergenic
1199050251 X:143228972-143228994 GGCCCCTCTCTCAGAGCAGCCGG - Intergenic
1199175517 X:144783711-144783733 GGGCCCACACTCAGAGCAGTCGG + Intergenic
1199356272 X:146867164-146867186 AGGCCCACACTCGGAGCAGCCGG - Intergenic
1199443699 X:147897256-147897278 GGCCCCACACTGGGTGCAGCTGG - Intergenic
1199460442 X:148078022-148078044 GGCCCCAGAGTTGGATTAGCTGG - Intergenic
1199641855 X:149869468-149869490 GGCCACACACTAGGGCCAGCAGG + Intergenic
1199831308 X:151551469-151551491 GGCCCCGCACTCAGAGCAGCCGG - Intergenic
1199831799 X:151555432-151555454 GGCCCTGCACTCGGAGCGGCCGG - Intergenic
1200082806 X:153587500-153587522 GCCCCCACACCTGCAGGAGCCGG + Intergenic
1200470930 Y:3584379-3584401 GGCCCCGCACTCGGAGCAGCCGG - Intergenic
1200748409 Y:6922854-6922876 GGCCCCGCACTTGGCGCAGCTGG - Intronic
1200824320 Y:7622498-7622520 GGCCCCACACTCGGAGCAGCCGG - Intergenic
1200888658 Y:8298696-8298718 GGCCCCGCACTCGGAGCAGGCGG + Intergenic
1201260960 Y:12158653-12158675 GTCCCCACACTTGGAGTGGCTGG - Intergenic
1201285506 Y:12375290-12375312 GGGCCCGCACTCGGAGCAGCCGG - Intergenic
1201424226 Y:13831429-13831451 GGCCCCGAACTCGGAGCAGCCGG + Intergenic
1201488138 Y:14512893-14512915 GGCCCTGCACTCAGAGCAGCCGG + Intergenic
1201495711 Y:14590065-14590087 GGCCCCGCACTCGGAGCAGCCGG - Intronic
1201496957 Y:14598478-14598500 GGCCCCGCACTCGGAGCAGCCGG - Intronic
1201715782 Y:17043185-17043207 GGGCCCGCACTCGGAGCAGTCGG + Intergenic
1201901127 Y:19046844-19046866 GGGCCCGCACTGGGAGCGGCTGG - Intergenic
1201982644 Y:19923998-19924020 GGCCCCACACTCGGAGCAGCCGG - Intergenic
1202090490 Y:21183500-21183522 GGCCCCACACTCGGTGCGGCCGG + Intergenic
1202137120 Y:21676944-21676966 GGCCCCACACTCAGAGCAGCCGG - Intergenic
1202235735 Y:22708589-22708611 GGCCCCACACTCGGAGCAGCCGG + Intergenic
1202242454 Y:22785672-22785694 GGCCCCACACTCAGCGAAGCTGG + Intergenic
1202307428 Y:23487579-23487601 GGCCCCACACTCGGAGCAGCCGG - Intergenic
1202395439 Y:24419421-24419443 GGCCCCACACTCAGCGAAGCTGG + Intergenic
1202475345 Y:25250671-25250693 GGCCCCACACTCAGCGAAGCTGG - Intergenic
1202563377 Y:26183007-26183029 GGCCCCACACTCGGAGCAGCCGG + Intergenic