ID: 1008270512

View in Genome Browser
Species Human (GRCh38)
Location 6:49483718-49483740
Sequence CAGGTGGGCGTGGGTTTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1302
Summary {0: 1, 1: 0, 2: 62, 3: 531, 4: 708}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008270512_1008270522 16 Left 1008270512 6:49483718-49483740 CCTGCTAAACCCACGCCCACCTG 0: 1
1: 0
2: 62
3: 531
4: 708
Right 1008270522 6:49483757-49483779 GCAAGCACCGGGCGCAGCCCCGG 0: 2
1: 63
2: 258
3: 487
4: 608
1008270512_1008270519 4 Left 1008270512 6:49483718-49483740 CCTGCTAAACCCACGCCCACCTG 0: 1
1: 0
2: 62
3: 531
4: 708
Right 1008270519 6:49483745-49483767 TACAGCTGACCTGCAAGCACCGG No data
1008270512_1008270520 5 Left 1008270512 6:49483718-49483740 CCTGCTAAACCCACGCCCACCTG 0: 1
1: 0
2: 62
3: 531
4: 708
Right 1008270520 6:49483746-49483768 ACAGCTGACCTGCAAGCACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008270512 Original CRISPR CAGGTGGGCGTGGGTTTAGC AGG (reversed) Intronic
900297490 1:1959339-1959361 CAGGTGGGGGTGGGTGGAGGGGG - Intronic
900615769 1:3565047-3565069 CAGGAGGGCAGGGGTTTTGCTGG + Intronic
901045994 1:6396032-6396054 CAGGTGGGCGTGGGCTCGGCGGG - Intergenic
901601495 1:10426662-10426684 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
901783323 1:11608815-11608837 CGGGTGGGCATGGGCTTGGCGGG + Intergenic
902033425 1:13439343-13439365 CGGGTGGGCGTGGGCTCCGCCGG + Intergenic
902100446 1:13983465-13983487 CAGGTGGTCGTGGGCTTGGCGGG - Intergenic
902335172 1:15750321-15750343 CAGCTGGGATTGGGGTTAGCTGG + Intergenic
902963977 1:19984754-19984776 CGGGTGGGCGTGGGCTCAGTGGG - Intergenic
903131139 1:21280222-21280244 CTTGTGGGTGTGGGTTTTGCAGG - Intronic
903624587 1:24721582-24721604 CGGGTGGGCGTGGGCTCGGCGGG + Intergenic
903886051 1:26541832-26541854 CAGGTGGGCTTGGCTACAGCTGG + Intronic
904696061 1:32332240-32332262 AAGGTGGGTTTGGGTTCAGCTGG + Exonic
905375611 1:37518309-37518331 CGGGTGGGCGTGGGCTTGGTGGG + Intergenic
905742872 1:40387910-40387932 CGGGTGGGCATGGGCTTGGCGGG + Intronic
905761166 1:40559174-40559196 CGGGTGGGCGTGGGCTCTGCGGG - Intergenic
906422992 1:45686617-45686639 CAGGTGGGCGTGTGTAAGGCGGG - Exonic
907102250 1:51847669-51847691 CAGGTGGGCGTGGGCTTGGCGGG - Intronic
907371163 1:54004526-54004548 CGGGTGGGCGTGGGCTCGGCGGG - Intergenic
907889475 1:58623489-58623511 CGGGTGGGCGTCGGCTTGGCGGG + Intergenic
908027774 1:59969967-59969989 CGGGTGGGCGTGGGCTTGGTGGG - Intergenic
908291316 1:62669947-62669969 CGGGTGGGCGTGGGCTTGGTGGG + Intronic
908301080 1:62761571-62761593 CAGGTGGGCGCTGGCTTGGCAGG + Intergenic
908888570 1:68817778-68817800 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
909318054 1:74248210-74248232 TGGGTGGGCGTGGGCTTAGTGGG - Intronic
909377093 1:74952350-74952372 CGGGTGGGCGTGGGCTTGGTGGG - Intergenic
909904585 1:81178914-81178936 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
910034785 1:82777084-82777106 CAGGTGGGCGTGGGCTTGGCGGG - Intergenic
910550263 1:88467114-88467136 CGGATGGGCGTGGGCTTGGCGGG + Intergenic
910685726 1:89914261-89914283 CGGGTGGGCGTGGGCTTGGTGGG - Intronic
911090493 1:94013423-94013445 CAGGTGGAGGTGGGTGTGGCAGG + Intronic
911259620 1:95669930-95669952 CGGGTGGGTGTGGGCTTGGCGGG - Intergenic
911839270 1:102660315-102660337 CGGGTGGGCGTTGGCTTGGCGGG - Intergenic
912166131 1:107044813-107044835 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
912312898 1:108641163-108641185 CGGGTGGGCGTGGGCTTGGTGGG - Intronic
912315909 1:108667533-108667555 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
912538778 1:110396640-110396662 CGGGTGGGTGTGGGCTTGGCGGG - Intergenic
913142519 1:115955541-115955563 CAGGTTGGTGTGGGTATAGAGGG + Intergenic
913161083 1:116146858-116146880 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
913468991 1:119171605-119171627 CAGGTGGGCATGGGCTTGGCGGG + Intergenic
913470179 1:119179124-119179146 CGGGTGGGCGTGGGCTCGGCGGG + Intergenic
913692132 1:121289407-121289429 CGGGTGGGCGTGGGCTTGGTGGG - Intronic
914203449 1:145506155-145506177 AGGGTGGGCGTGGGCTTGGCGGG - Intergenic
914438462 1:147681069-147681091 TGGGTGGGCGTGGGCTTGGCAGG - Intergenic
914482571 1:148079309-148079331 AGGGTGGGCGTGGGCTTGGCGGG - Intergenic
914928042 1:151906194-151906216 CAGGTGGGTGTGGGCTTGGCGGG + Intronic
915104108 1:153521844-153521866 CGGGTGGGTGTGGGCTTGGCGGG + Intergenic
915242338 1:154532376-154532398 TGGGTGGGCGTGGGCTTTGCGGG - Intronic
915260032 1:154670808-154670830 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
915261202 1:154678095-154678117 CGGGTGGGCGTGGGCTTGGTGGG + Intergenic
915764507 1:158349291-158349313 AGGGTGGGCGTGGGCTTGGCGGG - Intergenic
915865575 1:159494911-159494933 CGAGTGGGCGTGGGCTTGGCGGG - Intergenic
916910130 1:169337380-169337402 CGGGTGGGCGTGGGCTTGGCGGG - Intronic
916960261 1:169882169-169882191 TGGGTGGGCGTGGGCTTGGCAGG + Intronic
917406238 1:174711140-174711162 CGGGTGGGCGTGGGCTCGGCAGG - Intronic
917578569 1:176349573-176349595 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
917719099 1:177769141-177769163 CAGGTGGGGGTGGATTGAGTGGG - Intergenic
917860498 1:179138898-179138920 CGGGTGGGCGTGGGCTTGGCGGG + Intronic
917933020 1:179837233-179837255 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
918058983 1:181045892-181045914 CAAGTGGGCGTGGGCTTGGCGGG + Intronic
918659777 1:187074119-187074141 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
918708923 1:187703678-187703700 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
918720815 1:187850259-187850281 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
918732313 1:188013586-188013608 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
918789953 1:188813145-188813167 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
918792060 1:188841477-188841499 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
918993875 1:191731872-191731894 CGGGTGGGCGTGGGCTCGGCGGG + Intergenic
919049808 1:192499363-192499385 CGGGTGGGCGTGGGCTCCGCGGG - Intergenic
919091882 1:192986968-192986990 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
919174451 1:194001899-194001921 CCGGTGGGCGTGGGCTTGGCGGG + Intergenic
919201372 1:194358572-194358594 CGGGTGGGCGTGGACTTGGCGGG - Intergenic
919237020 1:194859124-194859146 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
919377145 1:196808870-196808892 CAGGTGGGTGTGGGATCTGCAGG + Intergenic
920150208 1:203900294-203900316 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
920479456 1:206307755-206307777 CGGGTGGGCGTGGGCTTGGTGGG - Intronic
920731387 1:208488741-208488763 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
920878480 1:209858953-209858975 CGGGTGGGCGTGGGCTCAGCTGG - Intergenic
920882053 1:209889242-209889264 TGGGTGGGCGTGGGCTTCGCGGG - Intergenic
920883168 1:209899103-209899125 CGGGTGGGCGTGGGCTTGGTGGG - Intergenic
921096269 1:211889606-211889628 CAGGTGGGCGTGGGCTCGGCGGG + Intergenic
921396407 1:214673449-214673471 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
921457938 1:215394716-215394738 CAGGTGGGTTTGGGCTTGGCGGG - Intergenic
921801786 1:219410709-219410731 CTGGTGGGCGTGGGCTTGGTGGG + Intergenic
921903868 1:220475997-220476019 TGGGTGGGCGTGGGCTTGGCGGG - Intergenic
921983697 1:221285961-221285983 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
922056810 1:222049804-222049826 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
922166160 1:223117242-223117264 TGGGTGGGCGTGGGCTTGGCAGG - Intronic
922417056 1:225431423-225431445 CAGGTGGGCGTGGGCTCGGCAGG + Intergenic
922434210 1:225586944-225586966 GAGGTGGGGGTGGGGTTGGCTGG + Intronic
922485406 1:225969827-225969849 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
922546836 1:226464255-226464277 CAGGTGGGCGTGGGCTTGGTGGG + Intergenic
922855773 1:228773763-228773785 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
923324829 1:232871747-232871769 CGGGTGGGCGTGGGCTTGGTGGG - Intergenic
923353162 1:233129181-233129203 CGGATGGGCGTGGGCTTGGCGGG + Intronic
923573790 1:235140342-235140364 CAGGTGGGCGTGGGCTTGGCGGG + Intronic
923930097 1:238684933-238684955 CAGGTGGGCATGGGCTTGGCGGG - Intergenic
1063148976 10:3320130-3320152 TGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1063322193 10:5060944-5060966 CAGGTGGGCATGGGCTCAGCAGG - Intronic
1063769675 10:9183407-9183429 CGGGTGGGCGTGGACTTGGCGGG + Intergenic
1064146451 10:12829922-12829944 CTGGTGGGTGTGGGTTCTGCTGG - Exonic
1064228320 10:13506798-13506820 CAAATGGGCTTGGGATTAGCTGG + Intronic
1065590299 10:27256537-27256559 CGGGTGGGCGTGGGCTCGGCGGG + Intergenic
1065743300 10:28815976-28815998 CGGGTGAGCGTGGGCTTGGCGGG - Intergenic
1065981588 10:30903101-30903123 CGGGTGGGCGTGGGCTTGGCGGG - Intronic
1066186283 10:33013349-33013371 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1066190240 10:33049283-33049305 CGGGTGGGCGTGGGCTTGGTGGG + Intergenic
1066234024 10:33468091-33468113 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1066293605 10:34035452-34035474 CAGGTGGGTGTGGGCTCGGCGGG + Intergenic
1066567421 10:36734922-36734944 CGGGTGGGCGTGGGCTTGGTGGG - Intergenic
1066590582 10:36989592-36989614 CAGGTGGGCATGGGCTTGGCAGG - Intergenic
1066598193 10:37076065-37076087 CGGGTGGGCGTGGGCTCAGTGGG + Intergenic
1066615081 10:37285469-37285491 CAGGTGGGCATGGGCTGGGCTGG - Intronic
1066648484 10:37634530-37634552 CAGGTGGGCGCGGGCTCAGTAGG + Intergenic
1066660881 10:37737432-37737454 TGGGTGGGCGTGGGCTCAGCAGG + Intergenic
1067216988 10:44311253-44311275 CACGTGGGCGTGCGGTCAGCAGG - Intergenic
1068216651 10:53990869-53990891 CAGGTGGGTGTGGGCTTGGCGGG + Intronic
1068374000 10:56155180-56155202 CGGGTGGGCGTGGCCTTGGCGGG + Intergenic
1068863149 10:61867702-61867724 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1068902094 10:62280435-62280457 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1068978117 10:63033646-63033668 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1069215368 10:65812356-65812378 CGGGTGGGCATGGGCTCAGCGGG - Intergenic
1069280860 10:66651766-66651788 TGGGTGGGCGTGGGCTTGGCTGG - Intronic
1069988657 10:72300666-72300688 CCGGTGGGCGTGGGCTCGGCGGG + Intergenic
1070564084 10:77590490-77590512 CGGGTGGGTGTGGGCTCAGCGGG - Intronic
1071003736 10:80859293-80859315 CGGGTGGGCGTGGGCTTGGTGGG + Intergenic
1071055285 10:81502916-81502938 CTGGTGGGGGTGGGCTCAGCAGG + Intergenic
1071387983 10:85141457-85141479 CAGGTGGGCATGGGCTTGGTGGG + Intergenic
1071901006 10:90120078-90120100 CAGGTGGGTGTGGGCTTGGCAGG - Intergenic
1071963799 10:90832478-90832500 CGGGTGGGCGTGGGCTTGGCGGG - Intronic
1073475069 10:103747326-103747348 CATGTGGGCGTGGGTGTGGTGGG + Intronic
1074316991 10:112369845-112369867 CGGGTGGGCGTGGGCTCGGCAGG + Intergenic
1074449389 10:113546866-113546888 CAGGTTGGAGTTGGTTAAGCAGG - Intergenic
1074999212 10:118782960-118782982 CAGGTGGGCGTGGGCTTGGTGGG + Intergenic
1075255599 10:120923882-120923904 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1075269399 10:121035642-121035664 CGGGTGCGCGTGGGCTTGGCAGG - Intergenic
1075376042 10:121978682-121978704 CCTGTGGGCGTGGGCTTGGCAGG - Intergenic
1075505026 10:123013806-123013828 CGGGTGGGCGTGGGCTTGGCAGG - Intronic
1075537549 10:123283657-123283679 CAGGTGGGCGTGGGCTTGGCGGG - Intergenic
1076261679 10:129071655-129071677 CGGGTGGACGTGGGCTTGGCGGG - Intergenic
1076773594 10:132680719-132680741 CGGGTGGGCGTGGGCTTGGCGGG + Intronic
1076796553 10:132801239-132801261 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1077805742 11:5589937-5589959 CGGGTGGGCGTGGGCTTGGCGGG + Intronic
1077815597 11:5683005-5683027 CGGGTGGGCGTGGGCTTGGTGGG + Intronic
1078252591 11:9628884-9628906 CAGCTGGATGGGGGTTTAGCAGG - Intergenic
1078301219 11:10133607-10133629 CGGGTGGGCGTGGGCTTGGTGGG - Intronic
1078743713 11:14091630-14091652 TGGGTGGGCGTGGGCTTGGCGGG - Intronic
1078795802 11:14591120-14591142 CAGGTGGGCATGGGCTTGGTGGG + Intronic
1078891313 11:15560981-15561003 CAGATGGGCCTGGGCTTGGCGGG + Intergenic
1079190998 11:18276395-18276417 CGGGTGGGCGTGGGCTCAGCGGG - Intergenic
1079555434 11:21753401-21753423 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1079730585 11:23935027-23935049 TGGGTGGGCGTGGGCTTGGCAGG - Intergenic
