ID: 1008270511

View in Genome Browser
Species Human (GRCh38)
Location 6:49483706-49483728
Sequence GGTTTAGCAGGCCCCACACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 671
Summary {0: 1, 1: 0, 2: 21, 3: 139, 4: 510}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008270511_1008270513 -10 Left 1008270511 6:49483706-49483728 CCAAGTGTGGGGCCTGCTAAACC 0: 1
1: 0
2: 21
3: 139
4: 510
Right 1008270513 6:49483719-49483741 CTGCTAAACCCACGCCCACCTGG No data
1008270511_1008270522 28 Left 1008270511 6:49483706-49483728 CCAAGTGTGGGGCCTGCTAAACC 0: 1
1: 0
2: 21
3: 139
4: 510
Right 1008270522 6:49483757-49483779 GCAAGCACCGGGCGCAGCCCCGG 0: 2
1: 63
2: 258
3: 487
4: 608
1008270511_1008270519 16 Left 1008270511 6:49483706-49483728 CCAAGTGTGGGGCCTGCTAAACC 0: 1
1: 0
2: 21
3: 139
4: 510
Right 1008270519 6:49483745-49483767 TACAGCTGACCTGCAAGCACCGG No data
1008270511_1008270520 17 Left 1008270511 6:49483706-49483728 CCAAGTGTGGGGCCTGCTAAACC 0: 1
1: 0
2: 21
3: 139
4: 510
Right 1008270520 6:49483746-49483768 ACAGCTGACCTGCAAGCACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008270511 Original CRISPR GGTTTAGCAGGCCCCACACT TGG (reversed) Intronic
901601494 1:10426650-10426672 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
901783324 1:11608827-11608849 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
904326690 1:29731159-29731181 TGTTCTGCAGGCCCCACACCTGG - Intergenic
904371773 1:30052195-30052217 TGTTCTGCAGGCCCCACACCTGG + Intergenic
905742873 1:40387922-40387944 GGCTTGGCGGGCCCCGCACTTGG + Intronic
907412600 1:54293081-54293103 ACTTTAGCAGGCCACAGACTGGG - Intronic
908888571 1:68817790-68817812 GGCTTGGCGGGCCCCGCACTTGG + Intergenic
910034784 1:82777072-82777094 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
910550264 1:88467126-88467148 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
910745890 1:90574639-90574661 GGTCTAGAAGTTCCCACACTTGG + Intergenic
911259619 1:95669918-95669940 GGCTTGGCGGGCCCCACACTCGG - Intergenic
911853928 1:102853845-102853867 GGCTCAGCGGGCCCCGCACTCGG + Intergenic
911950857 1:104172397-104172419 GGCTTGGCAGGCCCTGCACTTGG + Intergenic
912058143 1:105631526-105631548 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
912538777 1:110396628-110396650 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
913178666 1:116298274-116298296 GGCTTGGTAGGCCCCGCACTCGG - Intergenic
914203448 1:145506143-145506165 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
914438461 1:147681057-147681079 GGCTTGGCAGGCCCCACACTCGG - Intergenic
914482570 1:148079297-148079319 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
915104109 1:153521856-153521878 GGCTTGGCGGGCCCCACACTCGG + Intergenic
915260033 1:154670820-154670842 GGCTTGGCGGGCCCCACACTCGG + Intergenic
916582752 1:166123254-166123276 GGTTCAGAAGGCCCCAGGCTGGG + Intronic
916960262 1:169882181-169882203 GGCTTGGCAGGCCCCCCACTTGG + Intronic
917094009 1:171381975-171381997 TGTTCAGCAGGCCCTGCACTTGG - Intergenic
917348884 1:174056663-174056685 GGCTCGGCGGGCCCCACACTCGG - Intergenic
917578568 1:176349561-176349583 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
917933019 1:179837221-179837243 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
918708924 1:187703690-187703712 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
918732312 1:188013574-188013596 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
919201371 1:194358560-194358582 GACTTGGCGGGCCCCACACTCGG - Intergenic
920367991 1:205458018-205458040 GGTTTAGCACCTCTCACACTGGG - Intergenic
920789906 1:209080232-209080254 GGTGCAGCAGGCAACACACTGGG - Intergenic
920882052 1:209889230-209889252 GGCTTCGCGGGCCCCGCACTCGG - Intergenic
921094447 1:211874583-211874605 GGCCTGGCGGGCCCCACACTCGG - Intergenic
921396406 1:214673437-214673459 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
921457937 1:215394704-215394726 GGCTTGGCGGGCCCCGCACTTGG - Intergenic
921897076 1:220412501-220412523 GGCTTGGCGGGCCCCACCCTCGG + Intergenic
921983696 1:221285949-221285971 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
922056811 1:222049816-222049838 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
922417057 1:225431435-225431457 GGCTCGGCAGGCCCCGCACTCGG + Intergenic
922445772 1:225696055-225696077 CTTTTAACAGGCCCCAAACTTGG + Intergenic
922985856 1:229865526-229865548 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
923573791 1:235140354-235140376 GGCTTGGCGGGCCCCGCACTCGG + Intronic
923930096 1:238684921-238684943 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1063322192 10:5060932-5060954 GGCTCAGCAGGCCCTGCACTTGG - Intronic
1063848687 10:10160966-10160988 GTCTTGGTAGGCCCCACACTCGG + Intergenic
1064154820 10:12895305-12895327 GCTTTAGAGGGTCCCACACTTGG + Intergenic
1065284811 10:24177015-24177037 GGCTCAGCAGGCCCCGCACTCGG - Intronic
1065981586 10:30903089-30903111 GGCTTGGCGGGCCCCGCACTGGG - Intronic
1066186284 10:33013361-33013383 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1066234025 10:33468103-33468125 GGCTTGGCGGGCCCCACACTCGG + Intergenic
1066590581 10:36989580-36989602 GGCTTGGCAGGCCCCACACTTGG - Intergenic
1066613622 10:37275615-37275637 GGCTCAGCAGGCCCTGCACTCGG - Intronic
1066648485 10:37634542-37634564 GGCTCAGTAGGCCCCACGCTAGG + Intergenic
1067058826 10:43067469-43067491 GGTGTAGAAAGGCCCACACTGGG - Intergenic
1068820986 10:61377162-61377184 GGCTCGGCAGGCCCCACTCTTGG - Intergenic
1068863150 10:61867714-61867736 GGCTTGGCGGGCCCCAAACTCGG + Intergenic
1068902095 10:62280447-62280469 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1069280859 10:66651754-66651776 GGCTTGGCTGGCCCCGCACTCGG - Intronic
1069766121 10:70861713-70861735 GGCTTGGCGGGCCCCGCACTCGG + Intronic
1070973365 10:80585946-80585968 GGGCTAGGTGGCCCCACACTCGG + Intronic
1071901005 10:90120066-90120088 GGCTTGGCAGGCCCCGCACTCGG - Intergenic
1072341870 10:94459788-94459810 GGCTCGGCAAGCCCCACACTTGG - Intronic
1075255600 10:120923894-120923916 GGCTTGGCGGGCCCCGCACTTGG + Intergenic
1075269398 10:121035630-121035652 GGCTTGGCAGGCCCCGCACTCGG - Intergenic
1075302610 10:121338824-121338846 GGCTTAGCAGGTACCACGCTGGG - Intergenic
1075505025 10:123013794-123013816 GGCTTGGCAGGCCCTGCACTCGG - Intronic
1075637992 10:124043365-124043387 GGTTTAGCAGCCGCCACTGTAGG - Intronic
1076261678 10:129071643-129071665 GGCTTGGCGGGCCCCACACTCGG - Intergenic
