ID: 1008270514

View in Genome Browser
Species Human (GRCh38)
Location 6:49483727-49483749
Sequence CTGTAGTTCCAGGTGGGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1618
Summary {0: 1, 1: 56, 2: 503, 3: 406, 4: 652}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008270514_1008270522 7 Left 1008270514 6:49483727-49483749 CCCACGCCCACCTGGAACTACAG 0: 1
1: 56
2: 503
3: 406
4: 652
Right 1008270522 6:49483757-49483779 GCAAGCACCGGGCGCAGCCCCGG 0: 2
1: 63
2: 258
3: 487
4: 608
1008270514_1008270520 -4 Left 1008270514 6:49483727-49483749 CCCACGCCCACCTGGAACTACAG 0: 1
1: 56
2: 503
3: 406
4: 652
Right 1008270520 6:49483746-49483768 ACAGCTGACCTGCAAGCACCGGG No data
1008270514_1008270519 -5 Left 1008270514 6:49483727-49483749 CCCACGCCCACCTGGAACTACAG 0: 1
1: 56
2: 503
3: 406
4: 652
Right 1008270519 6:49483745-49483767 TACAGCTGACCTGCAAGCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008270514 Original CRISPR CTGTAGTTCCAGGTGGGCGT GGG (reversed) Intronic
900113297 1:1018623-1018645 CTGGAGTTCCGAGTGGGCGTGGG - Intergenic
900561885 1:3311258-3311280 TTGTTGTTCCCGGTGGGCCTCGG + Intronic
900607358 1:3529835-3529857 CTATAAGTCCAGGTGGGCTTCGG - Intronic
901045998 1:6396041-6396063 GGCGAGTTCCAGGTGGGCGTGGG - Intergenic
901285565 1:8075922-8075944 CTGGAGCTCCAGGTGGGAGGTGG + Intergenic
901601499 1:10426671-10426693 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
901783319 1:11608806-11608828 CTGGAGTTCCGGGTGGGCATGGG + Intergenic
902100450 1:13983474-13983496 CTAGAGTTCCAGGTGGTCGTGGG - Intergenic
902527940 1:17071395-17071417 CTGTACTTCCAGGTGAGGGCAGG - Exonic
902963980 1:19984763-19984785 CGCAAGTTCCGGGTGGGCGTGGG - Intergenic
903624583 1:24721573-24721595 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
905375607 1:37518300-37518322 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
905742868 1:40387901-40387923 CTGGAGTTCCGGGTGGGCATGGG + Intronic
905761169 1:40559183-40559205 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
905943864 1:41885541-41885563 CTGTAGTTCCAGCTACGCGGAGG + Intronic
906031400 1:42723105-42723127 CTGTAGTCCCAGGCGGGACTCGG + Intergenic
906083235 1:43107821-43107843 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
906563534 1:46778817-46778839 CTGGAGTTCCGGGTGGGCATGGG - Intronic
906876124 1:49541382-49541404 CATGAGTTCCAGGTGGGCATGGG + Intronic
907102254 1:51847678-51847700 CTAGAGTTCCAGGTGGGCGTGGG - Intronic
907371167 1:54004535-54004557 CGCAAGTTCCGGGTGGGCGTGGG - Intergenic
907889471 1:58623480-58623502 CTGGAGTTCCGGGTGGGCGTCGG + Intergenic
908027778 1:59969976-59969998 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
908291312 1:62669938-62669960 CTGGAGTTCCGGGTGGGCGTGGG + Intronic
908301077 1:62761562-62761584 CATGAGTTCCAGGTGGGCGCTGG + Intergenic
908888566 1:68817769-68817791 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
909318569 1:74253658-74253680 CTAGAGTTCTGGGTGGGCGTGGG - Intronic
909377097 1:74952359-74952381 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
909904589 1:81178923-81178945 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
910034789 1:82777093-82777115 CTGGAGTTCCAGGTGGGCGTGGG - Intergenic
910550259 1:88467105-88467127 CTAGAGTTCCGGATGGGCGTGGG + Intergenic
910685730 1:89914270-89914292 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
910693156 1:89984929-89984951 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
911001434 1:93170317-93170339 CTCGAGTTCCGGGTGGGCGTGGG + Intronic
911205905 1:95091439-95091461 CTGGAGTTCCGGGTGGGCGTAGG + Intergenic
911259624 1:95669939-95669961 CTGGAGTTCCGGGTGGGTGTGGG - Intergenic
911839274 1:102660324-102660346 CTGGAGTTCCGGGTGGGCGTTGG - Intergenic
911954515 1:104217756-104217778 CTGGAGTTCCGGGTGGGCATGGG - Intergenic
912166127 1:107044804-107044826 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
912312902 1:108641172-108641194 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
912527724 1:110297122-110297144 CTGTAATTCCAGATGGACGGAGG + Intergenic
912538782 1:110396649-110396671 CTAGAGTTCCGGGTGGGTGTGGG - Intergenic
913161087 1:116146867-116146889 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
913252940 1:116927233-116927255 GTGTAGTTCCAGGTTAGGGTTGG - Intronic