1079731775 11:23942580-23942602 TGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1079767801 11:24416322-24416344 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1080107514 11:28526086-28526108 CAGATGGGCATGGGCTTGGCAGG - Intergenic
1080195217 11:29600449-29600471 CGGGTGGGCGTGGGCTTGGCTGG - Intergenic
1080557713 11:33432046-33432068 CGGGTGGGCGTGGGCTTGGCAGG - Intergenic
1080621425 11:33990157-33990179 CGGGTGGGCGTGGGCTTGGCTGG + Intergenic
1081125042 11:39311886-39311908 CGGGTGGGCGTGGGCTTGGTGGG + Intergenic
1081126958 11:39333370-39333392 TAGGTGGGCGTGGGTTTGGCGGG - Intergenic
1081324483 11:41728386-41728408 CGGGTGGGTGTGGGCTTGGCGGG - Intergenic
1081329731 11:41788529-41788551 CAGGTGGGCGTGGGCTTGGCAGG - Intergenic
1081420876 11:42873976-42873998 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1081422048 11:42881441-42881463 TGGGTGGGCGTGGGCTTGGCAGG + Intergenic
1081428360 11:42949934-42949956 CGGGTGGGCATGGGCTTGGCAGG + Intergenic
1083013742 11:59429268-59429290 TAGGTGAGAGTGGGTTTATCAGG - Intergenic
1083546092 11:63550263-63550285 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1084107389 11:66988852-66988874 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1084186632 11:67476150-67476172 CGGGTGGGCGTGGGCTCGGCAGG + Intergenic
1084210439 11:67619094-67619116 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1084406097 11:68974543-68974565 CAGGTGCGAGTGGGCTTGGCGGG - Intergenic
1084473715 11:69377193-69377215 CAGGTGGGCGTGGGCATTCCTGG - Intergenic
1085447266 11:76609332-76609354 CGGGTGGGCGTGGGCTTGGCAGG - Intergenic
1085671095 11:78465205-78465227 CAGGTGGGTGTGGGCTCGGCGGG - Intronic
1085687673 11:78638905-78638927 CAGGTGGGTGTGGGCTTGGCGGG + Intergenic
1085863105 11:80257620-80257642 CGGGTGGGCGTGGGCTCAGCGGG + Intergenic
1086043012 11:82501217-82501239 TGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1086087542 11:82970731-82970753 CGGGTGGGCGTGGACTTGGCGGG + Intergenic
1086397767 11:86433824-86433846 CGGGTGGGCATGGGCTTGGCGGG - Intergenic
1086724629 11:90167247-90167269 CGGGTGGGCGTGGGCTCAGCGGG + Intronic
1086807994 11:91268814-91268836 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1087354520 11:97076658-97076680 CGGGTGGGCGTGGGCTTGGTGGG + Intergenic
1087682362 11:101231638-101231660 CAGGTGGGTGTGGGCTCAGCAGG - Intergenic
1087966580 11:104422732-104422754 CAGGTGGGTGTGGGCTCGGCAGG - Intergenic
1088570856 11:111222036-111222058 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1089244756 11:117110754-117110776 CTGGTGGGCGTGGGCTTGGTGGG - Intergenic
1089373593 11:117978790-117978812 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1089466424 11:118689276-118689298 CGGGTTGGCGTGGGCTTGGCGGG - Intergenic
1089800219 11:121021717-121021739 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1090229202 11:125089555-125089577 CGGGTGGGCATGGGCTTGGCGGG + Intronic
1090307704 11:125705005-125705027 CGGGTGGGCGTGGGCTTGGTGGG - Intergenic
1090347514 11:126083088-126083110 CAGGTGCGCATGGGTGTAGCGGG - Intergenic
1090586208 11:128215573-128215595 CAGGTGGGCGTGGGCTCGGCAGG - Intergenic
1090776744 11:129972123-129972145 TGGGTGGGCGTGGGCTTGGCGGG - Intronic
1091058243 11:132438781-132438803 GAGGTGGGCTTGGGTATAGGGGG + Intronic
1091233472 11:134003165-134003187 CGGGGGGGCGTGGGCTTGGCGGG - Intergenic
1091402263 12:188377-188399 CGGGTGGGCGTGGGCTCGGCGGG - Intergenic
1092101708 12:5889150-5889172 TGGGTGGGCGTGGGCTTGGCAGG - Intronic
1092133943 12:6132676-6132698 CGGATGGGCGTGGGCTCAGCGGG + Intergenic
1092135182 12:6142254-6142276 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1092137409 12:6159534-6159556 AGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1092142126 12:6191173-6191195 CAGGTGGGCGTGGGCTTGGCGGG - Intergenic
1092272907 12:7037483-7037505 CAGGTGGGCGTGGGCTTGGCGGG + Intronic
1092350542 12:7752376-7752398 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1092471750 12:8787324-8787346 CGGGCGGGCGTGGGCTTGGCGGG + Intergenic
1092472943 12:8794781-8794803 CGGGCGGGCGTGGGCTTGGCGGG + Intergenic
1092525221 12:9305697-9305719 CAGCTGGGCTTGGTTTTTGCAGG + Intergenic
1092542050 12:9426120-9426142 CAGCTGGGCTTGGTTTTTGCAGG - Intergenic
1092545874 12:9450687-9450709 CCGGTGGGCGTGGGCTCGGCGGG - Intergenic
1092572442 12:9739879-9739901 CGGGTAGGCGTGGGCTTGGCGGG - Intergenic
1092617176 12:10225935-10225957 CGGGTGGGCGTGGACTTGGCGGG - Intergenic
1093189380 12:16057440-16057462 CGGGTGGGCGGGGGTTTGGCGGG + Intergenic
1093346251 12:18040312-18040334 CGGGTGGGCGTGGGCTCGGCAGG + Intergenic
1093381546 12:18500204-18500226 CAGGTGGGCGTGGGCTTGGCGGG + Intronic
1093527111 12:20115532-20115554 TGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1093652529 12:21661587-21661609 CGGGTGGGAGTGGGCTTGGCAGG + Intronic
1093715495 12:22376962-22376984 CGGGTGGGCGTGGGCTTGGCGGG + Intronic
1093793703 12:23286003-23286025 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1093921645 12:24866134-24866156 CGGGTGGGAGTGGGCTTGGCAGG + Intronic
1093970191 12:25369424-25369446 CGGGTTGGCGTGGGCTTGGCGGG + Intergenic
1094327543 12:29256701-29256723 CGGGTGGGCGTGGGCTTGGCGGG + Intronic
1094338632 12:29386543-29386565 CCGGTGGGCATGGGCTTGGCAGG - Intergenic
1094409815 12:30156929-30156951 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1094494839 12:30982771-30982793 CAGGTGGGTGTGGGAAAAGCAGG + Intronic
1094507082 12:31071386-31071408 CCGGTGGGCGTGGGCTCGGCGGG + Intergenic
1094510958 12:31096319-31096341 CAGCTGGGCTTGGTTTTTGCAGG + Exonic
1094589322 12:31806091-31806113 CGGGTGGGCGTGGGCTTGGTGGG - Intergenic
1094661261 12:32472349-32472371 CGGGTGGGCGTGGGCTTGGTGGG + Intronic
1094666467 12:32525731-32525753 CAGGTGGGCGTGGGCTTGGTGGG + Intronic
1094718216 12:33034234-33034256 CAGGTGGGTGTGGGCTTGGCAGG - Intergenic
1094722041 12:33075403-33075425 CGGGTGGGCATGGGCTTGGCCGG + Intergenic
1095776685 12:46018076-46018098 CGGGTGGGCGTGGGCTTGGCCGG + Intergenic
1095900113 12:47319280-47319302 CAGGTTGGCTGGGGTTTGGCTGG - Intergenic
1095901523 12:47333442-47333464 CGGGTGGGCATGGGCTTGGCGGG + Intergenic
1096746916 12:53734946-53734968 CAGGTGGGCATGGGTAAGGCTGG + Intergenic
1096956369 12:55530024-55530046 CAGGTGGAGGTAGGTTTAGGTGG - Intergenic
1097017947 12:56000446-56000468 CGGGTGGGCGTGGGCTTGGCAGG - Intronic
1097547555 12:61023471-61023493 CAGGTGGGCATGGGCTCAGCAGG + Intergenic
1097863750 12:64542980-64543002 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1098147855 12:67516076-67516098 CAGGTGGGCCTGGTTGTTGCAGG - Intergenic
1098588650 12:72185098-72185120 TGGGTGGGCGTGGGCTTGGCGGG + Intronic
1098759221 12:74403004-74403026 CGGCTGGGCGTGGGCTTGGCGGG + Intergenic
1099228183 12:79993527-79993549 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1099478652 12:83140177-83140199 CGGGTGGGCGTGGGCTTGGCAGG + Intergenic
1099523952 12:83696589-83696611 CAGATGGGCGTGGGCTTGGCAGG - Intergenic
1099790693 12:87330273-87330295 GGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1100142320 12:91634002-91634024 CGGGTTGGCGTGGGTTTGGCGGG + Intergenic
1100166634 12:91924192-91924214 CAGGTGGGCATGGGCTTGGCGGG - Intergenic
1100211906 12:92406821-92406843 CAGGTGGGCGTGGGATTGGCGGG - Intergenic
1100521442 12:95379666-95379688 CAGGTGGGCGTGGTCTTGGCGGG + Intronic
1100584677 12:95969192-95969214 CGGGTGGGCGTGGGCTTAGCAGG + Intergenic
1101008968 12:100430359-100430381 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1101021603 12:100559439-100559461 CGGGTGGGCGTGGGCTTGGCGGG + Intronic
1101461983 12:104905815-104905837 CGGGTGGGCGTGGGCTTGGTGGG - Intronic
1103146169 12:118597478-118597500 CAGGTGGGTGTGGGCTTGGCGGG - Intergenic
1103439254 12:120950643-120950665 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1103459682 12:121093810-121093832 CAGGTGGGCGTGGGCTCGGCAGG - Intergenic
1103678730 12:122676900-122676922 CAGGTGGGCGTGGGCTCAGCGGG - Intergenic
1103783416 12:123414416-123414438 CGGGTGGGCGTGGGCTTGGTGGG - Exonic
1103853268 12:123947005-123947027 TGGGTGGGCGTGGGCTTGGCGGG + Intronic
1104344472 12:127983439-127983461 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1104614539 12:130256957-130256979 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1104878966 12:132055980-132056002 CAGGTGGGCATGGGAGGAGCGGG + Intronic
1105037731 12:132938811-132938833 CGGGTGGGCGTGGGCTTGGTGGG + Intronic
1105477409 13:20740231-20740253 CAGGTGGGTGCGGGCTTGGCAGG - Intronic
1105701561 13:22938940-22938962 CTGGTGGGCGCGGGCTCAGCGGG - Intergenic
1105722158 13:23127629-23127651 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1105876707 13:24561008-24561030 TGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1105899951 13:24745518-24745540 CCGGTGGGCGTTGGTGAAGCTGG - Intergenic
1106221348 13:27748617-27748639 CGGGTGGGCATGGGCTTGGCGGG - Intergenic
1106224066 13:27771881-27771903 CAGGTTGGCATGGGTTCTGCAGG - Intergenic
1106617086 13:31339969-31339991 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1106643449 13:31609129-31609151 CGGGTGGGTGTGGGCTTGGCGGG - Intergenic
1106810928 13:33358038-33358060 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1107259401 13:38472733-38472755 CGGGTGGGCGAGGGCTTGGCGGG - Intergenic
1107590486 13:41898881-41898903 CGGGTGGGCGTGGGCTTGGCGGG - Intronic
1108435319 13:50396652-50396674 CGGGTGGGCGTGGGCTTGGCGGG + Intronic
1108845646 13:54676628-54676650 CAGGTGGGCATGGGCTTGGTGGG + Intergenic
1108858978 13:54829803-54829825 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1108958221 13:56187578-56187600 CAGGTGGGCGTGGGCTCGGTGGG + Intergenic
1109111036 13:58318838-58318860 CCGGTGGGCGTGGGCTCGGCGGG - Intergenic
1109159894 13:58958485-58958507 TGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1109364615 13:61339225-61339247 CGGGTGGGCGTGTGCTTGGCGGG + Intergenic
1109441345 13:62379284-62379306 CAGGTGGGCGTGGGCTTGGTGGG + Intergenic
1109446633 13:62448201-62448223 CGGGTGGGCGTCGGCTTGGCGGG - Intergenic
1109745797 13:66622006-66622028 CGGGTGGGCGTGGGCTTGGTGGG + Intronic
1109835972 13:67857924-67857946 CAGGTGGGGGCGGGGTTAGGGGG - Intergenic
1109854321 13:68108019-68108041 CAGGTGGGCGTGGGCTCGGAGGG - Intergenic
1110024090 13:70512208-70512230 CGGGTGGGCGTGGGCTTGGCAGG - Intergenic
1110417465 13:75268506-75268528 CGGGTGGGCGTGTGCTTGGCGGG + Intergenic
1110792417 13:79600461-79600483 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1110862112 13:80355604-80355626 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1110874390 13:80490865-80490887 CCGGTGGGCGTGGGCTTGGCAGG - Intergenic
1110940320 13:81341073-81341095 CGGGTGGGCGTGGGCTTGGCCGG - Intergenic
1110999863 13:82165253-82165275 CGGGTGGGTGTGGGCTTGGCGGG - Intergenic
1111103269 13:83613698-83613720 CAGGTGGGCGTGGGCTTGGCGGG - Intergenic
1111441885 13:88291877-88291899 CGGGTGGGCATGGGCTTGGCGGG + Intergenic
1111841435 13:93455088-93455110 CGGGTGGGCGTGGGCTTGGCGGG - Intronic
1112077778 13:95931739-95931761 CGGGTGGGCGTGGGCTCAGCAGG - Intronic
1112282707 13:98076595-98076617 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1112518622 13:100077573-100077595 CGGGTGGGCGTGGGCTTGGTGGG + Intergenic
1112533191 13:100224352-100224374 CGGGTGGGCGTGGGCTTGGCAGG - Intronic
1112538254 13:100282504-100282526 CAGGTGGGCGTGGGCTTGGCGGG + Intronic
1112613074 13:100975754-100975776 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1112705833 13:102068532-102068554 CGGGTGGGCATGGGCTTGGCGGG + Intronic
1112842680 13:103600039-103600061 CGGGTGGGCGTGGGCTCGGCAGG + Intergenic
1113330202 13:109319359-109319381 CAGGAGGGCGTGGGCTCAGCAGG - Intergenic
1113371974 13:109732957-109732979 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1113482706 13:110633332-110633354 CGGGTGGGCGTGGGCTTGGCGGG - Intronic
1113506618 13:110821217-110821239 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1113538155 13:111084175-111084197 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1113604663 13:111596697-111596719 TAGCTGGGAGTAGGTTTAGCTGG - Intronic
1113678035 13:112221774-112221796 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1113905922 13:113819155-113819177 CAGGTGGGCATGAGTGTTGCTGG + Intergenic