1077805744 11:5589949-5589971 GGCTTGGCGGGCCCCGCACTGGG + Intronic
1078891315 11:15560993-15561015 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1079613746 11:22465209-22465231 AGTTTAGCAGGGCCCAAACTTGG + Intergenic
1080195216 11:29600437-29600459 GGCTTGGCTGGCCCCGCACTTGG - Intergenic
1080557712 11:33432034-33432056 GGCTTGGCAGGCCCCGCACTCGG - Intergenic
1080621426 11:33990169-33990191 GGCTTGGCTGGCCCCGCACTCGG + Intergenic
1081106649 11:39078683-39078705 GGCTCAGCAGGCCCCGCACTTGG + Intergenic
1081324482 11:41728374-41728396 GGCTTGGCGGGCCCCACACTTGG - Intergenic
1081329730 11:41788517-41788539 GGCTTGGCAGGCCCCACACTCGG - Intergenic
1081422049 11:42881453-42881475 GGCTTGGCAGGCCCTGCACTCGG + Intergenic
1081428361 11:42949946-42949968 GGCTTGGCAGGCCCCGCACTCGG + Intergenic
1082172933 11:49027617-49027639 GCTTAAGCAGCCCCCACAATTGG + Exonic
1082272098 11:50183342-50183364 GGCTTGGTGGGCCCCACACTCGG + Intergenic
1082698780 11:56402210-56402232 GGCTTGGCGGGCCCCCCACTCGG - Intergenic
1083546093 11:63550275-63550297 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1084107390 11:66988864-66988886 GGCTTGGCGGGCCCCCCACTCGG + Intergenic
1084240710 11:67817907-67817929 GGCTCGGCAGGCCCCGCACTCGG - Intergenic
1084406096 11:68974531-68974553 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1084468898 11:69343715-69343737 GGTTAAGCAGCTCCCACCCTTGG + Intronic
1084840685 11:71843906-71843928 GGCTCAGCAGGCCCCACACTTGG - Intergenic
1085297924 11:75441362-75441384 GCTTTACCAGCCCCGACACTGGG - Intronic
1085447264 11:76609320-76609342 GGCTTGGCAGGCCCGGCACTCGG - Intergenic
1085863106 11:80257632-80257654 GGCTCAGCGGGCCCCCCACTCGG + Intergenic
1085886979 11:80533034-80533056 GGCTCAGGGGGCCCCACACTCGG - Intergenic
1086712965 11:90031222-90031244 GCTTAAGCAGCCCCCACAATTGG + Exonic
1086807995 11:91268826-91268848 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1088570857 11:111222048-111222070 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1089373592 11:117978778-117978800 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1090776743 11:129972111-129972133 GGCTTGGCGGGCCCCACACTCGG - Intronic
1091233471 11:134003153-134003175 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1092101707 12:5889138-5889160 GGCTTGGCAGGCCCCGCACTTGG - Intronic
1092133944 12:6132688-6132710 GGCTCAGCGGGCCCCCCACTCGG + Intergenic
1092350541 12:7752364-7752386 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1092583827 12:9876331-9876353 GGCTTGGCAGGCCCCGCACTCGG - Intergenic
1093189381 12:16057452-16057474 GGTTTGGCGGGCCCCGCACTCGG + Intergenic
1093381547 12:18500216-18500238 GGCTTGGCGGGCCCCGCACTCGG + Intronic
1093527110 12:20115520-20115542 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1093652530 12:21661599-21661621 GGCTTGGCAGGCCCCGCACTCGG + Intronic
1093921646 12:24866146-24866168 GGCTTGGCAGGCCCCACATTCGG + Intronic
1093970192 12:25369436-25369458 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1094338631 12:29386531-29386553 GGCTTGGCAGGCCCCACACTTGG - Intergenic
1094405371 12:30110739-30110761 GGCTTGGCGGGCCCCACACTTGG - Intergenic
1094718215 12:33034222-33034244 GGCTTGGCAGGCCCCACACTCGG - Intergenic
1094722042 12:33075415-33075437 GGCTTGGCCGGCCCCGCACTCGG + Intergenic
1095444977 12:42273993-42274015 GGCTTGGTGGGCCCCACACTCGG - Intronic
1097017946 12:56000434-56000456 GGCTTGGCAGGCCCCGCACACGG - Intronic
1098498784 12:71166500-71166522 GGCTTGGTGGGCCCCACACTCGG - Intronic
1098759222 12:74403016-74403038 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1099478653 12:83140189-83140211 GGCTTGGCAGGCCCTGCACTAGG + Intergenic
1099523951 12:83696577-83696599 GGCTTGGCAGGCCCCACACTTGG - Intergenic
1099716252 12:86296693-86296715 GGCTTGGCGGGCCCCGCACTCGG - Intronic
1099798505 12:87428477-87428499 AGTTTAGCAGGACCCACACTTGG + Intergenic
1100584678 12:95969204-95969226 GGCTTAGCAGGCCCCGCACTCGG + Intergenic
1101021604 12:100559451-100559473 GGCTTGGCGGGCCCCTCACTCGG + Intronic
1102309736 12:111835724-111835746 GGCTTGGCAGTCCCCACACTTGG + Intergenic
1102387256 12:112520180-112520202 GGCTCAGCGGACCCCACACTTGG - Intergenic
1103146168 12:118597466-118597488 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1103373300 12:120435880-120435902 GGTATATGAGGCCCCACACTGGG - Intergenic
1103439253 12:120950631-120950653 GGCTTGGCGGGCCCCACACTCGG - Intergenic
1105477408 13:20740219-20740241 GGCTTGGCAGGCCCCGCACTCGG - Intronic
1105722159 13:23127641-23127663 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1106600566 13:31183299-31183321 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1106617085 13:31339957-31339979 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1106810929 13:33358050-33358072 GGCTTGGCGGGCCCCACACTCGG + Intergenic
1108845647 13:54676640-54676662 GGCTTGGTGGGCCCCACACTTGG + Intergenic
1109124941 13:58505711-58505733 GGCTCAGTGGGCCCCACACTTGG - Intergenic
1109145388 13:58773387-58773409 GGCTCGGCAGACCCCACACTGGG + Intergenic
1109201850 13:59439980-59440002 GGCTTGGCGGGTCCCACACTTGG + Intergenic
1109699684 13:66009455-66009477 GGCTTGGCGGGTCCCACACTCGG + Intergenic
1110024089 13:70512196-70512218 GGCTTGGCAGGCCCCGCATTCGG - Intergenic
1110792416 13:79600449-79600471 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1110862113 13:80355616-80355638 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1110874388 13:80490853-80490875 GGCTTGGCAGGCCCTGCACTGGG - Intergenic
1110887705 13:80658959-80658981 GGCTTGGCAGGCCCCACACTAGG - Intergenic
1110999862 13:82165241-82165263 GGCTTGGCGGGCTCCACACTCGG - Intergenic
1111747667 13:92290958-92290980 GGCTCGGCAGGCCCCACTCTTGG + Intronic
1112533190 13:100224340-100224362 GGCTTGGCAGGCCCCGCACTCGG - Intronic
1112613075 13:100975766-100975788 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1113330201 13:109319347-109319369 GGCTCAGCAGGCCCCACACTCGG - Intergenic
1113371973 13:109732945-109732967 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1113482705 13:110633320-110633342 GGCTTGGCGGGCCCCGCACTCGG - Intronic
1113506619 13:110821229-110821251 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1113538154 13:111084163-111084185 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1113678036 13:112221786-112221808 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1114560329 14:23585173-23585195 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1114593514 14:23891826-23891848 GGCTTGGCGGGCCCCGCACTTGG + Intergenic