913468987 1:119171596-119171618 CGTGAGTTCCAGGTGGGCATGGG + Intergenic
913692136 1:121289416-121289438 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
913987082 1:143575142-143575164 CTGGAGTTCCGGGTGGGCATGGG + Intergenic
913996398 1:143654491-143654513 CTGAAGCTCCAGGAGGGCGAGGG - Intergenic
914145419 1:144990698-144990720 CTGGAGTTCCGGGTGGGCTTGGG + Intronic
914203452 1:145506164-145506186 CCGGAGTTCAGGGTGGGCGTGGG - Intergenic
914438464 1:147681078-147681100 CTGGAGTTCTGGGTGGGCGTGGG - Intergenic
914482574 1:148079318-148079340 CCGGAGTTCAGGGTGGGCGTGGG - Intergenic
914928038 1:151906185-151906207 CTGGAGTTCCAGGTGGGTGTGGG + Intronic
915104104 1:153521835-153521857 CTGGAGTTCCGGGTGGGTGTGGG + Intergenic
915242340 1:154532385-154532407 CTAGAGTTCTGGGTGGGCGTGGG - Intronic
915260028 1:154670799-154670821 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
915261198 1:154678086-154678108 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
915495144 1:156277125-156277147 CTGCAGTTCCAGCTGGTAGTGGG + Exonic
915666131 1:157446592-157446614 CTGGATTTCCGGGTGGGCGTGGG - Intergenic
915764510 1:158349300-158349322 CTGGAGTGCAGGGTGGGCGTGGG - Intergenic
915865579 1:159494920-159494942 CTGGAGTTCCGAGTGGGCGTGGG - Intergenic
916606065 1:166343343-166343365 CCCGAGTTGCAGGTGGGCGTGGG - Intergenic
916910134 1:169337389-169337411 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
916960259 1:169882160-169882182 CTGGAGTTCTGGGTGGGCGTGGG + Intronic
916991645 1:170251049-170251071 TGCAAGTTCCAGGTGGGCGTGGG - Intergenic
917406241 1:174711149-174711171 CGTGAGTTCCGGGTGGGCGTGGG - Intronic
917445430 1:175102612-175102634 CTGGAGTTCTAGGTGGGCATGGG - Intronic
917446385 1:175108769-175108791 CTGGAGTTCTAGGTGGGCATGGG - Intronic
917578573 1:176349582-176349604 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
917860494 1:179138889-179138911 CTGGAGTTCCGGGTGGGCGTGGG + Intronic
917933024 1:179837242-179837264 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
918058979 1:181045883-181045905 CTGGAGTTCCAAGTGGGCGTGGG + Intronic
918659781 1:187074128-187074150 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
918708919 1:187703669-187703691 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
918720811 1:187850250-187850272 CCAGAGTTCCGGGTGGGCGTGGG + Intergenic
918732317 1:188013595-188013617 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
918789949 1:188813136-188813158 CTAGAGTTCCGGGTGGGCGTGGG + Intergenic
918792064 1:188841486-188841508 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
918993871 1:191731863-191731885 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
919049811 1:192499372-192499394 CGTGAGTTCCGGGTGGGCGTGGG - Intergenic
919091878 1:192986959-192986981 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
919167976 1:193919224-193919246 CTGGAGTTCCGGGTGGCCGTGGG - Intergenic
919174446 1:194001890-194001912 CTGGAGTTCCCGGTGGGCGTGGG + Intergenic
919237016 1:194859115-194859137 TTGGAGTTCCGGGTGGGCGTGGG + Intergenic
919727407 1:200893406-200893428 CTCCAGCTCCAGGTGGGGGTTGG - Intronic
920150204 1:203900285-203900307 CTAGAGTTCCGGGTGGGCGTGGG + Intergenic
920326275 1:205167275-205167297 CTGTAGTCCCAGGTGTGCAGGGG + Intronic
920479460 1:206307764-206307786 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
920573399 1:207035529-207035551 CTGCAGTCCCAGGTGCTCGTGGG + Intronic
920731391 1:208488750-208488772 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
920756656 1:208739727-208739749 CTGGAGTTCTGGGTGGGCGTGGG + Intergenic
920878482 1:209858962-209858984 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
920883172 1:209899112-209899134 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
921094452 1:211874604-211874626 CTAGAGTTCCAGATGGGTGTGGG - Intergenic
921096265 1:211889597-211889619 CGCGAGTTCCAGGTGGGCGTGGG + Intergenic
921396411 1:214673458-214673480 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
921801782 1:219410700-219410722 CTGGAGTTCCTGGTGGGCGTGGG + Intergenic
921897072 1:220412480-220412502 CTGGAGTTCTGGGTGGGTGTGGG + Intergenic
921903871 1:220476006-220476028 CTGGAGTTCTGGGTGGGCGTGGG - Intergenic