1114560330 14:23585185-23585207 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1114593513 14:23891814-23891836 CGGGTAGGCGTGGGCTTGGCGGG + Intergenic
1115118262 14:29909054-29909076 CGGGTGGGCGTGGGCTTGGCGGG + Intronic
1115421372 14:33199042-33199064 CAGGTGGGCGTGGGCTCGGCGGG - Intronic
1116251052 14:42482692-42482714 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1116297929 14:43136229-43136251 CAGGTGGCCATGGGCTTGGCAGG - Intergenic
1116390507 14:44384800-44384822 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1116426501 14:44798647-44798669 CGGGTGGGCGTGGGCTCGGCAGG + Intergenic
1116452338 14:45080494-45080516 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1116594360 14:46820492-46820514 CGGGTGGGCGTGGCCTTGGCCGG + Intergenic
1116623994 14:47242501-47242523 CGGGTGGGCGTGGGCTTGGTGGG + Intronic
1116653755 14:47626615-47626637 CGGGTGGGCGTGGCCTTGGCGGG + Intronic
1117077847 14:52122301-52122323 CAGGTGGGCGTGGGCTTGGCGGG + Intergenic
1117082574 14:52166804-52166826 CAGGTGGGCGTGGGCTCAGTGGG + Intergenic
1117297553 14:54393512-54393534 CGGGTGGGCGTGGGCTGGGCGGG + Intergenic
1117302488 14:54443109-54443131 CGGGTTGGCGTGGGATTGGCGGG + Intergenic
1117565619 14:56991104-56991126 CGGGTGGGTGTGGGCTTGGCGGG + Intergenic
1117571945 14:57056918-57056940 CCGGTGGGCGTGGGCTTGGTGGG - Intergenic
1117727357 14:58687556-58687578 CAGGTGGGCGTGGGCACAGCGGG - Intergenic
1118592785 14:67413637-67413659 CAGGTGGGAGTGGGGTTGGGGGG - Intergenic
1118717795 14:68572623-68572645 CAGGTGGGAGTGGCTTTGGCAGG - Intronic
1119027763 14:71167597-71167619 CGGGTGGGCGTGGGCTTAGCGGG + Intergenic
1119038818 14:71254353-71254375 CGGGTGGGCGTCGGCTTGGCGGG + Intergenic
1119300341 14:73566636-73566658 CAGGTGGGCATGGGCTTGGTGGG - Intergenic
1119426129 14:74535680-74535702 CAGGTGGGTGTGGGTGGAGATGG + Intronic
1119673471 14:76537053-76537075 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1120292212 14:82589964-82589986 CAGGTGGGCCTGGGTACGGCTGG + Intergenic
1120330959 14:83092442-83092464 CAGGTAGGCGTGGGCTTGGCAGG + Intergenic
1120632328 14:86905733-86905755 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1120704798 14:87735063-87735085 CGGGTGGGCATGGGCTTGGCAGG - Intergenic
1120844141 14:89111705-89111727 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1121145360 14:91578027-91578049 CAGGTAGGCATGGGCTTAGCGGG + Intergenic
1121350673 14:93170386-93170408 CGGGTGGGCGTGGGCTTGGCAGG - Intergenic
1122134717 14:99626245-99626267 CAGGTGTGTGTGGGTGTAGCGGG + Intergenic
1122216551 14:100208461-100208483 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1122493479 14:102135813-102135835 CGGGTGGGCGTGGGCTTGGCGGG - Intronic
1122894839 14:104751788-104751810 CGGGTGGGCGTGGGCTCGGCGGG - Intergenic
1123799119 15:23802971-23802993 CGGGTGGGCATGGGCTTGGCGGG + Intergenic
1123949153 15:25253496-25253518 CGGGTGGGTGTGGGCTTGGCGGG - Intergenic
1124036350 15:26056970-26056992 CGGGTGGGCGTGGGCTCAGCTGG + Intergenic
1124114881 15:26831482-26831504 CGGGTGGGCGTGGACTTGGCGGG - Intronic
1124256304 15:28145503-28145525 CCAGTGGGCGTGGGTTTTTCTGG - Intronic
1124410550 15:29432944-29432966 GAGGTGGGCGTGCGATGAGCAGG - Intronic
1124567944 15:30833649-30833671 CCAGTGGGCGTGGGTTTTTCTGG + Intergenic
1125112193 15:36047012-36047034 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1125480313 15:40075076-40075098 CAGGTGGGCGTGGGCTTGGTGGG - Intergenic
1125565773 15:40677230-40677252 CGGGTGGGCGAGGGTTTGGCGGG - Intergenic
1125609680 15:40961675-40961697 CGGGTGGGCGTGGGCTTGGCAGG + Intergenic
1125885563 15:43226851-43226873 CCGGTGGGCGTGGGTTTGGCGGG - Intergenic
1125914574 15:43474181-43474203 CTGGTGGGTGTGGGCTTGGCGGG - Intronic
1126088970 15:45034892-45034914 CGGGTAGGCGTGGGCTTGGCGGG + Intronic
1126128052 15:45314150-45314172 CGGGTGGGCATGGGCTTAGCCGG + Intergenic
1126165551 15:45651307-45651329 TGGGTGGGCGTGGGCTCAGCAGG - Intronic
1126639652 15:50812026-50812048 CGGGTGGGTGTGGGCTCAGCAGG + Intergenic
1127766085 15:62186864-62186886 CCAGTGGGCGTGGGCTTGGCGGG - Intergenic
1127916420 15:63459124-63459146 CGGGTGGGCGTGGGCTCGGCGGG + Intergenic
1127916426 15:63459143-63459165 CGGGCGGGCGTGGGCTTGGCAGG + Intergenic
1128110825 15:65075082-65075104 CAGGTGGGCGTGGGCTTGGCGGG + Intronic
1128594110 15:68929189-68929211 CGGGTGGGCGTGGGCTCGGCGGG - Intronic
1128669997 15:69567659-69567681 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1128813331 15:70587477-70587499 CGGGTGGGCGTGGGCTTGGAGGG - Intergenic
1129196915 15:73973806-73973828 CGGGTGGGCGTGGGCTCCGCGGG + Intergenic
1129586868 15:76876115-76876137 CTGATGGGCGTGGGCTTGGCGGG - Intronic
1129592170 15:76926440-76926462 CAGGTGGGAGTTTGTTTAGCCGG + Intergenic
1129777520 15:78246440-78246462 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1129859146 15:78846931-78846953 CAGATGGGCGTGGGCTTGGTGGG + Intronic
1130132840 15:81158680-81158702 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1131472844 15:92711320-92711342 CGGGTGGGCGTGGGCTCGGCGGG - Intronic
1131507768 15:93031885-93031907 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1131831727 15:96359075-96359097 CAGGGGTGGGTGGGTTGAGCTGG + Intergenic
1131846142 15:96492140-96492162 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1132044199 15:98549812-98549834 TGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1132097688 15:99000107-99000129 CGGGTGGGCGTGGGCTCCGCGGG + Intronic
1132098884 15:99008538-99008560 CGGGTGGGCGTGGGCTCGGCGGG - Intergenic
1132510997 16:341321-341343 CGGGTGGGCGTGGGCTTGGTGGG + Intronic
1132836846 16:1958502-1958524 CAGGTGGGTGTGGGCTCGGCGGG - Intergenic
1135135791 16:19884805-19884827 CAGGCGGGCGTGCGTGGAGCGGG - Exonic
1135262145 16:20989943-20989965 CGGGTGGGCGTGGGCTTGGCGGG - Intronic
1135280828 16:21152655-21152677 CGGGTGGGCGTGGGCTTGGCGGG + Intronic
1135299413 16:21313083-21313105 CGGGTGGGCGTGGACTTGGCGGG - Intergenic
1135470225 16:22723244-22723266 CAGGTAGGCGTGGGCTCAGCGGG - Intergenic
1135751090 16:25059213-25059235 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1136136628 16:28260299-28260321 CAGGTGGGGGTGGGGAGAGCTGG - Intergenic
1136163276 16:28435427-28435449 CGAGTGGGCGTGGGCTTGGCGGG + Intergenic
1136199690 16:28679560-28679582 CGAGTGGGCGTGGGCTTGGCGGG - Intergenic
1136216037 16:28793733-28793755 CGAGTGGGCGTGGGCTTGGCGGG - Intergenic
1136491196 16:30609709-30609731 GAGGTGGGCAGGGGCTTAGCAGG - Intronic
1137067886 16:35868662-35868684 CAGGTGTGAGTGGGGTGAGCTGG - Intergenic
1137442493 16:48508764-48508786 CGGGTGGGCGTGGGCTTGGCAGG + Intergenic
1137945683 16:52731476-52731498 CAGGTGGGCATGGGCTCAGCGGG + Intergenic
1138688754 16:58748908-58748930 CAGGTGGGCGTGGGCTTGGCGGG + Intergenic
1139019000 16:62724925-62724947 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1139051462 16:63129692-63129714 CGGGTGGGCGTGGGCTCGGCGGG + Intergenic
1139125560 16:64072631-64072653 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1139147712 16:64343953-64343975 CGGGTAGGCGTGGGCTTGGCGGG + Intergenic
1139442294 16:66974338-66974360 CGGGTGGGCGTGGGCTCGGCGGG + Exonic
1139603027 16:67998273-67998295 CGGGTGGGCGTGGGCTTGGCGGG + Intronic
1139919608 16:70451098-70451120 CGGGTGGGTGTGGGCTTGGCGGG - Intergenic
1140722544 16:77784680-77784702 CTGGTGGGCGTGGGCTTGGCGGG - Intergenic
1141465758 16:84204884-84204906 CGGGTAGGCGTGGGCTTGGCGGG - Intergenic
1141896962 16:86964437-86964459 CGGGTGGGCTTGGGTTTCCCGGG - Intergenic
1142505649 17:361651-361673 CGGGTGGGCGTGGGCTTGGCGGG + Intronic
1142828827 17:2532399-2532421 CGGGTGGGCGTGGGCTGGGCGGG - Intergenic
1143058217 17:4178327-4178349 TAGGAGGGGGTGGGTTTATCAGG - Intronic
1143283341 17:5771302-5771324 CGGGTGGGCGTGGGCTCGGCGGG + Intergenic
1143369255 17:6428298-6428320 CAGGTGGGGCTGGGGTTGGCAGG - Exonic
1143664297 17:8347422-8347444 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1143708681 17:8718379-8718401 TGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1144467135 17:15505755-15505777 CGGGTGGGCGTGGGCTTGGCGGG + Intronic
1145094823 17:20016524-20016546 CCGGTGGGCGTGGGCTTGGCGGG + Intronic
1146740489 17:35279216-35279238 CGGGTGGGCGTGGGCATGGCGGG - Intergenic
1147373602 17:40010991-40011013 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1147431799 17:40375886-40375908 CGGGTGGGCGTGGACTTGGCAGG + Intergenic
1147805324 17:43126898-43126920 CAGGTGGGCGCGGGCTCAGCGGG + Intergenic
1147997511 17:44368881-44368903 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1148016847 17:44528023-44528045 CGGGTGGGCGTGGGCTTGGTGGG + Intergenic
1148366200 17:47057585-47057607 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1149099277 17:52884261-52884283 CAGGTGGGTGTGGGCTCGGCGGG - Intronic
1149661371 17:58335776-58335798 CAGGTGGAAGAGGGTTTAGAAGG + Intergenic
1149916366 17:60613672-60613694 CAGGTGGGCATGGGCTCCGCAGG + Intronic
1150772260 17:68051931-68051953 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1150788244 17:68179906-68179928 CAGGTGGGCGTGGGCCTGGCGGG + Intergenic
1150804629 17:68309212-68309234 CGGGTGGGCGTGGGCTTGGCGGG - Intronic
1151567485 17:74907344-74907366 CAGGTGGGCGTGGGCTTGGCGGG - Intergenic
1151782699 17:76257951-76257973 TGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1153070359 18:1098284-1098306 CGGGTGGGCGTGGGCTGGGCGGG + Intergenic
1153644078 18:7178968-7178990 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1153832485 18:8935725-8935747 CGGGTGGGCGTGGGCTTGGTGGG - Intergenic
1154255338 18:12777156-12777178 CGGGTGGGCATGGGCTTGGCGGG - Intergenic
1154942970 18:21132758-21132780 CGGATGGGCGTGGGCTTGGCGGG - Intergenic
1155167731 18:23245079-23245101 CAGGTGGGCTGGGGTATAACGGG - Intronic
1155208073 18:23577933-23577955 CGGGTGGGCGTGGGCTTGGTGGG - Intronic
1155651429 18:28148080-28148102 CAAGTGGGCGTGGGGTTTGGGGG + Intronic
1155772853 18:29723575-29723597 CGGGTGGGCGTGGGCTTGGTGGG + Intergenic
1156038647 18:32794633-32794655 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1156150326 18:34234016-34234038 CAGGTGGGCGTGGGCTTGGCGGG + Intergenic
1156610511 18:38718686-38718708 CGGGTGGGCGTGGGCTCCGCCGG - Intergenic
1156683551 18:39618514-39618536 CAGGTGGGTGTGGGCTCGGCGGG + Intergenic
1156845923 18:41665191-41665213 CAGGTGGCCGTGTGGTGAGCTGG - Intergenic
1156863636 18:41865815-41865837 CAGGTGGGCATGGGCTTGGCGGG + Intergenic
1156969653 18:43139580-43139602 CGGGTGGGCATGGGCTTGGCGGG + Intergenic
1157085948 18:44580791-44580813 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1157858389 18:51121220-51121242 CGGGTGGGGGTGGGCTCAGCGGG - Intergenic
1157979821 18:52367206-52367228 CGGGTGGGCGTGGGCTTGGCGGG - Intronic
1158266417 18:55664949-55664971 CGGGTGGGCGTGGACTTGGCGGG + Intergenic
1158314773 18:56199819-56199841 TAGGTGGGCGTGAGTTTACTGGG - Intergenic
1158351896 18:56572348-56572370 CGGGTAGGCGTGGGCTTGGCGGG + Intergenic
1158597354 18:58827983-58828005 CGGGTGGGCGTGGGTTCCGCGGG - Intergenic
1158697283 18:59714394-59714416 CGGGTGGGCATGGGCTTGGCGGG - Intergenic
1158705775 18:59790753-59790775 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1159230775 18:65605312-65605334 CGGGTGGGCGGGGGCTTGGCGGG + Intergenic
1159260505 18:66006257-66006279 CGGGTGGGCGTGGGCTCGGCAGG - Intergenic
1159322203 18:66866758-66866780 CGGGTGGGCGTGGGCTCGGCGGG + Intergenic
1159656127 18:71031641-71031663 CAGGTGGGGGTGGGCTTGGTGGG - Intergenic
1160176644 18:76600432-76600454 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1160505710 18:79425782-79425804 CAGGTGGGCGGGGGAGGAGCTGG + Intronic
1162230122 19:9259572-9259594 CGGGTGGGCGTGGCCTTGGCGGG + Intergenic
1162233136 19:9283756-9283778 CGGGTGGGCGTGGCCTTGGCGGG - Intergenic
1162237626 19:9321456-9321478 CGGGTGGGCGTGGGCTTGGCAGG + Intergenic
1162814752 19:13187011-13187033 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1163181744 19:15608947-15608969 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1163218823 19:15899741-15899763 CAGGTGGGCGTAGGCTTGGCAGG + Intergenic
1163250388 19:16123241-16123263 CAGGTTGGCCTGGGTCTAGGAGG - Intronic