1115421371 14:33199030-33199052 GGCTCGGCGGGCCCCACACTTGG - Intronic
1116310989 14:43326674-43326696 GGCTCCGCGGGCCCCACACTTGG + Intergenic
1116325785 14:43533099-43533121 GGCTTGGCGGGCCCCACAGTCGG + Intergenic
1116452339 14:45080506-45080528 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1117727356 14:58687544-58687566 GGCACAGCGGGCCCCACACTTGG - Intergenic
1118215388 14:63803554-63803576 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1119027764 14:71167609-71167631 GGCTTAGCGGGCCCCGCACTCGG + Intergenic
1119300340 14:73566624-73566646 GGCTTGGTGGGCCCCACACTCGG - Intergenic
1119673470 14:76537041-76537063 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1120330960 14:83092454-83092476 GGCTTGGCAGGCCCCGCACTCGG + Intergenic
1120667981 14:87329785-87329807 GTTCTTGCAGGCCACACACTGGG - Intergenic
1120704797 14:87735051-87735073 GGCTTGGCAGGCCCCGCACTCGG - Intergenic
1120844142 14:89111717-89111739 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1120968816 14:90190859-90190881 GGATGAGCAGGCCCCAAACTAGG - Intergenic
1121145361 14:91578039-91578061 GGCTTAGCGGGTCCCGCACTCGG + Intergenic
1122216550 14:100208449-100208471 GGCTTGGCGGGCCCCACACTCGG - Intergenic
1122434961 14:101689150-101689172 GGCTCAGCAGGCCCCGCACTGGG + Intergenic
1122493478 14:102135801-102135823 GGCTTGGCGGGCCCCGCACTTGG - Intronic
1122514516 14:102297755-102297777 GGCTCAGCGGGCCCCGCACTAGG + Intronic
1122535898 14:102462629-102462651 GGTGGAGGACGCCCCACACTGGG - Intronic
1122566236 14:102658611-102658633 GGATTATCAGACCCCTCACTTGG + Intronic
1202913506 14_GL000194v1_random:141402-141424 GGGTGATCAGACCCCACACTAGG + Intergenic
1123799120 15:23802983-23803005 GGCTTGGCGGGCCCCGCACTTGG + Intergenic
1123949152 15:25253484-25253506 GGCTTGGCGGGCCCCACACTCGG - Intergenic
1123999612 15:25744039-25744061 TGTTTATCAGGCCCCTCTCTTGG - Intronic
1124110616 15:26781917-26781939 GGCTCAGCGAGCCCCACACTCGG - Intronic
1125112194 15:36047024-36047046 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1125609681 15:40961687-40961709 GGCTTGGCAGGCCCCGCACTCGG + Intergenic
1126128053 15:45314162-45314184 GGCTTAGCCGGCCCTGCACTCGG + Intergenic
1126165550 15:45651295-45651317 GGCTCAGCAGGCCCCGCACTTGG - Intronic
1126639653 15:50812038-50812060 GGCTCAGCAGGCCCTGCACTCGG + Intergenic
1127768102 15:62207607-62207629 GGCTGGGCAGGCCCCGCACTTGG + Intergenic
1128110826 15:65075094-65075116 GGCTTGGCGGGCCCCGCACTCGG + Intronic
1128598593 15:68975960-68975982 GGCTTGGCGGGCCCCACACTCGG - Intronic
1130132207 15:81153518-81153540 GGTCTTGCAGGCCCCACCATTGG - Intergenic
1130132841 15:81158692-81158714 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1131507769 15:93031897-93031919 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1135225010 16:20648125-20648147 GGGTTATCAGGCCCAACACCAGG - Intronic
1135262144 16:20989931-20989953 GGCTTGGCGGGCCCCGCACTCGG - Intronic
1135280830 16:21152667-21152689 GGCTTGGCGGGCCCCGCACTGGG + Intronic
1135338970 16:21630266-21630288 GGCTCGGCAGGCCCCGCACTTGG - Intronic
1135340060 16:21637653-21637675 GGCTCAGCAGGCCCAGCACTCGG - Intronic
1135751089 16:25059201-25059223 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1136222117 16:28835554-28835576 GGCGGGGCAGGCCCCACACTTGG + Exonic
1137442494 16:48508776-48508798 GGCTTGGCAGGCCCCGCACTTGG + Intergenic
1139051464 16:63129704-63129726 GGCTCGGCGGGCCCCACACTGGG + Intergenic
1139165833 16:64564200-64564222 GGTTTGGCATGGCCCACTCTTGG + Intergenic
1139600282 16:67982346-67982368 GGCTTGGCAAGCCCCGCACTCGG + Intergenic
1141832472 16:86517400-86517422 AATTTAGCTGTCCCCACACTGGG - Intergenic
1142505650 17:361663-361685 GGCTTGGCGGGCCCCGCACTCGG + Intronic
1144467136 17:15505767-15505789 GGCTTGGCGGGCCCCGCACTCGG + Intronic
1144723192 17:17486423-17486445 GGCTTGGCAAGCCCCGCACTCGG + Intronic
1144890342 17:18490736-18490758 GGGTTGGCAGGCCGCACGCTGGG - Exonic
1145094825 17:20016536-20016558 GGCTTGGCGGGCCCCGCACTGGG + Intronic
1145141874 17:20453582-20453604 GGGTTGGCAGGCCGCACGCTGGG + Exonic
1146061731 17:29611456-29611478 GGGTGAGCAGGCCCCACCCCAGG + Intronic
1147373603 17:40011003-40011025 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1147997512 17:44368893-44368915 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1148366199 17:47057573-47057595 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1148683865 17:49489909-49489931 GGTTTAGCATTGCCCACTCTGGG + Intergenic
1150804628 17:68309200-68309222 GGCTTGGCGGGCCCCGCACTCGG - Intronic
1151438525 17:74113606-74113628 GGTTTGGCGGGTCCCGCACTCGG - Intergenic
1151567484 17:74907332-74907354 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1153644077 18:7178956-7178978 GGCTTGGCGGGCCCCACACTCGG - Intergenic
1153832484 18:8935713-8935735 GGCTTGGTGGGCCCCACACTCGG - Intergenic
1154231171 18:12557434-12557456 GGCTTGGCAGGCCCCACATTTGG - Intronic
1154255337 18:12777144-12777166 GGCTTGGCGGGCCCCACACTCGG - Intergenic
1155208072 18:23577921-23577943 GGCTTGGTGGGCCCCACACTCGG - Intronic
1156038648 18:32794645-32794667 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1156460955 18:37321050-37321072 GGTTAACCAGGGCCCACCCTAGG - Intronic
1156657806 18:39309163-39309185 GGATCAGCGGGCCCCACACTCGG + Intergenic
1156863637 18:41865827-41865849 GGCTTGGCGGGCCCCACACTCGG + Intergenic
1157085949 18:44580803-44580825 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1157935199 18:51864660-51864682 GGCTCGGCGGGCCCCACACTCGG - Intergenic
1159109786 18:64043041-64043063 GGCTCAGCAGGCCCTGCACTTGG + Intergenic
1159900367 18:74039403-74039425 GGTTTAGCAGCCTCCTCCCTTGG + Intergenic
1160483344 18:79263296-79263318 GGTTTTGCAGGGCCCACTGTGGG - Intronic
1163181742 19:15608935-15608957 GGCTTGGCGGGCCCCGCACTGGG - Intergenic
1163218824 19:15899753-15899775 GGCTTGGCAGGCCCCGCACTCGG + Intergenic
1164144047 19:22499279-22499301 GGCTTGGCAGGCCCTGCACTCGG - Intronic
1164310439 19:24041384-24041406 GGCTTGGTGGGCCCCACACTCGG + Intronic
1164975772 19:32571658-32571680 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1166036244 19:40170431-40170453 GGCTTGGCGGGCCCCGCACTTGG - Intergenic
1166487033 19:43222222-43222244 GGCTTGGCAGGCCTCGCACTCGG - Intronic
924977498 2:191647-191669 GGCTCGGCGGGCCCCACACTGGG - Intergenic
925330368 2:3053975-3053997 TGTTCAGAAGGCCCCATACTTGG + Intergenic
926087273 2:10028365-10028387 GGCTGAGCAGGCACCACACTGGG - Intergenic
926616655 2:15002825-15002847 GGCTTGGCGGGCCCCGCACTTGG - Intergenic
928433769 2:31240577-31240599 GGTTTAGCAGGACAAACTCTAGG + Intronic
928701559 2:33903802-33903824 GGCTCGGCGGGCCCCACACTCGG - Intergenic
928723136 2:34142817-34142839 GGCTCAGCGGGCCCCACACTTGG - Intergenic
929070036 2:38020582-38020604 GGCTTGGCGGGCCCCACACTGGG + Intronic
929375178 2:41277782-41277804 GGTATAGCATACCACACACTTGG + Intergenic
929379665 2:41335660-41335682 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
929890895 2:45917964-45917986 GGCTTGGCGGGCCCCGCACTCGG - Intronic
930420903 2:51151909-51151931 GGCTTGGCAGGTCCCACACTTGG - Intergenic
930485484 2:52006869-52006891 GGCTTGGCTGGCCCCGCACTCGG + Intergenic
932359540 2:71092777-71092799 GGCTTGGCGGGCCCCACACTCGG - Intergenic
932915278 2:75851371-75851393 ACTTTAGCAGTCCCCACAGTTGG + Intergenic
933487280 2:82938735-82938757 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
933506310 2:83181113-83181135 GAGTTGGCGGGCCCCACACTTGG + Intergenic
934680790 2:96282608-96282630 GGTTTAGCACCACCCACCCTTGG + Intronic
934898471 2:98139073-98139095 GGCTTGGCAGGCCCCGCACTCGG + Intronic
935866415 2:107392350-107392372 GGCTTGGCAGGCCCTGCACTCGG + Intergenic
935872839 2:107469633-107469655 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
935896877 2:107747629-107747651 GGCTTGGCGGGCCCCGCACTTGG - Intergenic
935922533 2:108031634-108031656 GGCTCGGCAGGCCCCGCACTCGG + Intergenic
936346865 2:111681920-111681942 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
938618069 2:133020384-133020406 GGATGAGCAGGACCCAGACTAGG + Intronic
939229734 2:139410410-139410432 GGCTTGGCGGGCCCCACACTCGG + Intergenic
939465106 2:142546131-142546153 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
939738803 2:145881199-145881221 GGCTTGGCGGGCCCCTCACTCGG - Intergenic
939886450 2:147686538-147686560 GGCTTGGCAGGCCCTGCACTGGG - Intergenic
940666729 2:156618348-156618370 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
941397954 2:164995045-164995067 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
941779013 2:169424832-169424854 TGTTTAGCAGTCCTCTCACTAGG - Intergenic
941928090 2:170915660-170915682 GGCTCGGCAGTCCCCACACTCGG - Intergenic
942867265 2:180691457-180691479 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
943134415 2:183892604-183892626 GGCTTGCCGGGCCCCACACTTGG + Intergenic
943166093 2:184327943-184327965 GGCTCAGCAGGCCCCGCACTCGG - Intergenic
943443268 2:187951784-187951806 GGCTCAGCAGGCCCTGCACTTGG + Intergenic
943520641 2:188944715-188944737 GGCTCAGCATGCCCCGCACTCGG - Intergenic
943680372 2:190761254-190761276 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
943835139 2:192508038-192508060 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
944440420 2:199737704-199737726 CACTTAGAAGGCCCCACACTTGG + Intergenic
944728576 2:202496980-202497002 GGCTTGGCGGGCCCCGCACTCGG + Intronic
944729620 2:202503453-202503475 GGCTTGGCGGGCCCCGCACTCGG + Intronic
945069626 2:205977300-205977322 GGCTCGGCAAGCCCCACACTGGG + Intergenic
945869129 2:215207943-215207965 GGCTCAGCGGGCCCCGCACTCGG + Intergenic
945872848 2:215246019-215246041 GGCTTGGCGGGTCCCACACTCGG - Intergenic
946982191 2:225229739-225229761 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
947411971 2:229850788-229850810 GGCTTGGCGGGCCCCACACTCGG + Intronic
947932080 2:233972758-233972780 GGCTTGGCGGGCCCCGCACTGGG - Intronic
948449137 2:238058148-238058170 GGCTTGGCGGGCCCCGCACTCGG - Intronic
1169630254 20:7622736-7622758 GGCTTGGCAGGCCCTGCACTTGG - Intergenic
1169849173 20:10031751-10031773 GGCTTGGCGGGCCCCGCACTCGG + Intronic
1170649482 20:18226835-18226857 GGCTTGGCGGGCCCCGCACTTGG + Intergenic
1170989862 20:21291941-21291963 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1171973450 20:31578851-31578873 GGCTTGGCGGGCCCCGCACTTGG - Intergenic
1172431881 20:34899093-34899115 GGCTTGGCAGGCCCCGCACTCGG - Intronic
1173195547 20:40910760-40910782 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1173195664 20:40911253-40911275 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1173601574 20:44299203-44299225 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1173778743 20:45735967-45735989 GGCTCAGCAGGCCCTGCACTTGG + Intergenic
1173831488 20:46091921-46091943 GGCCTGGCGGGCCCCACACTCGG + Intergenic
1175210044 20:57348466-57348488 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1175254130 20:57628864-57628886 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1175457423 20:59125988-59126010 AGTTCAGCAGGAGCCACACTTGG + Intergenic
1175909968 20:62400461-62400483 GGATGGGCAGGGCCCACACTGGG + Intronic
1176671021 21:9735608-9735630 GGCTAGGCAGGCCCCACACTCGG + Intergenic
1177496909 21:21902487-21902509 GGTTTGGCGGGCCCCGCACTCGG + Intergenic
1177565850 21:22819130-22819152 GGCTTGGCGGGCCCCACACTCGG - Intergenic
1177580980 21:23021621-23021643 GGCTTGGCGGGCCCCGCACTGGG - Intergenic
1178398720 21:32265401-32265423 GGCTTAGTGGGCCCCGCACTTGG + Intergenic
1178983372 21:37283476-37283498 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1179627505 21:42657067-42657089 TGTTCATCAGGCCCCACACGGGG - Intronic
1180373761 22:12071582-12071604 GGTTGATCAGACCCAACACTAGG - Intergenic
1180741068 22:18053647-18053669 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1181077683 22:20392647-20392669 GGCTCAGCGGGCCCCGCACTCGG - Intergenic
1181439648 22:22929124-22929146 GGCTTTGCAGGCCCCACAGGAGG - Intergenic
1182301568 22:29340093-29340115 GGTTTAGGCGCCCCCACACATGG + Intronic
1185326759 22:50229470-50229492 CGTGTAGCAGGTCCCATACTCGG + Exonic
950204873 3:11071513-11071535 AGCTTGGCAGGCCCCGCACTCGG - Intergenic
950256983 3:11513533-11513555 GGCTTGGCAGGCCCCGCACTGGG - Intronic
950401032 3:12769150-12769172 GGCTTGGTAGGCCCCGCACTTGG - Intronic
950408917 3:12821695-12821717 TGTGTATCAGGCACCACACTAGG + Intronic
950418540 3:12882961-12882983 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
950632621 3:14293277-14293299 GGCTCGGCAGGCCCCGCACTCGG + Intergenic
952058114 3:29473792-29473814 GGCTTGGTGGGCCCCACACTTGG - Intronic
952355367 3:32578824-32578846 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
952393689 3:32902864-32902886 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