1164144048 19:22499291-22499313 CGGGTCGGCGTGGGCTTGGCAGG - Intronic
1164270611 19:23668829-23668851 CGGGTGGGCGTGGGCTTGGCGGG - Intronic
1164310438 19:24041372-24041394 CGGGTGGGCGTGGGCTTGGTGGG + Intronic
1164975771 19:32571646-32571668 TGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1165036369 19:33036697-33036719 CAGGTGGGCGTGGGCTGGACGGG + Intronic
1165266916 19:34668252-34668274 CCGGTGGGCGTGGGCTTGGCGGG + Intronic
1166036245 19:40170443-40170465 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1166487034 19:43222234-43222256 CGGGTGGGCGTGGGCTTGGCAGG - Intronic
1166720291 19:44992539-44992561 CAGGTGGGCCTGGGTGGAGAGGG - Intronic
1167006159 19:46777698-46777720 CTGGTGGGCGGGGCTTTGGCTGG - Intronic
1168268985 19:55239574-55239596 CAGGTGGGCGTGGGGCTATGTGG - Exonic
1168494277 19:56837249-56837271 CAGGTGGGGGTGTGTTTAAAGGG - Intronic
924964915 2:67117-67139 CAGGTGAGCGGGAGTTTTGCAGG - Intergenic
924964963 2:67592-67614 CAGGTGAGCGGGAGTTTTGCAGG - Intergenic
924964996 2:67907-67929 CAGGTGAGCGGGAGTTTTGCAGG - Intergenic
924965015 2:68118-68140 CAGGTGAGCGGGAGTTTTGCAGG - Intergenic
924965025 2:68224-68246 CAGGTGAGCGGGAGTTTTGCAGG - Intergenic
924965029 2:68276-68298 CAGGTGAGCGGGAGTTTTGCAGG - Intergenic
924965033 2:68330-68352 CAGGTGAGCGGGAGTTTTGCAGG - Intergenic
924965052 2:68544-68566 CAGGTGAGCGGGAGTTTTGCAGG - Intergenic
924967359 2:91050-91072 TGGGTGGGCGTGGGCTTGGCGGG + Intergenic
925098994 2:1229897-1229919 CGGGTGGGCGTAGGCTTGGCGGG - Intronic
925172620 2:1759598-1759620 TGGGTGGGCGTGGGCTCAGCGGG - Intergenic
925537829 2:4935616-4935638 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
926099235 2:10103458-10103480 CAGGTTGGCGTGGGAAGAGCAGG - Intergenic
926616656 2:15002837-15002859 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
926685845 2:15697032-15697054 CAGGTGGGCGTGGGCTCAGCGGG - Intronic
928106350 2:28472754-28472776 TGGGTGGGCGTGGGCTTGGCGGG + Intronic
928493064 2:31803777-31803799 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
928701560 2:33903814-33903836 CAGGTGGGCATGGGCTCGGCGGG - Intergenic
928936873 2:36688319-36688341 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
929070034 2:38020570-38020592 CGGGTGGGCGTGGGCTTGGCGGG + Intronic
929138041 2:38643363-38643385 CAGGTGGGCGCGGGCTCAACGGG - Intergenic
929201836 2:39244333-39244355 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
929233692 2:39585424-39585446 CGGGTGGGCGTGGGCTTGGAGGG + Intergenic
929379664 2:41335648-41335670 CAGGTGGGCGTGGGCTTGGCGGG + Intergenic
929403515 2:41612930-41612952 CTGGTGGGAGTGTTTTTAGCAGG + Intergenic
929890896 2:45917976-45917998 CGGGTGGGCGTGGGCTTGGCGGG - Intronic
930420904 2:51151921-51151943 CGAGTGGGCGTGGGCTTGGCAGG - Intergenic
930485483 2:52006857-52006879 CGGGTGGGCGTGGGCTTGGCTGG + Intergenic
931708669 2:64969062-64969084 CGGGTGGGCGTGGGCTTGGCCGG + Intergenic
932178264 2:69622141-69622163 CAGGTGGGCGTGGGCTTGGTGGG + Intronic
932359541 2:71092789-71092811 CGGGTAGGCGTGGGCTTGGCGGG - Intergenic
932486453 2:72086939-72086961 CCGGTGGGCGTGGGCTTGGTGGG + Intergenic
932902027 2:75711633-75711655 CGGGTGGGCATGGGCTTGGCGGG + Intergenic
933049898 2:77590532-77590554 TGGGTGGGTGTGGGCTTAGCAGG + Intronic
933139785 2:78779052-78779074 CCGGTGGGCGCGGGCTCAGCGGG + Intergenic
933487281 2:82938747-82938769 TGGGTGGGCGTGGGCTTGGCGGG - Intergenic
935872840 2:107469645-107469667 TGGGTGGGCGTGGGCTTGGCGGG - Intergenic
935896878 2:107747641-107747663 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
936329599 2:111536390-111536412 CAGGTGGGCATGGCTAGAGCTGG - Intergenic
936346864 2:111681908-111681930 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
937209617 2:120260053-120260075 CGGGTGGGCGTGGGCTTGGTGGG - Intronic
937608221 2:123827046-123827068 CATGTGGGCGTGGGCTGGGCGGG - Intergenic
937711871 2:124987713-124987735 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
938126102 2:128672427-128672449 CGGGTGGGCGTGGGCTTGGCAGG - Intergenic
938401004 2:130991503-130991525 TCGGTGGGCGTGGGCTTGGCGGG + Intronic
938474121 2:131591513-131591535 CGGGTGGGTGTGGGTTTTCCTGG + Intergenic
938728754 2:134129996-134130018 CAGGTGGGCGTGGGCTCCGCGGG + Intronic
938931225 2:136088325-136088347 CAGGTGGGCGTGAGCTCGGCGGG - Intergenic
939003117 2:136758519-136758541 CGAGTGGGCGTGGGCTCAGCGGG + Intergenic
939053239 2:137331909-137331931 CGGGTGGGCGTGGGCTTGGCGGG - Intronic
939465105 2:142546119-142546141 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
939509605 2:143089737-143089759 CAGGTGGGCATGGGCTTGGTGGG - Intergenic
939869037 2:147506979-147507001 CAGGTGGGTGTGGGCTCAGTGGG + Intergenic
939898890 2:147826919-147826941 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
940112668 2:150171329-150171351 CGGGTGGGCGTGGGCTCGGCAGG - Intergenic
940215080 2:151296067-151296089 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
940361958 2:152805123-152805145 CGGGTGGGCGTGGGCTCAGTGGG - Intergenic
940666730 2:156618360-156618382 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
941240062 2:163026333-163026355 CGGGTGGGCGTGGGCTTGGGGGG + Intergenic
941309227 2:163909580-163909602 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
941309763 2:163913672-163913694 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
941397955 2:164995057-164995079 CTGGTGGGCGTGGGCTTGGCGGG - Intergenic
941705894 2:168657741-168657763 CGGGTGGGCGTGGGCTTGGTGGG - Intronic
941712145 2:168725200-168725222 CGGGTGGGCGTGGGCTTGGCGGG - Intronic
941804292 2:169694654-169694676 CAGGTGGGGATGGGAGTAGCAGG - Exonic
941820769 2:169841591-169841613 CGGGTGGGCGTGGGCTTGGTGGG + Intronic
942299610 2:174548843-174548865 CGGGTGGGTGTGGGCTTGGCGGG - Intergenic
942867264 2:180691445-180691467 CAGGTGGGCGTGGGCTTGGCGGG + Intergenic
943106176 2:183546948-183546970 CGGGTGGGCGTGGCCTTGGCAGG - Intergenic
943166094 2:184327955-184327977 CGGGTGGGCGTGGGCTCAGCAGG - Intergenic
943443267 2:187951772-187951794 CAGGTGGGCGCAGGCTCAGCAGG + Intergenic
943494778 2:188606696-188606718 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
943680373 2:190761266-190761288 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
943835138 2:192508026-192508048 CAGGTGGGCATGGGCTTGGCGGG + Intergenic
943942701 2:194020219-194020241 CAGGTGGGCGTGGGCTCGGCAGG + Intergenic
944058505 2:195547614-195547636 CGGGTGGGCGTGGGCTCGGCGGG - Intergenic
944482785 2:200174842-200174864 CGGGTGGGCGTGGGCTCGGCGGG + Intergenic
944728575 2:202496968-202496990 CGGGTGGGCATGGGCTTGGCGGG + Intronic
945401377 2:209387437-209387459 CGGGTGGGCGTGGGCTCGGCGGG + Intergenic
945745759 2:213718549-213718571 CGGGTGGGCGTGGGCTTGGTGGG + Intronic
945869128 2:215207931-215207953 CAGGTGGGCGCGGGCTCAGCGGG + Intergenic
945872849 2:215246031-215246053 CGGGTGGGCATGGGCTTGGCGGG - Intergenic
945907913 2:215615188-215615210 CGGGTGGGCGTGGGCTTGGCAGG - Intergenic
946053977 2:216885307-216885329 CGGGTGGGCGTGGGCTTGGGGGG + Intergenic
946358106 2:219201730-219201752 CAGGTGGGCGTGGGCTTGGTGGG - Intronic
947118923 2:226797665-226797687 CCGGTGGGCGTGGGTTCTGTTGG + Exonic
947411970 2:229850776-229850798 CGGGTGGGTGTGGGCTTGGCGGG + Intronic
947720398 2:232366398-232366420 CGGGTGGGCGTGGGCTTGGCAGG + Intergenic
947787380 2:232835761-232835783 GAGGTGACCGTGGGTTTGGCAGG + Intronic
947932082 2:233972770-233972792 CGGGTGGGCGTGGGCTTGGCGGG - Intronic
947938041 2:234024584-234024606 CGGGTGGGCGTGGGCTTGGTGGG - Intergenic
948449138 2:238058160-238058182 CGGGTGGGCGTGGGCTTGGCGGG - Intronic
948487692 2:238291246-238291268 CTGGTGGGAGTGGGTGGAGCAGG - Intergenic
948823301 2:240561075-240561097 CAGGTGGGCGGGCCTTTAGGGGG + Exonic
1169335245 20:4750598-4750620 CAGGTTGGCTGGGGTTCAGCTGG + Intergenic
1169409260 20:5353302-5353324 CAGGAGGAGGTGGCTTTAGCAGG + Intergenic
1169630255 20:7622748-7622770 CCGGTGGGTGTGGGCTTGGCAGG - Intergenic
1169814477 20:9641891-9641913 CGGGTGGGCGTGGGCTTGGTGGG - Intronic
1169849172 20:10031739-10031761 TGGGTGGGCGTGGGCTTGGCGGG + Intronic
1170230889 20:14045085-14045107 CAGGTGGGCGTGGGCTCCTCGGG - Intronic
1170246446 20:14226566-14226588 CGGGTGGGCGTGGGCTTGGCGGG + Intronic
1170649481 20:18226823-18226845 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1170989861 20:21291929-21291951 CCGGTGAGCGTGGGCTTGGCGGG + Intergenic
1171318874 20:24221023-24221045 CGGGTGGGCGTGGGCTTGGAGGG - Intergenic
1171973451 20:31578863-31578885 CGGGTGGGCATGGGCTTGGCGGG - Intergenic
1172109532 20:32536963-32536985 CAGGTGCGCGTGGGGTGGGCGGG - Intronic
1172431882 20:34899105-34899127 CGAGTGGGCGTGGGCTTGGCAGG - Intronic
1172530945 20:35631015-35631037 CAGGTGGGCGTGGACTTCACTGG - Exonic
1173195548 20:40910772-40910794 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1173195663 20:40911241-40911263 CGCGTGGGCGTGGGCTTGGCGGG + Intergenic
1173601573 20:44299191-44299213 CGGGAGGGCGTGGGCTTGGCGGG + Intergenic
1173831487 20:46091909-46091931 CAGGTGGGCGTGGGCCTGGCGGG + Intergenic
1174162900 20:48564365-48564387 CGGGTGGGCGTGGGCTCAGGGGG - Intergenic
1174804112 20:53592503-53592525 CGGGTGGGGGTGGGGTGAGCAGG - Intronic
1175210043 20:57348454-57348476 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1175254129 20:57628852-57628874 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1175703967 20:61162045-61162067 AAGGTGGGGGTGGGTTTATGGGG - Intergenic
1176663203 21:9660093-9660115 CAGGTGGGCGTGGGCTCCGCGGG + Intergenic
1176966640 21:15218878-15218900 CGGGTGGGCGTGGGCTTGGTGGG - Intergenic
1177496908 21:21902475-21902497 CGGGTGGGCGTGGGTTTGGCGGG + Intergenic
1177565851 21:22819142-22819164 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1177637595 21:23807075-23807097 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1177669670 21:24208973-24208995 CGGGTGGGCGCGGGCTCAGCGGG - Intergenic
1177795887 21:25778425-25778447 CGGGTGGGCGTGGGCTCCGCGGG + Intergenic
1178259797 21:31088506-31088528 CAGGTGGGCGCGGGCTCGGCGGG - Intergenic
1178326976 21:31654252-31654274 CAGGTGTGCGTGGGCTTGGCGGG + Intergenic
1178398719 21:32265389-32265411 CGGGTGGGCGTGGGCTTAGTGGG + Intergenic
1178733725 21:35130207-35130229 CAGGTGAGCTTGAGTTTTGCTGG - Intronic
1178983373 21:37283488-37283510 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1179985570 21:44918866-44918888 CTGGTGGGCGTGGGCTGGGCTGG - Intronic
1180095949 21:45555352-45555374 CAGGTGGGGGTGGGGGTTGCAGG + Intergenic
1180741069 22:18053659-18053681 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1181077684 22:20392659-20392681 CGGGTGGGCGTGGGCTCAGCGGG - Intergenic
1181450567 22:23017322-23017344 CGGGTGGGCGTGGGCTGGGCGGG - Intergenic
1182338045 22:29598324-29598346 CGGGTGGGCGTGGGCTCAGCGGG - Intergenic
1183389844 22:37539260-37539282 CAGGTGGACGTGTCTTTTGCAGG - Intergenic
1183422148 22:37718142-37718164 CGGGTGGGCGTGGGCTTGGTGGG - Intronic
1183685191 22:39357595-39357617 CGGGTGGGCGTGGGCTTGGCGGG + Intronic
1183990339 22:41593584-41593606 TGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1184584236 22:45436786-45436808 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1184821235 22:46910565-46910587 CAGTTGGGCCTGGCCTTAGCTGG + Intronic
1184906272 22:47488609-47488631 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
949258954 3:2083690-2083712 GTGGTGGGCGTGGGCTTGGCGGG + Intergenic
950068960 3:10136669-10136691 CGGGTGGGCGTGGGCTCAGCCGG - Intergenic
950203578 3:11061440-11061462 CAGGTGGGCGTGGGCTCCGCGGG + Intergenic
950207873 3:11094103-11094125 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
950256985 3:11513545-11513567 CGGGTGGGCGTGGGCTTGGCAGG - Intronic
950267224 3:11583155-11583177 CAGCTGGGCTTGGGTATATCAGG - Intronic
950311441 3:11961979-11962001 CAGGTTGGCATTGGGTTAGCCGG - Intergenic
950418539 3:12882949-12882971 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
950632620 3:14293265-14293287 CGGGTGGGCGTGGGCTCGGCAGG + Intergenic
951491253 3:23272306-23272328 TGGGTGGGCGTGGGCTTGGCAGG - Intronic
951734779 3:25851823-25851845 CAGGTGGGCGTGGGCTCGGCAGG + Intergenic
951951111 3:28200715-28200737 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
952058115 3:29473804-29473826 CAGGTGGGCGTGGGCTTGGTGGG - Intronic