952453675 3:33453519-33453541 GGCTTGGCGGGCCCCAGACTCGG + Intergenic
952730618 3:36633977-36633999 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
954897070 3:53984768-53984790 GATGTAGCAGGCACCATACTGGG - Intergenic
955100088 3:55840184-55840206 AGTAAAGCAGTCCCCACACTAGG + Intronic
955449463 3:59050928-59050950 GACTTGGCAGGCCCCGCACTCGG + Intergenic
956481439 3:69677523-69677545 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
956855238 3:73269263-73269285 GGCTTGGCAGGCCTCGCACTCGG + Intergenic
957419691 3:79951661-79951683 GGCTTGGCGGGCCCCACACTCGG - Intergenic
957556319 3:81767677-81767699 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
957630926 3:82715400-82715422 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
958810772 3:98858214-98858236 GGCTCGGCAGGCCCCACACTCGG - Intronic
959323319 3:104906207-104906229 GGCTCAGCAGGCCCCACATTCGG + Intergenic
960149827 3:114238580-114238602 GGCTTGGCGGGCCCCACACTCGG - Intergenic
961298213 3:125904003-125904025 GGCTCGGCAGGCCCCACACTCGG + Intergenic
961460442 3:127046747-127046769 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
961461978 3:127056397-127056419 GGCTTGGCAGGCCCCGCACTTGG - Intergenic
961688776 3:128653465-128653487 GGCTTGGCGGGCCCCGCACTCGG + Intronic
961700816 3:128743212-128743234 GGCTTGGAGGGCCCCACACTCGG - Intronic
962758230 3:138484719-138484741 GGCTTGGCGGGCCCCACACTCGG + Intergenic
963397190 3:144749882-144749904 GGCTTGGCGGGCCCCGCACTGGG + Intergenic
963509172 3:146225722-146225744 GGCTTGGCGGGCCCCACACTCGG - Intronic
963743024 3:149098140-149098162 GGCTTGGCAGACCCCGCACTTGG - Intergenic
963744141 3:149109458-149109480 GGCTCGGCGGGCCCCACACTCGG + Intergenic
963862146 3:150323038-150323060 GGCTTGGCCGGCCCCGCACTCGG + Intergenic
963866842 3:150370515-150370537 TTTTTACCAGGCCCCACCCTTGG + Intergenic
964037521 3:152217373-152217395 GGCTTGGCGGGCCCCACACTCGG + Intergenic
964452162 3:156822967-156822989 GGCTTGGCAGGCCCCGCACTCGG - Intergenic
964982525 3:162703214-162703236 GGCTCAGCGGGCCCCACACTCGG - Intergenic
965288019 3:166842882-166842904 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
965652337 3:170947293-170947315 GGCTTGGCAGGCCCCACACTTGG + Intergenic
965837348 3:172866851-172866873 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
968181619 3:196599327-196599349 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
968716143 4:2161340-2161362 GGCTTGGCAGGCCCTGCACTCGG + Intronic
969781782 4:9409899-9409921 GGCTCAGCGGGCCCCACACTTGG - Intergenic
970649349 4:18159559-18159581 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
970673188 4:18418628-18418650 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
970803504 4:20004082-20004104 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
971043370 4:22778885-22778907 GGCTCAGCAGGCCCCACACTCGG - Intergenic
971085852 4:23274217-23274239 GGTTTAGCAAGCCCTCCATTGGG - Intergenic
971281701 4:25246905-25246927 GGCTGGGCAGGCCCCACACTGGG - Intronic
971553057 4:27978625-27978647 GGCTTGGTGGGCCCCACACTCGG - Intergenic
971618742 4:28828066-28828088 GGCTCAGCAGACCCCACACTCGG + Intergenic
971709440 4:30092778-30092800 GGCTTGGCGGGCCCCACACTCGG + Intergenic
971905215 4:32716515-32716537 GGCTTGGCGGGCCCCTCACTCGG - Intergenic
972022804 4:34335931-34335953 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
972778594 4:42266010-42266032 GGCTCAGTGGGCCCCACACTGGG + Intergenic
972913284 4:43846240-43846262 GGCTCAGCGGGCCCCGCACTTGG + Intergenic
973037080 4:45420233-45420255 GGCTTGGCAGGCCCCACACTCGG + Intergenic
973142072 4:46781749-46781771 GGCTCAGCAGGCCCCACCCTTGG + Intronic
973190334 4:47378344-47378366 GGCTTGGCAAGCCCCGCACTTGG - Intronic
974641762 4:64640763-64640785 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
974781767 4:66561771-66561793 GACTTGGCAGGCCCCGCACTGGG - Intergenic
974792789 4:66712703-66712725 GGCTTGGCAGGCCCCACACGCGG - Intergenic
974804363 4:66860239-66860261 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
974827735 4:67151950-67151972 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
974839361 4:67283110-67283132 GGCTTGGTGGGCCCCACACTTGG - Intergenic
975348046 4:73316318-73316340 TGCTTAGAAGGCCCCACACTTGG + Intergenic
975596387 4:76050947-76050969 GGCTTGGCGGGCCCCGCACTCGG - Intronic
975744936 4:77466456-77466478 GGCTCGGCAGGCCCCACACTTGG + Intergenic
976646885 4:87396236-87396258 GGCTTGGTGGGCCCCACACTCGG - Intergenic
976846054 4:89490127-89490149 GGCTCGGCAGGCCCCACACTTGG + Intergenic
977416647 4:96742589-96742611 GGCTTGGCGGGCTCCACACTTGG + Intergenic
977750985 4:100609055-100609077 GGCTTGGCGGGCCCCGCACTCGG - Intronic
978999594 4:115200484-115200506 GGCTTGGCAGGCTCCACACTCGG - Intergenic
979290838 4:118977339-118977361 GGGTTGGCAGGCCCCGCACTCGG - Intronic
979308299 4:119173856-119173878 GGCTTGGCGGGCCCCGCACTCGG + Intronic
979899730 4:126201580-126201602 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
980043402 4:127964527-127964549 GGCTTGGCGGGCCCCGCACTGGG - Intronic
980051954 4:128047848-128047870 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
980227959 4:130012851-130012873 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
982024332 4:151236303-151236325 GGTTCCGCGGGCCCCGCACTTGG + Intronic
982768916 4:159378168-159378190 GGCTTGGCAGGCCCCACACTTGG + Intergenic
982770124 4:159390029-159390051 GGCTCAGCGGGCCCCACACTCGG + Intergenic
982868831 4:160550407-160550429 GGCTTGGCAGGCCCCGCACTCGG - Intergenic
982985741 4:162203658-162203680 GGCTTGGCGGGCCCCGCACTGGG + Intergenic
983026078 4:162739611-162739633 GGCTTAGCGGGCCCCGCACTCGG + Intergenic
983230679 4:165126227-165126249 GGCTTGGCAGGCCCTGCACTCGG - Intronic
983752824 4:171298345-171298367 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
984662230 4:182386631-182386653 GGCTTGGCGGGCCCCGCACTCGG + Intronic
984948743 4:184990378-184990400 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
985145414 4:186890185-186890207 GGCTCAGCGGGCCTCACACTGGG + Intergenic
985195195 4:187421238-187421260 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
985324688 4:188754569-188754591 GGCTCAGTAGGCCCCACACTTGG + Intergenic
985403621 4:189615507-189615529 GGCTAGGCAGGCCCCACACTCGG - Intergenic
986626143 5:9725379-9725401 GGCTTGGCAGGCCCCGCACTTGG + Intergenic
986919009 5:12661977-12661999 GGCTTGGCAGGCCCTGCACTTGG + Intergenic