952275224 3:31870179-31870201 CAGGTGGGCGTGGGCTTGGAGGG + Intronic
952355366 3:32578812-32578834 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
952360448 3:32625697-32625719 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
952393688 3:32902852-32902874 TGGGTGGGCGTGGGCTTGGCGGG + Intergenic
952593614 3:34988422-34988444 CAGGTGGGCGTGGGCTTGGCGGG + Intergenic
952730617 3:36633965-36633987 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
953002868 3:38951210-38951232 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
953124534 3:40078227-40078249 CGGGTGGGCGTGGGCTTGGCGGG - Intronic
953522514 3:43656728-43656750 CAGGTGGGCGTGGGCTTGGCGGG - Intronic
954040985 3:47887264-47887286 CGGGTGGGCGTGGGCTTGGTGGG + Intronic
954088863 3:48269034-48269056 AATGTGGGCGGGGATTTAGCCGG + Exonic
954226211 3:49182918-49182940 CGGGTGGGCATGGGCTCAGCGGG - Intronic
954230581 3:49213743-49213765 CAGGTGGGCATGGGCTTGGCAGG - Intronic
954620101 3:51990615-51990637 CGGGTGGGCGTGGGTTTGGCGGG + Intergenic
955186404 3:56718992-56719014 CGGGTGGGCGTGGGCTTGGCTGG + Intergenic
955266481 3:57449648-57449670 CAGGTGGGCGTGGGCTTGGCGGG - Intronic
955449462 3:59050916-59050938 CGGGTGGGCGTGGACTTGGCAGG + Intergenic
956392208 3:68785568-68785590 CAGGTGGGTGTGGGCTTGGTGGG - Intronic
956479602 3:69660725-69660747 CGGGTGGGCATGGGCTCAGCGGG + Intergenic
956481438 3:69677511-69677533 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
956563616 3:70611914-70611936 CGGGTGGGCGTGGGCTTGGTGGG + Intergenic
956855237 3:73269251-73269273 CGGGTGGGCGTGGGCTTGGCAGG + Intergenic
957074066 3:75587857-75587879 CAGGTGGGCATGGGCTTGGCTGG + Intergenic
957209450 3:77240386-77240408 CGGGTGGGCGTGGGCTCGGCGGG - Intronic
957362058 3:79173396-79173418 CAGGTGGGTGTGGGCTCGGCGGG + Intronic
957371463 3:79300277-79300299 CGGGTGGGCGTGGGCTTGGCGGG + Intronic
957419692 3:79951673-79951695 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
957556320 3:81767689-81767711 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
957665207 3:83217913-83217935 CGGGTGGGCGTGGGCCTGGCTGG - Intergenic
957830041 3:85504978-85505000 CGGGTGGGCGTGGGCTTGGCGGG - Intronic
957885483 3:86282307-86282329 CGGGTGGGCTTGGGCTTGGCGGG + Intergenic
957919881 3:86733380-86733402 CAGGTGGGCACGGGCTCAGCAGG - Intergenic
957921795 3:86757651-86757673 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
957995078 3:87679155-87679177 CAGGTGGGCGTGGGCTTGGTGGG + Intergenic
958022612 3:88015748-88015770 CGGGTCGGCGTGGGCTTGGCGGG + Intergenic
958419853 3:93917646-93917668 CTGGTGGGCGTGGGCTTGGCGGG + Intronic
959323318 3:104906195-104906217 CAGGTGGACATGGGCTCAGCAGG + Intergenic
959422717 3:106148685-106148707 CAGGTGGGCATGGGCTTGGCAGG + Intergenic
960487299 3:118269740-118269762 CCGGTGGGCGTGGGCTTGGCGGG + Intergenic
960691795 3:120353807-120353829 AAGGTAGGAGTGGGTTTAGCAGG - Intergenic
961460441 3:127046735-127046757 CGGGTGGGCATGGGCTTGGCGGG + Intergenic
962383786 3:134916662-134916684 CGGGTGGGCGTGGGCTCAGCGGG - Intronic
962405237 3:135094650-135094672 CAGGAGGGAGAAGGTTTAGCTGG - Intronic
962591096 3:136890302-136890324 CGGGTGGGCGTGGGCTTGGCAGG - Intronic
962600527 3:136987889-136987911 CGGGTGGGCGTGGGCTTGGTGGG - Intronic
963397188 3:144749870-144749892 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
963509173 3:146225734-146225756 CGGGTGGGCGTCGGCTTGGCGGG - Intronic
963862145 3:150323026-150323048 CGGGTGGGGGTGGGCTTGGCCGG + Intergenic
963893652 3:150662769-150662791 AAGGTGGGGGTGGGTGTGGCTGG + Intronic
964014350 3:151928213-151928235 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
964032300 3:152152474-152152496 CGGGTGGGCGTGGCCTTGGCGGG + Intergenic
964037520 3:152217361-152217383 CAGGTGGGTGTGGGCTTGGCGGG + Intergenic
964064044 3:152559494-152559516 CAGGTGGGTGTGGGCTCGGCGGG + Intergenic
964138379 3:153370061-153370083 CAGGTTGGCGTGGGCTCCGCGGG - Intergenic
964139240 3:153378638-153378660 CGGGTGGGCGTGGGCTTGGTGGG - Intergenic
964265400 3:154889542-154889564 CGGGAGGGCGTGGGTTCGGCGGG - Intergenic
964375036 3:156041377-156041399 CGGGTGGGCGTGGGCTCGGCGGG + Intronic
964378509 3:156073219-156073241 CAGGTGAGTGTGGGTTCAGCGGG + Intronic
964393803 3:156224227-156224249 CGGGTGGGCGTGGGCTCAGTGGG - Intronic
964452163 3:156822979-156823001 CGGGTGGGCGTGGGCTTGGCAGG - Intergenic
964751839 3:160060582-160060604 CAGGTGGGCGTGGGCTTGGCGGG + Intergenic
964982526 3:162703226-162703248 CAGGTGGGCGTGGGCTCAGCGGG - Intergenic
964983174 3:162710812-162710834 CGGGTGGGCGTGGGCTTCGTGGG - Intergenic
965003506 3:162987407-162987429 CGGGTGGGCGTGGGCTGGGCGGG + Intergenic
965044158 3:163552623-163552645 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
965092229 3:164179306-164179328 CGGGTGGGCATGGGCTTGGCAGG + Intergenic
965109449 3:164402201-164402223 CGGGTGGGCGTGGTCTTGGCGGG - Intergenic
965200366 3:165649619-165649641 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
965220913 3:165924607-165924629 CGGGTGGGCGTGGGCTTGACAGG - Intergenic
965245263 3:166258770-166258792 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
965288018 3:166842870-166842892 CCGGTGGGCGTGGGCTTGGCGGG + Intergenic
965298108 3:166975892-166975914 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
965342753 3:167510852-167510874 CAGGTGGGGGTATGTTTAGATGG - Intronic
965652336 3:170947281-170947303 CAGGTGGGCGTGGGCTTGGCAGG + Intergenic
965747076 3:171937025-171937047 TAGCCGGGCGTGGGATTAGCAGG + Intronic
965753254 3:171999173-171999195 CGGGTGGGCGTGGGCTTGGTGGG - Intergenic
965757013 3:172038048-172038070 AAGGAGGGAGTGGTTTTAGCCGG + Intergenic
966076048 3:175937433-175937455 CGGGTGTGCGTGGGCTTGGCGGG + Intergenic
966096817 3:176213730-176213752 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
966108233 3:176362525-176362547 CGGGTGGGTGTGGGTTCAGAGGG - Intergenic
966191038 3:177272029-177272051 CGGGTGGGCGGGGGCTTGGCGGG - Intergenic
966372434 3:179263310-179263332 CAGGTGGGCGTGGACTCAGCGGG - Intronic
966724981 3:183100955-183100977 CGGGTGGGCGTGGGCTTGGTGGG + Intronic
967234122 3:187367871-187367893 TGGGTGGGCGTGGGCTTGGCGGG - Intergenic
967448483 3:189596182-189596204 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
967499175 3:190177351-190177373 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
968181620 3:196599339-196599361 CGGGTAGGCGTGGGCTTGGCGGG - Intergenic
968469665 4:773620-773642 CGGGTGGGCGTGGGCTCGGCAGG + Intergenic
968613259 4:1566541-1566563 CGGGTGGGTGTGGCTTTGGCGGG + Intergenic
968613290 4:1566662-1566684 CAGGTGGGTGTGGCTTTGGCGGG + Intergenic
968613321 4:1566783-1566805 CAGGTGGGTGTGGCTTTGGCGGG + Intergenic
968716142 4:2161328-2161350 AGGGTGGGCGTGGGCTTGGCAGG + Intronic
969303177 4:6309327-6309349 CGGGTGGGCGGGGGCTCAGCTGG - Intergenic
969440720 4:7215187-7215209 CGGGTGGGCGTGGGCTTGGAGGG + Intronic
969654995 4:8491711-8491733 CGGGTGGGCGTGGGTTTGGCGGG - Intronic
970391195 4:15614972-15614994 CGGGTGGGCGTGGGCTTGGCGGG + Intronic
970408666 4:15787035-15787057 CAGGTGGGCGTGGGCTCCCCAGG - Intronic
970649350 4:18159571-18159593 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
970673189 4:18418640-18418662 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
970779979 4:19725139-19725161 CAAGTGGCAATGGGTTTAGCTGG + Intergenic
970803503 4:20004070-20004092 CAGGTGGGCGTGGGCTTGGCGGG + Intergenic
970817908 4:20179326-20179348 CAGGTGGGCGTGGACTCAGCAGG - Intergenic
971280553 4:25239534-25239556 CGGGTGGGCATGGGCTTGGCAGG - Intronic
971281703 4:25246917-25246939 CAGGTGGGCATGGGCTGGGCAGG - Intronic
971377138 4:26064281-26064303 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
971564212 4:28117443-28117465 CGGGTGGGCGTGGGCTCGGCGGG - Intergenic
971709439 4:30092766-30092788 CAGATGGGCGTGGGCTTGGCGGG + Intergenic
971792374 4:31185272-31185294 CAGGTGGGTGTGGGCTCAGCGGG - Intergenic
971811934 4:31438710-31438732 CGGGTGGGCGTGGGCTTGGTGGG + Intergenic
971905216 4:32716527-32716549 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
972022805 4:34335943-34335965 CGGCTGGGCGTGGGCTTGGCGGG - Intergenic
972505800 4:39718804-39718826 CAGGTGGGCGTGGGCTTGGCGGG - Intronic
972900107 4:43672416-43672438 CGGGTGGGCGTGGGCTTGGTGGG + Intergenic
973037079 4:45420221-45420243 CGGGTTGGCGTGGGCTTGGCAGG + Intergenic
973041823 4:45477652-45477674 CGGGTGGGCGTGGACTCAGCGGG - Intergenic
973308059 4:48675399-48675421 CGGGTGGGCGTGGGCTTGCCAGG + Intronic
973817560 4:54632595-54632617 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
973854096 4:54993573-54993595 CAGGTGGGCGTGGGCTAGGCAGG + Intergenic
974089904 4:57300471-57300493 CGGGTGGGCATGGGCTCAGCAGG - Intergenic
974128979 4:57730080-57730102 CAGGTGGGAGTGGGCTTGGCGGG - Intergenic
974147397 4:57965483-57965505 CGGATGGGCGTGGGCTTGGCGGG + Intergenic
974147687 4:57967253-57967275 CAGGTGGGTGTGGGCTTGGCAGG + Intergenic
974207428 4:58724194-58724216 CAGGTGGGCATGGGCTTGGTGGG + Intergenic
974484811 4:62492198-62492220 CGAGTGGGCGTGGGCTTGGCGGG - Intergenic
974641763 4:64640775-64640797 CCGGTGGGCGTGGGCTTGGCGGG - Intergenic
974781769 4:66561783-66561805 CGGGTGGGCGTGGACTTGGCAGG - Intergenic
974804362 4:66860227-66860249 TGGGTGGGCGTGGGCTTGGCGGG + Intergenic
974827734 4:67151938-67151960 CCGGTGGGCGTGGGCTTGGCGGG + Intergenic
974992895 4:69115545-69115567 CGGGTGGGCGTGGGCTTGGCCGG - Intronic
975055384 4:69923950-69923972 CGGGTGGGCGTGGGCTTGGTGGG + Intergenic
975596388 4:76050959-76050981 CGGGTAGGCGTGGGCTTGGCGGG - Intronic
975994923 4:80302896-80302918 CAGGTGGGCGTGGGCTTGGTGGG + Intronic
976520651 4:86021910-86021932 CAGGTAGGCGTGGGCTTGGCGGG - Intronic
976646886 4:87396248-87396270 CGGGTGGGCGTGGGCTTGGTGGG - Intergenic
976846053 4:89490115-89490137 CAGGTGGGCGTGGGCTCGGCAGG + Intergenic
977416646 4:96742577-96742599 CGGGTGGGCATGGGCTTGGCGGG + Intergenic
977470724 4:97438387-97438409 CGGGTGGGCATGGGATCAGCGGG - Intronic
977717371 4:100196822-100196844 CGGGTGGGCGTGGGCTTGGCCGG - Intergenic
977750986 4:100609067-100609089 TGGGTGGGCGTGGGCTTGGCGGG - Intronic
977885783 4:102250590-102250612 CCGGTGGGCGTGGGCTCGGCGGG - Intergenic
977906462 4:102483185-102483207 CAGGTGAGCATGGGCTTGGCAGG + Intergenic
978466232 4:109012532-109012554 CAGGTGGGCGCGGGCTTGGCGGG + Intronic
978595655 4:110374428-110374450 AAGATGGGAGTGGCTTTAGCGGG + Intronic
978999595 4:115200496-115200518 CGGGTGGGCGTGGGCTTGGCAGG - Intergenic
979224164 4:118265607-118265629 CGGGTGGGCGTGGGCTCCGCGGG + Intergenic
979290839 4:118977351-118977373 CGGGTGGGCGTGGGGTTGGCAGG - Intronic
979424770 4:120551039-120551061 CGGGTGGGCGTGGGCTTGGTGGG - Intergenic
979445687 4:120808868-120808890 CAGGTGGGCGTGGGCTAGGTGGG - Intronic
979608996 4:122670275-122670297 CAGGTGGGCGTGGGCTCGACGGG + Intergenic
979678632 4:123435671-123435693 CAGGTGGGCGTGGGCTCGGCAGG - Intergenic
979688565 4:123537975-123537997 CGGGTGGGCGTGGGCTCGGCGGG + Intergenic
979825727 4:125229893-125229915 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
979829336 4:125281007-125281029 CAGGTGGGCATGGGCTCAGCGGG + Intergenic
979857523 4:125652031-125652053 CCGGTGGGCGTGGGCTCGGCAGG - Intergenic
979899731 4:126201592-126201614 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
979991444 4:127379993-127380015 CGGGTGGGCGTGGGCTTGGTGGG + Intergenic
980043404 4:127964539-127964561 CGAGTGGGCGTGGGCTTGGCGGG - Intronic
980051955 4:128047860-128047882 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
980115200 4:128672721-128672743 CGGGTGGGCATGGGCTTGGCGGG + Intergenic
980230274 4:130038844-130038866 CGGGTGGGCGTGAGCTTGGCGGG - Intergenic
980470248 4:133240710-133240732 CGGGTGGGTGTGGGCTTGGCGGG - Intergenic
980628575 4:135406677-135406699 CGGGTGGGCGTGGGCTTGGTGGG + Intergenic
980774470 4:137421079-137421101 TGGGTGGGCGTGGGCTTGGCGGG + Intergenic
980815532 4:137942129-137942151 CAGGTGGGCGTGGGCTTGGTGGG + Intergenic
980827338 4:138088871-138088893 TAGGTGGGCGTGGGCTCGGCGGG - Intergenic
981146795 4:141333495-141333517 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
981169585 4:141605694-141605716 TGGGTGGGCGTGGGCTTGGCAGG - Intergenic
981275801 4:142897558-142897580 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
982024331 4:151236291-151236313 CAGGTGTGCGTGGGTTCCGCGGG + Intronic
982408205 4:155044362-155044384 CTGGTGGGCGTGGGCTTGGCGGG + Intergenic
982679077 4:158408126-158408148 CGGGTGGGCGTGGGCTTGGCGGG + Intronic
982770123 4:159390017-159390039 CAGGTGGGCACGGGCTCAGCGGG + Intergenic
982814605 4:159869336-159869358 TGGGTGGGCGTGGGCTTGGCGGG - Intergenic
982816742 4:159895190-159895212 CTGGTGGGCGTGTTTTTAACAGG + Intergenic
982868832 4:160550419-160550441 CGGGTGGGCGTGGGCTTGGCAGG - Intergenic
982921244 4:161277301-161277323 CGGGTGGGCGTGGTCTTGGCGGG + Intergenic
983026077 4:162739599-162739621 CGGGCGGGCGGGGGCTTAGCGGG + Intergenic
983064105 4:163190007-163190029 TGGGTGGGCGTGGGCTTGGCGGG - Intergenic
983230680 4:165126239-165126261 GGGGTGGGCGTGGGCTTGGCAGG - Intronic
983290685 4:165799688-165799710 CGGGTGGGCGTGGGCTCAGCAGG - Intergenic
983553077 4:169036137-169036159 CGGGTGGGCGTGGGCTTGGCTGG - Intergenic
983656718 4:170091288-170091310 CGGGTGGGCGTGGGCTTGGCGGG + Intronic
983660660 4:170127903-170127925 CAGGTGGGCATGGGCTCGGCAGG - Intergenic
983752823 4:171298333-171298355 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
984192859 4:176625465-176625487 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
984238840 4:177193496-177193518 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
984662229 4:182386619-182386641 CGGGTGGGCGTGGGCTTGGCGGG + Intronic
984805366 4:183746741-183746763 CAGGTGGGCGTGGGCTCGGCAGG - Intergenic
984948744 4:184990390-184990412 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
984959074 4:185077025-185077047 CAGATGGACCTAGGTTTAGCTGG + Intergenic
985145412 4:186890173-186890195 CGGGTGGGCGTGGGCTCAGCGGG + Intergenic
985195196 4:187421250-187421272 TGGGTGGGCGTGGGCTTGGCGGG - Intergenic
985203230 4:187505689-187505711 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
985333689 4:188869021-188869043 CAGGTGGGGGTGGGATTTGTAGG - Intergenic
985366379 4:189236366-189236388 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
985403891 4:189616947-189616969 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
985428558 4:189855534-189855556 CAGGTGGGTATGGTGTTAGCTGG + Intergenic
986034283 5:3923438-3923460 CAGGTGTGCGTGGAGATAGCAGG + Intergenic
986151981 5:5137844-5137866 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
986912409 5:12574246-12574268 CGGGTGGGCGTGGGCTTGGTGGG - Intergenic
986993260 5:13578570-13578592 CGGGTGGGCGTGGGCTCGGCGGG + Intergenic
987084493 5:14456171-14456193 CAGGTGGGCGTGTGCTCAGCGGG - Intronic
987146272 5:14994107-14994129 CGGGTGGGCGTGGGCTTGGAGGG - Intergenic
987315274 5:16718010-16718032 CGGGTGGGCGTGGGCTTGGTGGG + Intronic
987347450 5:16991240-16991262 CAGGTAGGCGTGGGCTCGGCTGG - Intergenic
987352299 5:17032694-17032716 CCGGTGGGCGTGGGCTCGGCGGG - Intergenic
987355837 5:17062290-17062312 CAGGTGGGCGTGGGCTCCGTGGG + Intergenic
987384034 5:17312074-17312096 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
987476720 5:18399974-18399996 CCGGTGGGCGTGGGCTTGGCCGG - Intergenic
987532806 5:19143072-19143094 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
987543807 5:19287803-19287825 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
987896273 5:23951355-23951377 CGGGTGGGCGTGGGCTTGGCGGG + Intronic
987990264 5:25200324-25200346 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
988073468 5:26324480-26324502 CGGGTGGGCGTGGGCTTGGAGGG + Intergenic
988132137 5:27119956-27119978 CGGGTGGGCGTGGGCTTGGTGGG + Intronic
988143078 5:27267499-27267521 CGGGTGGGCGTGGGCTCGGCAGG - Intergenic
988155076 5:27439752-27439774 CGGGTGGGCGTGGGCTTGGTGGG - Intergenic
988369221 5:30345787-30345809 CGGGTGGGTGTGGGCTTGGCGGG + Intergenic
988591408 5:32553071-32553093 TGGGTGGGCATGGGCTTAGCAGG - Intronic
988684756 5:33515688-33515710 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
988883566 5:35531685-35531707 CAGGTGGGCGTAGGCTTGGCGGG + Intergenic
988915916 5:35893169-35893191 CGGGTGGGCGTGGGCTTGGTGGG - Intergenic
989346777 5:40438718-40438740 CGGGTGGGCGTCGGCTTGGCGGG + Intergenic
989559658 5:42836427-42836449 CTGGTGGGCGCGGGCTCAGCAGG + Intronic
989965808 5:50465073-50465095 CGGGTGGGCGTGGGCTTGGCAGG + Intergenic
990323200 5:54649323-54649345 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
990869457 5:60415515-60415537 CCGGTGGGCGTGGGCTTGGTGGG + Intronic
990880214 5:60530399-60530421 TGGGTGGGCGTGGGCTCAGCAGG + Intergenic
991567590 5:68020705-68020727 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
992050343 5:72935297-72935319 CGGGTGGGCGTGGGCTCAGCGGG + Intergenic
992296720 5:75333744-75333766 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
992947429 5:81823781-81823803 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
993031846 5:82714739-82714761 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
993320954 5:86466982-86467004 CAGGTGGGCATGGGCTCAGCGGG - Intergenic
993529210 5:89003919-89003941 CGGATGGGCGTGGGCTTGGCGGG - Intergenic
993678616 5:90847774-90847796 CGGGTGGGCGTGGGCTCAGTGGG - Intronic
993770262 5:91917336-91917358 CGGGTGGGCGTGGGCTTGGCAGG + Intergenic
993822014 5:92631392-92631414 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
994096320 5:95851226-95851248 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
994229945 5:97301207-97301229 CAGCTGGGCATGGGTTTGGCGGG + Intergenic
994507090 5:100656822-100656844 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
994509861 5:100689168-100689190 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
994605623 5:101962747-101962769 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
994620319 5:102154999-102155021 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
994669732 5:102752126-102752148 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
994769808 5:103966626-103966648 CGGGTGGGCGTGGGCTTGGCAGG - Intergenic
995032300 5:107494304-107494326 CGGGTGGGCGTGGGCTTGGCGGG + Intronic
995112390 5:108442340-108442362 TGGGTGGGCGTGGGCTTGGCGGG - Intergenic
995568656 5:113457203-113457225 CAGGTGGGCCTGGGCTTGGCGGG + Intronic
995596470 5:113753419-113753441 CGGGTGGGCGTGGGCTTGGTGGG - Intergenic
995656488 5:114432740-114432762 CGGGTGGGCGTGGGCTTGGCAGG + Intronic
995679891 5:114704590-114704612 CGGGTGGGCATGGGCTTGGCGGG - Intergenic
995920377 5:117304720-117304742 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
995975789 5:118033838-118033860 CGGGTGGGCGTGGGCTTAGCGGG + Intergenic
996107026 5:119517163-119517185 TGGGTGGGCGTGGGCTTGGCGGG + Intronic
996234202 5:121107236-121107258 CGGGTGGGCGTGGGCTTGGCAGG + Intergenic
996298578 5:121954253-121954275 CGGGTGGGCGCAGGTTTGGCGGG - Intergenic
996435670 5:123430606-123430628 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
996478714 5:123949489-123949511 CGGGTGGGCATGGGCTTGGCAGG - Intergenic
996567175 5:124892475-124892497 CGGGTGGGCGTGGGCTCCGCAGG + Intergenic
996585981 5:125088762-125088784 CGGGTGGGCGTGGGCTCGGCGGG + Intergenic
996747119 5:126854832-126854854 CGGGTGGGCGTGGGCTCGGCAGG - Intergenic
996815556 5:127569514-127569536 CGGGTGGGCGTGGGCTCGGCGGG + Intergenic
997158217 5:131580335-131580357 CGGGTGGGCGTGGGCTTGGTGGG - Intronic
997375484 5:133394412-133394434 CAGGTGGGCATGGGCTTGGTGGG + Intronic
997623714 5:135317766-135317788 CAGGTGGGTGTGGGTGTTGGTGG + Intronic
999348531 5:150845523-150845545 CGGGTGGGCGTGGGCTCAGCGGG + Intergenic
999855305 5:155587052-155587074 CAGGTGGGCGTGGGCTTGGCAGG - Intergenic
1000066012 5:157693897-157693919 CAGGTGGGCGTGGGCTTGGCAGG + Intergenic
1000084725 5:157879349-157879371 CGGGTGGGCATGGGCTCAGCAGG + Intergenic
1000085848 5:157886915-157886937 CAGGTGGGTGTGGGCTTGGCAGG + Intergenic
1000212345 5:159119232-159119254 CGGGTGGGCGTGGGCTCGGCGGG + Intergenic
1000329212 5:160194198-160194220 CCGGTGGGCGTGGGCTTGGTGGG - Intronic
1000547590 5:162621902-162621924 TGGGTGGGCGTGGGCTTGGCAGG + Intergenic
1000889335 5:166784799-166784821 CGGGCGGGCGTGGGCTCAGCAGG - Intergenic
1000902505 5:166927248-166927270 CGGGTGGGCGTGGGCTCGGCGGG - Intergenic
1001636426 5:173213504-173213526 TGGGTGGGCGTGGGATTGGCGGG + Intergenic
1002004656 5:176222326-176222348 CGGGTAGGCGTGGGCTTGGCGGG - Intergenic
1002757993 6:179632-179654 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1002758000 6:179651-179673 CGGGTGGGCGTGGGCTTGGTGGG + Intergenic
1002789398 6:426502-426524 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1002793188 6:450045-450067 CGGGTGGGCGTGGGCTTGGCTGG + Intergenic
1002817689 6:694686-694708 TGGGTGGGCGTGGGCTCAGCGGG + Intergenic
1002907045 6:1457272-1457294 AGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1003060704 6:2860203-2860225 CGGGTGGACGTGGGCTTGGCGGG + Intergenic
1003069650 6:2935868-2935890 CGGGTGGGCGTGGGGTTGGCGGG + Intergenic
1003070202 6:2939689-2939711 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1003081892 6:3027761-3027783 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1003100170 6:3170825-3170847 CAGGTGGGCGTGGGCTTGGTGGG + Intergenic
1003170870 6:3721066-3721088 CGGGTGGGCCTGGGCTTGGCGGG - Intergenic
1003178466 6:3771697-3771719 CGGGTGGGCGTGGGCTTTGCGGG + Intergenic
1003213731 6:4090201-4090223 CGGGTGGGCGTGGGCTCGGCAGG + Intronic
1003224485 6:4191590-4191612 CAGGTGGGCGTGGACTTGGCAGG - Intergenic
1003284870 6:4725608-4725630 CGGGTGGGCGTGGGCTCGGCGGG - Intronic
1003489240 6:6606727-6606749 CGGGTGGGCGTGGGCTCAGCGGG - Intronic
1003490045 6:6613549-6613571 CCGGTGGGCGTGGGATCGGCGGG - Intronic
1003508857 6:6762781-6762803 CGGGTGGGCGTGGGTTTGGCGGG - Intergenic
1003578021 6:7315280-7315302 CGGGTGGGCGTGGGCTTGGCGGG + Intronic
1003578310 6:7317035-7317057 CGGGTGGGCGTGGGCTTGGCGGG - Intronic
1003581425 6:7344276-7344298 CGGGTAGGCGTGGGCTTGGCGGG + Intronic
1003671519 6:8164396-8164418 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1003747990 6:9024337-9024359 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1003749560 6:9040818-9040840 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1003770178 6:9290737-9290759 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1003836231 6:10074979-10075001 CGGGTGGGCGTGGGCTCGGCGGG - Intronic
1003845711 6:10171782-10171804 CGGGTGGGCATGGGCTTGGCGGG + Intronic
1003901571 6:10659945-10659967 CGGGTGGGCGTGGGCTTGGCTGG + Intergenic
1003908108 6:10720653-10720675 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1003947260 6:11087276-11087298 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1003982488 6:11402883-11402905 CCGGTGGGCGTGGGCTTGGCGGG - Intergenic
1003983992 6:11417295-11417317 CGGGTGGGCGTGGGCTCTGCAGG - Intergenic
1004036945 6:11933140-11933162 CGGGTGGGCGTGGTCTTGGCGGG + Intergenic
1004053173 6:12108691-12108713 CGGGTGGGCGTGGGCTTGGCGGG - Intronic
1004196605 6:13511331-13511353 CGGGTGGGCGTGGGCTCAGCGGG - Intergenic
1004200244 6:13541600-13541622 CGGGTAGGCGTGGGCTTGGCGGG + Intergenic
1004224379 6:13772549-13772571 CAGGTGGGCGTGGGCTTGGCGGG + Intergenic
1004233727 6:13855018-13855040 CGGTTGGGCGTAGGTTTGGCAGG - Intergenic
1004235562 6:13872223-13872245 CGCGTGGGCGTGGGCTTGGCGGG - Intergenic
1004452408 6:15759059-15759081 CGGGTGGGCGTGGGCTTGGCAGG - Intergenic
1004483241 6:16040619-16040641 TGGGTGGGCGTGGGCTTGGCAGG - Intergenic
1004486289 6:16069488-16069510 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1004499692 6:16198391-16198413 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1004502109 6:16218298-16218320 CGGGTGGGCGTGGGCTTGGCTGG - Intergenic
1004511627 6:16288313-16288335 CGGGTGGGTGTGGGCTTGGCAGG + Intronic
1004663294 6:17728819-17728841 CGGGTGGGCGTGGGCTCGGCGGG + Intergenic
1004665546 6:17745608-17745630 CGGGTGGGCGCGGGCTTGGCGGG - Intergenic
1004689113 6:17976489-17976511 TGGGTGGGCGTGGGCTTGGCGGG - Intronic
1004861397 6:19807269-19807291 CAGGTGGGCGTGGGCTTGGCAGG - Intergenic
1004905417 6:20233277-20233299 CAGGTGGGCGTGGGCTCGGCGGG + Intergenic
1004906954 6:20245071-20245093 CAGGTGGGCGTGGGCTTGGCGGG - Intergenic
1004908500 6:20259627-20259649 CGGGTGGGCGTGGGCTCAGCGGG + Intergenic