987384033 5:17312062-17312084 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
987476719 5:18399962-18399984 GGCTTGGCCGGCCCCGCACTCGG - Intergenic
987876930 5:23691195-23691217 GGTTTGGTGGGCCCCGCACTCGG + Intergenic
988020541 5:25614845-25614867 GGCTCAGCAGGCCCCGCACTTGG - Intergenic
988035598 5:25823608-25823630 GGCTCAGCGGGCCCCACACTCGG - Intergenic
988369222 5:30345799-30345821 GGCTTGGCGGGCCCCGCACTAGG + Intergenic
988684755 5:33515676-33515698 GGCTTGGCGGGCCCCACACTCGG - Intergenic
988883567 5:35531697-35531719 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
989346778 5:40438730-40438752 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
989757640 5:44975083-44975105 GGCTCAGCAAGCCCCACACTCGG + Intergenic
989957910 5:50376903-50376925 GGCTTGGCGGGCCCCACACTCGG + Intergenic
989965809 5:50465085-50465107 GGCTTGGCAGGCCCTGCACTCGG + Intergenic
990243240 5:53837042-53837064 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
992296721 5:75333756-75333778 GGCTTGGCGGGCCCCACACTCGG + Intergenic
993320953 5:86466970-86466992 GGCTCAGCGGGCCCCGCACTCGG - Intergenic
993328600 5:86569813-86569835 GGCTTGGCAGGCCCCGCACTCGG - Intergenic
993770264 5:91917348-91917370 GGCTTGGCAGGCCCCGCACAGGG + Intergenic
994229946 5:97301219-97301241 GGTTTGGCGGGCCCTGCACTTGG + Intergenic
994605621 5:101962735-101962757 GGCTTGGCGGGCCCCGCACTGGG - Intergenic
994620321 5:102155011-102155033 GGCTTGGCGGGCCCCGCACTGGG + Intergenic
994701718 5:103142320-103142342 GGCTTGGCGGGCCCCGCACTCGG - Intronic
994841372 5:104929074-104929096 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
995529113 5:113075106-113075128 GGCTCACCAGGCCCCGCACTTGG + Intronic
995568658 5:113457215-113457237 GGCTTGGCGGGCCCCACACTCGG + Intronic
995679889 5:114704578-114704600 GGCTTGGCGGGCCCCGCACTGGG - Intergenic
995920378 5:117304732-117304754 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
995975790 5:118033850-118033872 GGCTTAGCGGGCCCCGCACTCGG + Intergenic
996234203 5:121107248-121107270 GGCTTGGCAGGCCCTGCACTCGG + Intergenic
996298577 5:121954241-121954263 GGTTTGGCGGGCCTCACACTTGG - Intergenic
996306405 5:122053081-122053103 GCTTAGGCAGGCCCCACAGTTGG + Intronic
996435671 5:123430618-123430640 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
996478713 5:123949477-123949499 GGCTTGGCAGGCCCCGCACTCGG - Intergenic
996681169 5:126229174-126229196 GGCTTGGCAGGCCCCACACTTGG + Intergenic
997158216 5:131580323-131580345 GGCTTGGTGGGCCCCACACTCGG - Intronic
997760539 5:136444284-136444306 GGCTTGGTGGGCCCCACACTCGG + Intergenic
1000066014 5:157693909-157693931 GGCTTGGCAGGCCCCTCACTGGG + Intergenic
1000547591 5:162621914-162621936 GGCTTGGCAGGCCCCACACTCGG + Intergenic
1000889333 5:166784787-166784809 GGCTCAGCAGGCCCGGCACTCGG - Intergenic
1000891839 5:166810485-166810507 GGCTTGGTAGGCCCCACATTCGG - Intergenic
1002789397 6:426490-426512 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1002907044 6:1457260-1457282 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1003070203 6:2939701-2939723 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1003170867 6:3721054-3721076 GGCTTGGCGGGCCCCGCACTGGG - Intergenic
1003501338 6:6705445-6705467 TGCTTAGAAGGACCCACACTTGG + Intergenic
1003508856 6:6762769-6762791 GGTTTGGCGGGCCCCGCACTTGG - Intergenic
1003578309 6:7317023-7317045 GGCTTGGCGGGCCCCGCACTCGG - Intronic
1003736878 6:8887238-8887260 GGTTTGGTGGGCCCCGCACTCGG + Intergenic
1003747991 6:9024349-9024371 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1003749561 6:9040830-9040852 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1003770177 6:9290725-9290747 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1003901572 6:10659957-10659979 GGCTTGGCTGGCCCCGCACTCGG + Intergenic
1003908109 6:10720665-10720687 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1003947261 6:11087288-11087310 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1003982487 6:11402871-11402893 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1004036946 6:11933152-11933174 GTCTTGGCGGGCCCCACACTCGG + Intergenic
1004053172 6:12108679-12108701 GGCTTGGCGGGCCCCGCACTCGG - Intronic
1004196604 6:13511319-13511341 GGCTCAGCGGGCCCCGCACTTGG - Intergenic
1004200245 6:13541612-13541634 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1004217566 6:13716822-13716844 GGCTCAGCAGGCCCCGCACTCGG + Intergenic
1004235560 6:13872211-13872233 GGCTTGGCGGGCCCCGCACTGGG - Intergenic
1004354051 6:14916054-14916076 GGCTCGGCAGGCCCCGCACTCGG + Intergenic
1004452407 6:15759047-15759069 GGCTTGGCAGGCCCCGCACTCGG - Intergenic
1004501871 6:16216893-16216915 GGCTCGGCAGGCCCCTCACTCGG + Intergenic
1004511628 6:16288325-16288347 GGCTTGGCAGGCCCTGCACTCGG + Intronic
1004607388 6:17206727-17206749 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1004665545 6:17745596-17745618 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1004694371 6:18020092-18020114 GGTTTGGCAGGCCCCGCAGTTGG + Intergenic
1004912612 6:20301324-20301346 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1005332899 6:24766225-24766247 GGCTTGGTGGGCCCCACACTCGG - Intergenic
1005561425 6:27045357-27045379 GGCTCGGCAGGCCCCGCACTTGG + Intergenic
1005707465 6:28469642-28469664 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1005712002 6:28511910-28511932 GGCTCAGCGGGCCCCGCACTCGG + Intronic
1005766296 6:29015166-29015188 GGTTCCGGGGGCCCCACACTCGG + Intergenic
1005978259 6:30816587-30816609 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1006033618 6:31195532-31195554 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1006227086 6:32548213-32548235 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1006351121 6:33521788-33521810 GGCTCGGCAGACCCCACACTCGG - Intergenic
1006978384 6:38124608-38124630 GGCTTGGCGGGCCCCACACTCGG - Intronic
1007500826 6:42295484-42295506 GGTTTAGAAAGCCCCACAGATGG - Intronic
1008038762 6:46774670-46774692 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1008230880 6:48984015-48984037 GCGATTGCAGGCCCCACACTCGG + Intergenic
1008236487 6:49057697-49057719 GGGGTTGGAGGCCCCACACTGGG - Intergenic
1008270207 6:49482113-49482135 GGCTTGGCAGGCCCCACACTCGG - Intronic
1008270511 6:49483706-49483728 GGTTTAGCAGGCCCCACACTTGG - Intronic
1008284365 6:49629838-49629860 GGCTTGGCGGGCCCCGCACTCGG - Intronic
1008770978 6:54979307-54979329 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1009587635 6:65627613-65627635 GGTCTTGGCGGCCCCACACTCGG + Intronic