1005042280 6:21610162-21610184 CGGGTGGGCGTGGGCTTGGCCGG - Intergenic
1005059263 6:21761218-21761240 CAGGTGGGTGTGGGCTCGGCGGG + Intergenic
1005106775 6:22232298-22232320 CAACTGGGCCTGGGTTTGGCTGG - Intergenic
1005117750 6:22356710-22356732 CAGGTGGGTGTGGGCTCAGCAGG - Intergenic
1005332900 6:24766237-24766259 CGGGTGGGCGTGGGCTTGGTGGG - Intergenic
1005561424 6:27045345-27045367 CGGGTGGGCGTGGGCTCGGCAGG + Intergenic
1005600895 6:27425129-27425151 CGGGAGGGCGTGGGCTTGGCGGG - Intergenic
1005712001 6:28511898-28511920 CACGTGGGAGTGGGCTCAGCGGG + Intronic
1005749082 6:28866741-28866763 CGGGTGGGCGTGGGCTCGGCGGG - Intergenic
1005749951 6:28872894-28872916 CGGGTGGGCGTGGGCTTGGTGGG - Intergenic
1005758913 6:28950094-28950116 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1005759787 6:28957904-28957926 CGGGTGGGCGTGGGCTTGGTGGG + Intergenic
1005977025 6:30807743-30807765 CGGGTGGGCGTGGGCTTGGAGGG - Intergenic
1005978260 6:30816599-30816621 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1006005759 6:31000549-31000571 CGGGTGGGCGTGGGCTTGGCTGG + Intergenic
1006033617 6:31195520-31195542 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1006352621 6:33532449-33532471 CAGGTGGGCGTGGGCTTGGTGGG + Intergenic
1006477811 6:34269085-34269107 CGGGTGGGCGTGGGCTTGGTGGG + Intergenic
1006695991 6:35931326-35931348 CAGGTGGGCGTGGGCTTGGCGGG + Intergenic
1006748921 6:36364533-36364555 CGGGTGAGCGTGGGCTTGGCGGG - Intronic
1006978385 6:38124620-38124642 CAGATGGGCATGGGCTTGGCGGG - Intronic
1007897402 6:45377484-45377506 CGGGTGGGCGTGGGGTGAGGGGG - Intronic
1008005613 6:46406067-46406089 TGGGTGGGCGTGGGCTTGGCGGG - Intronic
1008038761 6:46774658-46774680 TGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1008270208 6:49482125-49482147 CCGGTGGGTGTGGGCTTGGCAGG - Intronic
1008270512 6:49483718-49483740 CAGGTGGGCGTGGGTTTAGCAGG - Intronic
1008770977 6:54979295-54979317 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1009407119 6:63326755-63326777 TGGGTGGGCGTGGGCTTGGCAGG - Intergenic
1009418848 6:63443246-63443268 CAGGTGGGCGCGGGCTCGGCAGG - Intergenic
1009470261 6:64023836-64023858 CAGGTGGGCGTGGGCTCAGTGGG + Intronic
1009615514 6:65999667-65999689 CAGGTGGACGTGGCCTCAGCGGG - Intergenic
1009800707 6:68533493-68533515 TGGGTGGGCGTGGGCTCAGCAGG + Intergenic
1009872244 6:69467261-69467283 CAGATGGGCGTGGGCTTGGTGGG + Intergenic
1010235671 6:73572837-73572859 CGGGTGGGCGTGGACTTGGCAGG - Intergenic
1010617360 6:78029858-78029880 CGGGTGGGCGTGGGCTTGGTGGG + Intergenic
1011246503 6:85326038-85326060 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1011601593 6:89065083-89065105 CAGGGGGGCGTGGGTTTGGTGGG + Intergenic
1011974748 6:93282706-93282728 CCGGTGGGCGTGGGCTCGGCGGG + Intronic
1012131272 6:95497002-95497024 CAGGTGGGCACGGGATCAGCAGG + Intergenic
1012189362 6:96261246-96261268 TGGGTGGGCGTGGGCTTTGCGGG - Intergenic
1012598841 6:101070322-101070344 CTGGTGGGCGTGGGCTTGGCAGG + Intergenic
1012760522 6:103294704-103294726 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1013081506 6:106817063-106817085 CGGGTGGGCGTGGGCTTGGTGGG - Intergenic
1013143588 6:107364546-107364568 CGGGTGGGCGTGGGCTTGGTGGG - Intronic
1013410796 6:109881442-109881464 TGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1013853358 6:114541984-114542006 CAGGTGGGTGTGGGCTCCGCAGG - Intergenic
1013957226 6:115855255-115855277 CAGGTGGGCGCGGGCTTGGCGGG + Intergenic
1013960072 6:115889164-115889186 CGGGTGGGCGTGGGCTTGGCCGG + Intergenic
1014055867 6:117014820-117014842 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1014507743 6:122280640-122280662 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1014718543 6:124892032-124892054 CGGGTGGGCGTGGGCTTGGCAGG + Intergenic
1014738977 6:125125912-125125934 CGGGTGGGTGTGGGCTTGGCAGG + Intronic
1014921092 6:127214891-127214913 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1015572275 6:134633846-134633868 TGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1015600326 6:134904790-134904812 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1016067392 6:139698216-139698238 CGGGTGGGCCTGGGCTTGGCGGG - Intergenic
1016069908 6:139726649-139726671 CAGGTGGGCGTGGGCTTGGCGGG - Intergenic
1016858940 6:148698345-148698367 CGGGTGGGCGTGGGCTTTGTAGG - Intergenic
1017298963 6:152834403-152834425 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1017310058 6:152966230-152966252 CGGGTGGGCGTGGGCTCAGTGGG - Intergenic
1017325066 6:153133681-153133703 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1017581244 6:155867056-155867078 TAGGTGGGCGTGGGCTTGGCGGG - Intergenic
1018545654 6:164933359-164933381 CGGGTGGGCGTGGGCTTCGCAGG + Intergenic
1018624667 6:165765587-165765609 CAGGTGGGCGTGGGCTTGGCGGG - Intronic
1019000285 6:168744086-168744108 CGGGTGGGCGTGGACTTGGCGGG - Intergenic
1019281588 7:203047-203069 TAGGTGGGAGAGGGCTTAGCAGG + Intronic
1019618372 7:1977417-1977439 TGGGTGGGCGTGGGCTTGGCGGG - Intronic
1019944292 7:4314239-4314261 CGGGTGGGCGTGGGCTTGGTGGG - Intergenic
1019965774 7:4497231-4497253 CGGGTGGGCGTGGGTTTGGCGGG - Intergenic
1020375367 7:7478845-7478867 CGGGTGGGCATGGGCTTGGCGGG - Intronic
1020552295 7:9621747-9621769 CGGGTGGGCGTGGGTTCGACAGG - Intergenic
1020662214 7:10995828-10995850 CGGGTGGGCATGGGCTTGGCGGG - Intronic
1021324103 7:19245543-19245565 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1021513833 7:21461546-21461568 CGGGTGGGTGTGGGCTTGGCGGG - Intronic
1021520717 7:21536836-21536858 CGGGTGGGCGTGGGCTCTGCAGG - Intergenic
1021567905 7:22032625-22032647 CGGGTGGGTGTGGGCTTGGCAGG - Intergenic
1022750415 7:33219033-33219055 CGGGTGGGTGTGGGCTTGGCGGG + Intronic
1023396226 7:39754240-39754262 CAGGTGGGCGTGGGCTTGGCGGG - Intergenic
1024269054 7:47628536-47628558 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1024335661 7:48203218-48203240 CCGGTGCGCGTGGGCTTGGCGGG - Intronic
1024691255 7:51805894-51805916 CTGGTGGGCGTGGGCTTGGCAGG + Intergenic
1024700658 7:51901196-51901218 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1024834024 7:53495080-53495102 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1024903959 7:54354621-54354643 CCGGTGGGCGTGGGTGTGTCTGG + Intergenic
1025962093 7:66231641-66231663 CGGGTGGGCGTGGACTTGGCGGG - Intronic
1026010090 7:66629348-66629370 CAGGTGGGCGGGGGAGTTGCAGG - Intronic
1026187112 7:68090715-68090737 TGGGTGGGCGTGGGCTTGGCCGG - Intergenic
1026202925 7:68231090-68231112 CGGGTGGGCGTGGGCTTGGTGGG + Intergenic
1026237018 7:68535401-68535423 CGGGTGGGCGTGGGCTCAGAGGG - Intergenic
1026335878 7:69393888-69393910 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1026512320 7:71037654-71037676 AGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1026596580 7:71738380-71738402 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1027238031 7:76309738-76309760 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1027561647 7:79739359-79739381 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1027564062 7:79768265-79768287 TGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1027668729 7:81071168-81071190 CAGGTGGGCATGGGCTCGGCGGG + Intergenic
1027868075 7:83673377-83673399 CAGGTGGGCGTGGGCTTGGCGGG + Intergenic
1028070070 7:86440626-86440648 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1028142480 7:87288783-87288805 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1028303314 7:89229029-89229051 CAGGTGGGCGTGGGCTCCGCGGG - Intronic
1028392647 7:90334480-90334502 TGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1028511242 7:91627694-91627716 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1028727158 7:94100951-94100973 CGGGTGGGCGTGGGCTTGGTGGG + Intergenic
1028852543 7:95552767-95552789 CGGGTGGGTGTGGGCTTGGCGGG - Intergenic
1029407070 7:100381787-100381809 TGGGTGGGCGTGGGCTTGGCGGG + Intronic
1029567490 7:101348634-101348656 TGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1029635959 7:101783922-101783944 CAGGTGGGTGTGGGGTTGGATGG + Intergenic
1029832395 7:103275226-103275248 CGGGTGGGCGTGGGCTTGGTGGG - Intergenic
1029988144 7:104940216-104940238 CGGGTGGGTGTGGGCTCAGCGGG + Intergenic
1030102137 7:105956058-105956080 CAGGTGGGTGTGGGCTCGGCGGG - Intronic
1030292674 7:107888046-107888068 CGGGTGGGCGTGGGCTTGGTGGG + Intergenic
1030506952 7:110436598-110436620 CAGCTGGTCGTGGTTTTACCTGG - Intergenic
1030600004 7:111582244-111582266 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1030733460 7:113017402-113017424 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1030780392 7:113593379-113593401 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1030819336 7:114077144-114077166 CCGGTGGGCCTGGGCTTGGCGGG - Intergenic
1030980700 7:116182223-116182245 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1031253153 7:119413629-119413651 CAGGTGGGTGTGGGCTTGGCAGG - Intergenic
1031378776 7:121060029-121060051 CGGGTGGGCGTGGGCTTGGCGGG + Intronic
1031409190 7:121421789-121421811 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1031605539 7:123763472-123763494 CGGGTGGGCGTGGGCTCGGCGGG - Intergenic
1031902843 7:127429225-127429247 CGGGTGGGCGTGGGCTCAGCAGG + Intronic
1032248054 7:130230081-130230103 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1032561627 7:132898908-132898930 CGGGTGGGTGTGGGCTTGGCGGG - Intronic
1033394105 7:140957245-140957267 CGGGTGGGTGTGGGCTTGGCGGG - Intergenic
1033464062 7:141575020-141575042 CAAGTGGGGTTAGGTTTAGCTGG + Intronic
1033664126 7:143424698-143424720 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1033758619 7:144418199-144418221 CAGGTGGGCGTGGGCTCGGCGGG - Intergenic
1033779303 7:144650479-144650501 CAGGTGGGTGTGGGCTCAGCGGG + Intronic
1033866659 7:145697670-145697692 CGGGTGGGCGTGGGCTCCGCGGG - Intergenic
1034091021 7:148363867-148363889 CGGGTGGGCGTGGGCTTGGTGGG + Intronic
1034154996 7:148949140-148949162 CGGGTGGGCGTGGGCTTGGTGGG + Intergenic
1034562267 7:151888611-151888633 GTGGTGGGAGTGGGTTCAGCTGG - Intergenic
1034656064 7:152730577-152730599 CGGGTGGGCGTGGTCTTGGCGGG - Intergenic
1034928470 7:155141794-155141816 CCTGTGGGCGTGGGCTCAGCTGG - Intergenic
1035151206 7:156874305-156874327 CGGGTGGGCGTGGGCTTGGTGGG - Intronic
1035356602 7:158279635-158279657 CGGGTGGGCACGGGCTTAGCGGG - Intronic
1035999222 8:4582886-4582908 CGGGTGGGCGTGGGCTTGGCTGG + Intronic
1036135043 8:6152766-6152788 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1036441056 8:8781693-8781715 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1036693586 8:10960204-10960226 CAGGTGGGTGCAGGTATAGCAGG + Intronic
1036693597 8:10960261-10960283 CAGGTGGGTGCAGGTATAGCAGG + Intronic
1036801350 8:11794864-11794886 CGGGTGGGCGTGGGCTCGGCGGG + Intergenic
1036914957 8:12796354-12796376 CGGGTGGGCGTGGGCTTGGTAGG + Intergenic
1037241530 8:16783965-16783987 CGGGTGGGCGTGGGCTTGGTGGG + Intergenic
1037263865 8:17037119-17037141 CAGGTGGGCGTGGGCTTGGCAGG - Intronic
1037558935 8:20054850-20054872 TGGGTGGGCGTGGGCTCAGCAGG + Intergenic
1037616133 8:20520375-20520397 CAGGAAGGCCTGGGTTTAGAGGG + Intergenic
1037810951 8:22086613-22086635 CGGGTGGGCTTGGGCTTGGCGGG + Intergenic
1037957577 8:23071087-23071109 CGGGTGGGCGTGGGCTCGGCGGG - Intergenic
1037971363 8:23174102-23174124 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1038174049 8:25164555-25164577 CAGGTGGGCGTGGGCTTGGTGGG + Intergenic
1038639382 8:29311524-29311546 CAGGTGGGTGTGGGCTTGGCGGG + Intergenic
1039069137 8:33634134-33634156 CGTGTGGGCGTGGGCTTGGCGGG - Intergenic
1039587599 8:38719924-38719946 CGGGTGGGCATGGGCTTGGCGGG + Intergenic
1039637277 8:39180173-39180195 CGGGTGGGCGTGGGCTTGGCGGG + Intronic
1040003716 8:42600363-42600385 CAGGTGGGCATGGGCTCAGCGGG - Intergenic
1040027675 8:42796662-42796684 CAGGTGGGCGTCGGCTCGGCAGG + Intergenic
1040408496 8:47132817-47132839 CAGGTGGGCGTGGGCTTCCCTGG - Intergenic
1040622259 8:49103320-49103342 CAGGTGGGCATGGGCTTGGCTGG - Intergenic
1040804324 8:51377576-51377598 CGGGTGGGCGTGGGCTCAGCTGG + Intronic
1040952869 8:52953872-52953894 CGGGTGGGCGTGGGCTTGGCAGG + Intergenic
1040965595 8:53077929-53077951 CAGGTGGGCGCGGGCTTGGCGGG - Intergenic
1041034680 8:53776200-53776222 TGGGTGGGCGTGGGCTTGGCGGG - Intronic
1041068518 8:54104303-54104325 CGGGTGGGCGTGGGCTCGGCGGG + Intergenic
1041604365 8:59762256-59762278 CGGGTGGGCGTGGGCTCCGCGGG - Intergenic
1041623533 8:59999923-59999945 CAGGTGGGCATGGGCTCAGTGGG + Intergenic
1041636696 8:60153257-60153279 CGGGTGGGCGTGGGCTCTGCGGG - Intergenic
1041918909 8:63162048-63162070 CGGGTGGGCGTGGGCTTGGTAGG + Intergenic
1042225371 8:66511057-66511079 CAGGTGGGCTTGGCTGTAGAGGG - Intronic
1042512589 8:69626773-69626795 CGGATGGGCGTGGGCTTGGCTGG - Intronic
1043073372 8:75665766-75665788 CAGGTGGGCGTGGACTTGGCGGG - Intergenic
1043110100 8:76169667-76169689 CAGGTGGGCGTGGGATTGGCGGG + Intergenic
1043129962 8:76447915-76447937 TGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1043224050 8:77700784-77700806 CAGGTGGGCGTGGGCTCCGCAGG + Intergenic
1043346438 8:79303553-79303575 CCGGTGGGCGTGGGCTTGGCGGG + Intergenic
1043352511 8:79377506-79377528 CGGGTGGGCTTGGGCTTGGCGGG - Intergenic
1043435300 8:80231867-80231889 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1043640149 8:82441481-82441503 CGGGTGGGCGTGGGCTTAGCGGG + Intergenic
1044075801 8:87820893-87820915 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1044088467 8:87971206-87971228 CGGGTGGGCGTGGGCTCGGCGGG + Intergenic
1044302898 8:90606398-90606420 CAGGTGGGCGCGGGCTCAGCGGG - Intergenic
1044456021 8:92393861-92393883 CAGGTGGGTGTGGGCTCAGCAGG - Intergenic
1044633498 8:94300635-94300657 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1044788660 8:95823697-95823719 CAGGTGGGCGTGGGCTTGGCGGG + Intergenic
1044862171 8:96534111-96534133 CAGGTGGGCGTGGGCTCGGCAGG - Intronic
1044880684 8:96719387-96719409 CGGGTGGGCGTGGGCTTGGCGGG - Intronic
1045055701 8:98366708-98366730 CAGGTGGGGGTGGGTGGAGCAGG - Intergenic
1045467784 8:102485813-102485835 CGAGTGGGCGTGGGCTTGGCGGG - Intergenic
1046149371 8:110202872-110202894 CGGGTGGGCGTAGGCTTGGCGGG - Intergenic
1046265413 8:111823584-111823606 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1046445313 8:114311410-114311432 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1046450692 8:114386215-114386237 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1047100196 8:121667714-121667736 CGGGTGGGCGTAGGCTTGGCGGG - Intergenic
1047124716 8:121948095-121948117 CGGGTGGGCGTGGGCTTGGTGGG + Intergenic
1047631728 8:126714938-126714960 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1048676985 8:136794092-136794114 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1048757525 8:137755422-137755444 CGGGTGGGCGTGGGCTTGGCAGG - Intergenic
1048789149 8:138084194-138084216 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1049087662 8:140490816-140490838 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1049157687 8:141076746-141076768 CGGGTGGGCGTGGGCTCAGTGGG + Intergenic
1049857918 8:144875229-144875251 CGGGTGGGCATGGGCTCAGCAGG + Intergenic
1050249936 9:3733871-3733893 CGGGTGGGCGTGGGCTCAGCGGG + Intergenic
1050294888 9:4195356-4195378 TGGGTGGGCGTGGGCTTGGCCGG + Intronic
1051305113 9:15700343-15700365 CGGGTGGGCGTGGGCTTGGCGGG - Intronic
1051314214 9:15810705-15810727 CGGGTGGGCGTGGGCTCGGCAGG - Intronic
1051383281 9:16480567-16480589 CGGGTGGGCGTGGGCTTGGCGGG + Intronic
1051439836 9:17072664-17072686 TGGGTGGGCGTGGGCTTGGCAGG + Intergenic
1051929074 9:22363774-22363796 CGGGTGGGCGTGGGCTCGGCGGG - Intergenic
1052075432 9:24135145-24135167 CAGATGGGCGTGGGCTTGGCGGG + Intergenic
1052979523 9:34437983-34438005 CGAGTGGGCGTGGGCTTGGCGGG + Intronic
1052985371 9:34483066-34483088 CGGGTGGGCGTGGGCTTGGTGGG - Intronic
1053027309 9:34740538-34740560 CAGGTGGGCGTGGGCTTGGCGGG - Intergenic
1053393385 9:37751937-37751959 CGGGTGGGCGTGGGCTTGGCGGG + Intronic
1053436078 9:38075436-38075458 CGGGTGGGCGTGGGGTCAGCGGG + Intergenic
1053475226 9:38377637-38377659 CGGGTGGGCGTGGGCTCGGCGGG + Intergenic
1053547939 9:39042659-39042681 CGGGTGGGCATGGGCTTGGCGGG - Intergenic
1054722425 9:68617082-68617104 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1055049338 9:71963598-71963620 CGGGTGGGCGTGGGCTTGGCGGG + Intronic
1055102590 9:72480503-72480525 CGGGTGGGCGTGGGCTCGGCAGG - Intergenic
1055557602 9:77490684-77490706 CGGGTGGGCGTGGGCTTGGCAGG - Intronic
1055651349 9:78410056-78410078 TGGGTGGGCGTTGGCTTAGCGGG + Intergenic
1055814188 9:80185598-80185620 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1055925599 9:81507432-81507454 CAGGTGGGCGAGGGCTCAGCGGG + Intergenic
1056080988 9:83093608-83093630 CGGGTGGGCATGGGCTTGGCGGG - Intergenic
1056216251 9:84408538-84408560 CAAGTGGGCGTGGGCTTGGCGGG + Intergenic
1056743725 9:89282484-89282506 CGGGTGGGCGTGGTCTTGGCGGG + Intergenic
1056771419 9:89480720-89480742 CGGGTGGGCGTGGGCTTGGTGGG - Intronic
1056913999 9:90729532-90729554 CAGGTGCGCGTGGGCTTGGCGGG + Intergenic
1056921742 9:90796654-90796676 ATGGTGGGGGTGGGCTTAGCTGG - Intergenic
1057118148 9:92545330-92545352 TGGGTGGGCGTGGGCTTGGCGGG + Intronic
1057300686 9:93880000-93880022 CGGGTGGGCATGGGCTTGGCTGG + Intergenic
1057383944 9:94591445-94591467 CGGGTGGGCGTGGGCTTGGCGGG - Intronic
1057511114 9:95680389-95680411 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1058174894 9:101724417-101724439 TGGGTGGGCGTGGGCTTGGCGGG - Intronic
1058286543 9:103186971-103186993 CGCGTGGGCGTGGGCTTGGCAGG + Intergenic
1058365164 9:104200653-104200675 CAGGTGGGCGTGGGCTTGGCGGG + Intergenic
1058727500 9:107817852-107817874 CGGGTGGGCGTGGGCTCAGCGGG + Intergenic
1058786471 9:108393564-108393586 CGGATGGGCGTGGGCTTGGCGGG + Intergenic
1059810595 9:117852085-117852107 CGGGTGGGCGTGGGCTTCGTGGG + Intergenic
1059991584 9:119870584-119870606 CGGGTGGGCGTGGGCTTGGTGGG - Intergenic
1061052481 9:128204530-128204552 CAAAGGGTCGTGGGTTTAGCGGG + Intronic
1061483804 9:130910179-130910201 CAGGTGGGCATGGGCTTGGCGGG + Intronic
1062639256 9:137509306-137509328 CTGGTGTGAGTGAGTTTAGCTGG + Intronic
1062639272 9:137509572-137509594 CTGGTGTGAGTGAGTTTAGCTGG + Intronic
1203662896 Un_KI270753v1:61672-61694 CAGGTGGGCGTGGGCTCCGCGGG - Intergenic
1185891105 X:3822681-3822703 CAGGTGGGCTTGGGGTGAGTGGG + Intronic
1185896208 X:3861097-3861119 CAGGTGGGCTTGGGGTGAGTGGG + Intergenic
1185901327 X:3899523-3899545 CAGGTGGGCTTGGGGTGAGTGGG + Intergenic
1185906436 X:3937956-3937978 CAGGTGGGCTTGGGGTGAGCGGG + Intergenic
1186152623 X:6690809-6690831 CGGGTGGGCGTGGGCTTGGCTGG - Intergenic
1186282101 X:8003573-8003595 TGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1186293168 X:8121647-8121669 CGGGTGGGCGTGGGGTCAGCGGG + Intergenic
1186295660 X:8145207-8145229 CAGGTGGCCGTGGGTTCAGCCGG - Intergenic
1186323277 X:8452793-8452815 CGGGTGGGCGTGGGCTTGGCAGG - Intergenic
1187304585 X:18083861-18083883 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1187557599 X:20367152-20367174 CGGGTGGGCGTGGGCTTGGTGGG - Intergenic
1187903993 X:24049750-24049772 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1188189506 X:27157063-27157085 CGGGTGGGCATGGGCTTGGCGGG + Intergenic
1189209816 X:39275675-39275697 CAGGTGGGCGTGGGCTTGGCAGG + Intergenic
1189896855 X:45665070-45665092 CAGGTGGGTGTGGGCTCAGCGGG - Intergenic
1190045896 X:47111306-47111328 TGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1190413991 X:50163632-50163654 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1191053928 X:56222854-56222876 CGGGTGGGCGTGGGCTGGGCTGG - Intergenic
1192116151 X:68413419-68413441 CATGTGGGTGTGGGTGTAGAGGG - Intronic
1192186742 X:68952219-68952241 CAGGTGGACGTGGGCTTGGCGGG + Intergenic
1192869683 X:75173900-75173922 CGGGTAGGCGTGGGCTTGGCGGG - Intergenic
1193538183 X:82738506-82738528 CGGGTGGGCGTGGGCTTGGTGGG - Intergenic
1193708984 X:84856905-84856927 CAGGTGGGTGTGGGCTTGGCGGG - Intergenic
1193719965 X:84974952-84974974 CAGGTGGGCGTGGGCTCGGCAGG + Intergenic
1193804070 X:85972660-85972682 CGGGTGGGCGTGGGCTTGGCGGG - Intronic
1194071620 X:89331332-89331354 CGGGTGGGCGTGGGCTTGGTGGG - Intergenic
1194118055 X:89926837-89926859 CGGGTGGGCGTGGGCTTGGCAGG - Intergenic
1194384359 X:93235789-93235811 TGGGTGGGCGTGGGGTTAGCGGG + Intergenic
1195258055 X:103107652-103107674 CAGGTGGGCGTGGGCTTGGCAGG - Intergenic
1195909621 X:109876151-109876173 CAGGTGGGCGTGGGCTCAGCGGG - Intergenic
1196319558 X:114270862-114270884 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1196582669 X:117394739-117394761 CGAGTGGGCGTGGGCTTGGCGGG + Intergenic
1196705941 X:118717242-118717264 CGGGTGGGCGTGGGCTTGGAGGG - Intergenic
1196714588 X:118799014-118799036 CGGGTGGGCATGGGCTTGGCGGG + Intergenic
1196741498 X:119029572-119029594 CCGGTGGGCGTGGGCTTGGGGGG + Intergenic
1196762368 X:119211182-119211204 CCCGTGGGCGTGGGTTTGGCGGG - Intergenic
1196775180 X:119331932-119331954 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1196775481 X:119333653-119333675 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1196781489 X:119387887-119387909 CAGGTGGGCGTGGGCTTGGCTGG - Intergenic
1196794006 X:119488166-119488188 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1196827303 X:119751131-119751153 TGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1196845033 X:119890649-119890671 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1197340026 X:125255705-125255727 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1197376826 X:125690882-125690904 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1197533796 X:127663272-127663294 CGGGTGGGCGTGGGCTCAGCGGG - Intergenic
1197607901 X:128606663-128606685 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1198060893 X:133044435-133044457 CGGGTGGGCATGGGCTTGGCAGG + Intronic
1198256110 X:134925701-134925723 CAGGTGGGCGTGGGCTCGACGGG + Intergenic
1198299958 X:135325512-135325534 CGGGTGGGCATGGGCTTGGCGGG + Intronic
1198533784 X:137567766-137567788 CAGGCGGGCGTGGGTTCCACTGG + Intronic
1198664335 X:139004328-139004350 CGGGTGGGCGTGGGCTTGGCGGG - Intronic
1198972617 X:142298548-142298570 CGGGTGGACGTGGGCTTGGCGGG - Intergenic
1199009966 X:142746026-142746048 CGGGTGGGCATGGGCTTGGCGGG - Intergenic
1199028823 X:142972439-142972461 CGGGTGGGCGTGGGCTTGGTGGG - Intergenic
1199050252 X:143228993-143229015 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1199175516 X:144783691-144783713 CAGGTGGGCGTGGGCTTGGCGGG + Intergenic
1199285116 X:146046458-146046480 CGGGTGGGCGTGGGCTCGGCGGG - Intergenic
1199356274 X:146867184-146867206 CAGGTGGGCGTGGGCTTGGCAGG - Intergenic
1199833049 X:151563082-151563104 CGGGTGGACGTGGGCTCAGCGGG - Intergenic
1199951653 X:152711946-152711968 CAGGTAGGCGAGTGTTTAACTGG + Intergenic
1199958030 X:152756502-152756524 CAGGTAGGCGAGTGTTTAACTGG - Intergenic
1200053914 X:153448844-153448866 CAGGTGGGCGGGGGCACAGCCGG - Intronic
1200824322 Y:7622519-7622541 CGGGTGGGCGTGGGCTTGGTGGG - Intergenic
1200888655 Y:8298675-8298697 TGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1201423068 Y:13820507-13820529 CGGGTGGGTGTGGGCTTGGCGGG - Intergenic
1201468321 Y:14309345-14309367 CAGGTGGGCGTGGGCTCGGCAGG + Intergenic
1201469092 Y:14314549-14314571 CAGGTGGATGTGGGCTCAGCGGG + Intergenic
1201479910 Y:14428148-14428170 CGGGTGGGCGTGGGCTTGGTGGG + Intergenic
1201487048 Y:14505709-14505731 CCGGTGGGCGTGGGCTTGGTGGG + Intergenic
1201488137 Y:14512872-14512894 CAGGTGAGCGTGGGCTTGGTGGG + Intergenic
1201495713 Y:14590086-14590108 CGGGTGGGCGTGGGCTTGGCGGG - Intronic
1201496959 Y:14598499-14598521 TGGGTGGGCGTGGGCTTGGCTGG - Intronic
1201715780 Y:17043165-17043187 CGGGTGGGCGTGGGCTTGGCGGG + Intergenic
1202109817 Y:21407259-21407281 CAGGTGGGCGTGGGCTTGGCGGG + Intergenic
1202137121 Y:21676965-21676987 CGGGTGGGCGTGGGCTTGGCGGG - Intergenic
1202235733 Y:22708568-22708590 CGGGTGGGCGTGGGCTTGGTGGG + Intergenic
1202272681 Y:23086065-23086087 CGGGTGGGTGTGGGCTTGGCAGG - Intergenic
1202293345 Y:23334617-23334639 CGGGTGGGTGTGGGCTTGGCAGG + Intergenic
1202307430 Y:23487600-23487622 CGGGTGGGCGTGGGCTTGGTGGG - Intergenic
1202425678 Y:24719809-24719831 CGGGTGGGTGTGGGCTTGGCAGG - Intergenic
1202445111 Y:24950276-24950298 CGGGTGGGTGTGGGCTTGGCAGG + Intergenic
1202563375 Y:26182986-26183008 CGGGTGGGCGTGGGCTTGGTGGG + Intergenic