1009664342 6:66655655-66655677 GACTCCGCAGGCCCCACACTCGG - Intergenic
1010235670 6:73572825-73572847 GACTTGGCAGGCCCCGCACTCGG - Intergenic
1010270352 6:73910059-73910081 GGCTCAGCGGGCCCCACACTGGG + Intergenic
1011601594 6:89065095-89065117 GGTTTGGTGGGCCCCGCACTTGG + Intergenic
1013853357 6:114541972-114541994 GGCTCCGCAGGCCCCTCACTTGG - Intergenic
1014718544 6:124892044-124892066 GGCTTGGCAGGCCCCACACTCGG + Intergenic
1014738978 6:125125924-125125946 GGCTTGGCAGGCCCTGCACTCGG + Intronic
1015135077 6:129859619-129859641 AGTTTAGCAGTCCTCATACTTGG + Intronic
1015572274 6:134633834-134633856 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1015600327 6:134904802-134904824 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1016067390 6:139698204-139698226 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1016069907 6:139726637-139726659 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1016482338 6:144495438-144495460 GGCTTGGCGGGCCCCGCACTCGG - Intronic
1016858939 6:148698333-148698355 GGCTTTGTAGGCCCCGCACTTGG - Intergenic
1017298964 6:152834415-152834437 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1017325067 6:153133693-153133715 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1017537350 6:155363140-155363162 GGCTTGGCAGGCCCCGCACTCGG + Intergenic
1017581243 6:155867044-155867066 GGCTTGGCGGGCCCCGCACTTGG - Intergenic
1017839530 6:158210077-158210099 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1018434254 6:163746935-163746957 GGGTTGGAAGCCCCCACACTGGG + Intergenic
1018624666 6:165765575-165765597 GGCTTGGCGGGCCCCGCACTCGG - Intronic
1019086208 6:169480107-169480129 GGCTCAGCGGGTCCCACACTTGG + Intronic
1019367568 7:642814-642836 GGTTTATCAGGCAGCACACTCGG + Intronic
1019965773 7:4497219-4497241 GGTTTGGCGGGCCCTGCACTCGG - Intergenic
1020375366 7:7478833-7478855 GGCTTGGCGGGCCCCGCACTTGG - Intronic
1020552294 7:9621735-9621757 GGTTCGACAGGCCCCGCACTCGG - Intergenic
1021324104 7:19245555-19245577 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1022236732 7:28468529-28468551 GGTTGAGCAGGCACCAGAGTGGG + Intronic
1022558580 7:31325680-31325702 GGTTTATCAGACACCACACTAGG - Intergenic
1022750416 7:33219045-33219067 GGCTTGGCGGGCCCCGCACTCGG + Intronic
1022785680 7:33634819-33634841 GGATGAGTAGGCCCCACAGTGGG + Intergenic
1023049187 7:36236346-36236368 GGCTTGGCAAGCCCCGCACTAGG + Intronic
1023377973 7:39577483-39577505 GGCTTGGCAGGCCCTGCACTTGG + Intronic
1023396225 7:39754228-39754250 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1023689197 7:42768596-42768618 GGCTCAGAAGGGCCCACACTTGG + Intergenic
1024691256 7:51805906-51805928 GGCTTGGCAGGCCCCGCACTCGG + Intergenic
1024825444 7:53385451-53385473 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1025173483 7:56782628-56782650 GGTTTTGCAGGGCCCACGGTGGG + Intergenic
1025917555 7:65877882-65877904 GGTTCTGCAGGGCCCACAGTGGG - Intronic
1026187111 7:68090703-68090725 GGCTTGGCCGGCCCCGCACTCGG - Intergenic
1026596579 7:71738368-71738390 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1027238030 7:76309726-76309748 GGCTTGGCGGGCCCCGCACTTGG - Intergenic
1027561648 7:79739371-79739393 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1027564061 7:79768253-79768275 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1027868076 7:83673389-83673411 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1028303313 7:89229017-89229039 GGCTCCGCGGGCCCCACACTCGG - Intronic
1028511241 7:91627682-91627704 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1028852542 7:95552755-95552777 GGCTTGGCGGGCCCCACACTCGG - Intergenic
1029407071 7:100381799-100381821 GGCTTGGCGGGCCCCGCACTCGG + Intronic
1030772245 7:113488434-113488456 GGCTTTGCAGACCCCACACTCGG - Intergenic
1030819334 7:114077132-114077154 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1030836003 7:114286591-114286613 ACATTAGCAGGCCCCACTCTTGG - Intronic
1031109954 7:117596216-117596238 GGCTGGGCAGGCCCCGCACTCGG + Intronic
1031409191 7:121421801-121421823 GGCTTGGCGGGCACCACACTTGG + Intergenic
1031513330 7:122674118-122674140 GGCTCAGTGGGCCCCACACTTGG - Intronic
1031741404 7:125436250-125436272 GGCATTGCAGGGCCCACACTGGG - Intergenic
1031902844 7:127429237-127429259 GGCTCAGCAGGCCCCATACTTGG + Intronic
1033664125 7:143424686-143424708 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1033758618 7:144418187-144418209 GGCTCGGCGGGCCCCACACTCGG - Intergenic
1034100376 7:148445514-148445536 GGCTCGGCAGGCCCCACACTCGG - Intergenic
1034713667 7:153219477-153219499 GGTTTAGCAGGCACCACAACAGG + Intergenic
1035325398 7:158062642-158062664 GGCTCGGCAGGCCCCACACTCGG + Intronic
1035636097 8:1145386-1145408 GGTCTCCCAGGCCCCACGCTGGG - Intergenic
1035999223 8:4582898-4582920 GGCTTGGCTGGCCCCACACTCGG + Intronic
1036441055 8:8781681-8781703 GGCTTGGCGGGCCCCGCACTAGG - Intergenic
1036952537 8:13154487-13154509 GGCTCGGCAGGCCCCGCACTCGG - Intronic
1037263864 8:17037107-17037129 GGCTTGGCAGGCCCCGCAGTCGG - Intronic
1037417598 8:18667973-18667995 GCTTCCGCGGGCCCCACACTTGG - Intronic
1037479111 8:19287655-19287677 GGATTGCCAGGCCCCACAGTAGG + Intergenic
1037558937 8:20054862-20054884 GGCTCAGCAGGCCCTGCACTGGG + Intergenic
1037810952 8:22086625-22086647 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1038638258 8:29304324-29304346 GGCTTGGTGGGCCCCACACTCGG + Intergenic
1038639383 8:29311536-29311558 GGCTTGGCGGGCCCCACACTCGG + Intergenic
1039069135 8:33634122-33634144 GGCTTGGCGGGCCCCGCACTGGG - Intergenic
1039284845 8:36028897-36028919 GTCTTGGCGGGCCCCACACTTGG + Intergenic
1039637278 8:39180185-39180207 GGCTTGGCGGGCCCCGCACTCGG + Intronic
1040003715 8:42600351-42600373 GGCTCAGCGGGCCCCACACTTGG - Intergenic
1040583436 8:48716275-48716297 GGCTCGGCAGGCCCCGCACTTGG - Intronic
1040952724 8:52953146-52953168 GGCTTGGCAGGCCCCGCACTCGG - Intergenic
1040952870 8:52953884-52953906 GGCTTGGCAGGCCCTGCACTCGG + Intergenic
1040965594 8:53077917-53077939 GGCTTGGCGGGCCCCACACTTGG - Intergenic
1041034679 8:53776188-53776210 GGCTTGGCGGGCCCCAAACTCGG - Intronic
1041918910 8:63162060-63162082 GGCTTGGTAGGCCCCGCACTTGG + Intergenic
1043034433 8:75178689-75178711 GGCTTGGTGGGCCCCACACTCGG - Intergenic
1043102242 8:76060696-76060718 GGCTTGGCATACCCCACACTTGG - Intergenic
1043129961 8:76447903-76447925 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1043346439 8:79303565-79303587 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1043352510 8:79377494-79377516 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1043701105 8:83290423-83290445 CGCTTGGCAGGCCCCGCACTCGG + Intergenic
1044075802 8:87820905-87820927 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1044633497 8:94300623-94300645 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1044788661 8:95823709-95823731 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1045467783 8:102485801-102485823 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1046149370 8:110202860-110202882 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1046265412 8:111823572-111823594 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1046445315 8:114311422-114311444 GGCTTGGCGGGCCCCGCACTGGG + Intergenic
1046497753 8:115036779-115036801 GGCTTGGCCGGCCCCACACTGGG + Intergenic
1047515976 8:125555104-125555126 GCTTAGACAGGCCCCACACTTGG - Intergenic
1047631727 8:126714926-126714948 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1048676984 8:136794080-136794102 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1048757523 8:137755410-137755432 GGCTTGGCAGGCCCCGCACTGGG - Intergenic
1048789150 8:138084206-138084228 GGCTTGGCGGGCCCCGCACTTGG + Intergenic
1049087661 8:140490804-140490826 GGCTTGGCGGGCCCCACACTCGG - Intergenic
1049857919 8:144875241-144875263 GGCTCAGCAGGCCCCGCGCTCGG + Intergenic
1049944526 9:581049-581071 GGCTCGGCGGGCCCCACACTTGG - Intronic
1050294889 9:4195368-4195390 GGCTTGGCCGGCCCCACACTCGG + Intronic
1051314213 9:15810693-15810715 GGCTCGGCAGGCCCCGCACTCGG - Intronic
1051383282 9:16480579-16480601 GGCTTGGCGGGCCCCACACTTGG + Intronic
1051439837 9:17072676-17072698 GGCTTGGCAGGCCCCACACTTGG + Intergenic
1052577755 9:30312008-30312030 GGGCTTGGAGGCCCCACACTGGG - Intergenic
1052979524 9:34437995-34438017 GGCTTGGCGGGCCCCGCACTCGG + Intronic
1053386426 9:37694155-37694177 GGTTTTGCAGACCCCACTGTGGG - Intronic
1053547937 9:39042647-39042669 GGCTTGGCGGGCCCCGCACTGGG - Intergenic
1053812058 9:41862688-41862710 GGCTTGGCGGGCCCCACACTGGG - Intergenic
1054618537 9:67324751-67324773 GGCTTGGCGGGCCCCACACTGGG + Intergenic
1054722426 9:68617094-68617116 GGCTTGGCGGGCCCCACACTCGG + Intergenic
1054815218 9:69468002-69468024 GGGTTGGCAGGCCCCACCCCAGG - Intronic
1055102588 9:72480491-72480513 GGCTCGGCAGGCCCCACACTGGG - Intergenic
1055557601 9:77490672-77490694 GGCTTGGCAGGCCCCGCACTCGG - Intronic
1055561150 9:77522888-77522910 GTTTTTGCAGGTCCTACACTTGG - Intronic
1055651351 9:78410068-78410090 GGCTTAGCGGGCCCCGCACTGGG + Intergenic
1056080987 9:83093596-83093618 GGCTTGGCGGGCCCCACACTCGG - Intergenic
1057511115 9:95680401-95680423 GGCTTGGCGGGCCCCGCACTAGG + Intergenic
1057689527 9:97271366-97271388 GGCTCGGCAGGCCCCGCACTCGG - Intergenic
1057818262 9:98311644-98311666 GGTTTGGCAGGCCCCAGGCTTGG - Intronic
1058174893 9:101724405-101724427 GGCTTGGCGGGCCCCGCACTCGG - Intronic
1058727502 9:107817864-107817886 GGCTCAGCGGGCCCCACACTGGG + Intergenic
1058786472 9:108393576-108393598 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1059300362 9:113307714-113307736 TGTTTAGCAGGCCCCAGTCAAGG + Intergenic
1061855818 9:133441480-133441502 GGTTTCTCAGGCCCAACACAGGG - Intronic
1062349294 9:136131312-136131334 GGTTTGGGAAGCGCCACACTTGG + Intergenic
1203536144 Un_KI270743v1:41857-41879 GGTTGATCAGACCCAACACTAGG - Intergenic
1186152622 X:6690797-6690819 GGCTTGGCTGGCCCCGCACTTGG - Intergenic
1186293169 X:8121659-8121681 GGGTCAGCGGGCCCCGCACTCGG + Intergenic
1186323276 X:8452781-8452803 GGCTTGGCAGGCCCCGCACTCGG - Intergenic
1186777992 X:12884577-12884599 GGTTTAGCATGACAGACACTGGG - Intronic
1187005866 X:15232021-15232043 GGCTTGGCAGGCCCCGCACTCGG - Intergenic
1189209817 X:39275687-39275709 GGCTTGGCAGGCCCTGCACTTGG + Intergenic
1190045895 X:47111294-47111316 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1192869682 X:75173888-75173910 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1193804069 X:85972648-85972670 GGCTTGGCGGGCCCCGCACTCGG - Intronic
1193951794 X:87808971-87808993 GGGTTCGGGGGCCCCACACTCGG - Intergenic
1194118054 X:89926825-89926847 GGCTTGGCAGGCCCCGCACTCGG - Intergenic
1196319556 X:114270850-114270872 GGCTTGGCGGGCCCCGCACTGGG - Intergenic
1196762366 X:119211170-119211192 GGTTTGGCGGGCCCTGCACTCGG - Intergenic
1196775482 X:119333665-119333687 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1196781487 X:119387875-119387897 GGCTTGGCTGGCCCCGCACTGGG - Intergenic
1196794005 X:119488154-119488176 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1196827302 X:119751119-119751141 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1196845034 X:119890661-119890683 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1197340027 X:125255717-125255739 GGCTTGGCGGGCCCCACACTCGG + Intergenic
1197607902 X:128606675-128606697 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1197934867 X:131729612-131729634 AGACTAGCAGGCTCCACACTGGG - Intergenic
1197978735 X:132194156-132194178 GGCTCGGCAGGCCCCACACTCGG + Intergenic
1198299959 X:135325524-135325546 GGCTTGGCGGGCCCCGCACTCGG + Intronic
1198972616 X:142298536-142298558 GGCTTGGCGGGCCCCGCACTCGG - Intergenic
1199028822 X:142972427-142972449 GGCTTGGTGGGCCCCACACTCGG - Intergenic
1199097200 X:143757493-143757515 GGCTCAGCAAGCCCCGCACTCGG - Intergenic
1200470931 Y:3584388-3584410 GGCTTGGCAGGCCCCGCACTCGG - Intergenic
1200824321 Y:7622507-7622529 GGCTTGGTGGGCCCCACACTCGG - Intergenic
1200873652 Y:8128807-8128829 GGCTTGGCAGGCCCAGCACTCGG - Intergenic
1200888656 Y:8298687-8298709 GGCTTGGCGGGCCCCGCACTCGG + Intergenic
1201423067 Y:13820495-13820517 GGCTTGGCGGGCCCCACACCCGG - Intergenic
1201495712 Y:14590074-14590096 GGCTTGGCGGGCCCCGCACTCGG - Intronic
1201496958 Y:14598487-14598509 GGCTTGGCTGGCCCCGCACTCGG - Intronic
1201555269 Y:15260234-15260256 GGCTCTGCAGGCCTCACACTTGG + Intergenic
1201556304 Y:15267369-15267391 GGCTCTGCAGGCCTCACACTTGG + Intergenic
1201573008 Y:15433914-15433936 GGCTTGGCAGGCCCCACACTTGG + Intergenic
1202090488 Y:21183491-21183513 GGCTCAGTGGGCCCCACACTCGG + Intergenic
1202235734 Y:22708580-22708602 GGCTTGGTGGGCCCCACACTCGG + Intergenic
1202307429 Y:23487588-23487610 GGCTTGGTGGGCCCCACACTCGG - Intergenic
1202563376 Y:26182998-26183020 GGCTTGGTGGGCCCCACACTCGG + Intergenic