921983701 1:221285970-221285992 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
922056806 1:222049795-222049817 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
922417053 1:225431414-225431436 TGCAAGTTCCAGGTGGGCGTGGG + Intergenic
922423187 1:225472755-225472777 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
922485402 1:225969818-225969840 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
922546832 1:226464246-226464268 TGCGAGTTCCAGGTGGGCGTGGG + Intergenic
922855769 1:228773754-228773776 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
923157257 1:231289787-231289809 CTGGAGTTCTGGGTGGGCGTGGG - Intergenic
923324833 1:232871756-232871778 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
923353158 1:233129172-233129194 CTAGAGTTCCGGATGGGCGTGGG + Intronic
923573786 1:235140333-235140355 CTGGAGTTCCAGGTGGGCGTGGG + Intronic
923930101 1:238684942-238684964 CTGGAGTTCCAGGTGGGCATGGG - Intergenic
924117497 1:240762539-240762561 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
924219260 1:241855889-241855911 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
1063148979 10:3320139-3320161 CTCGAGTTCTGGGTGGGCGTGGG - Intergenic
1063318756 10:5032829-5032851 CTGGAGTTCCCGGTGGGCAGGGG - Intronic
1063322195 10:5060953-5060975 CGTGAGTTCCAGGTGGGCATGGG - Intronic
1063368666 10:5507229-5507251 GTGTAGTTCCAGGGGAGGGTTGG + Intergenic
1064004540 10:11689624-11689646 CTGTAGTTCCAGCTACTCGTGGG - Intergenic
1064197765 10:13259654-13259676 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1064449235 10:15426387-15426409 CACGAGTTCCGGGTGGGCGTGGG - Intergenic
1064790380 10:18951589-18951611 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1065441312 10:25756047-25756069 CTGGAGTTCCAGGTGGGCGTGGG + Intergenic
1065554878 10:26905594-26905616 CGCGAGTTCCAGGTGGGTGTGGG + Intergenic
1065590295 10:27256528-27256550 CGTGAGTTCCGGGTGGGCGTGGG + Intergenic
1065743304 10:28815985-28816007 CTGGAGTTCCGGGTGAGCGTGGG - Intergenic
1065752190 10:28897088-28897110 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
1065981592 10:30903110-30903132 CTAGAGTTCCGGGTGGGCGTGGG - Intronic
1065995480 10:31055872-31055894 CTAGAGTTCTGGGTGGGCGTGGG + Intergenic
1066186279 10:33013340-33013362 GTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1066190236 10:33049274-33049296 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1066234020 10:33468082-33468104 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1066267769 10:33792791-33792813 CTGTAGTCCCAGCTGGGCTGAGG + Intergenic
1066544266 10:36482308-36482330 CTGGAGTTCCAGGTGGGCGTGGG - Intergenic
1066567425 10:36734931-36734953 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1066597066 10:37062516-37062538 CGGGAGTTCCAGGTGGGCGTGGG + Intergenic
1066598190 10:37076056-37076078 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
1066648482 10:37634521-37634543 CGTGAGTTCCAGGTGGGCGCGGG + Intergenic
1067363166 10:45600792-45600814 CTGGAGTTCCCGGTGGGAGTGGG + Intergenic
1068216647 10:53990860-53990882 CACGAGTTCCAGGTGGGTGTGGG + Intronic
1068455517 10:57249888-57249910 CTGGAGTTCTGGGTGGGCATGGG + Intergenic
1068460350 10:57321569-57321591 CGCAAGTTCCAGGTGGGCGTGGG + Intergenic
1068863145 10:61867693-61867715 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1068902090 10:62280426-62280448 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1068978113 10:63033637-63033659 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1069186547 10:65429728-65429750 CTGGAGTTCTGGGTGGGCGTGGG - Intergenic
1069396862 10:67998860-67998882 CTGTAGTCCCAGCTGCTCGTTGG - Intronic
1069499665 10:68940254-68940276 CTGTAGTTCCAGATGCTTGTGGG + Intronic
1069988652 10:72300657-72300679 CGCGAGTTCCCGGTGGGCGTGGG + Intergenic
1069992946 10:72326004-72326026 CTAGAGTTCCGGGTGGGCGTGGG + Intergenic
1070121453 10:73581214-73581236 CTGGAGTTCGAGGTGAGCGTGGG + Intronic
1070937871 10:80315480-80315502 CGCGAGTTCCAGGTGGGCATAGG + Intergenic
1070953172 10:80446997-80447019 CAGGAGTTCCAGGTGAGCCTGGG - Intergenic
1070973362 10:80585926-80585948 CTGGATTTCTGGGTGGGCGTGGG + Intronic
1071003732 10:80859284-80859306 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1071037504 10:81265226-81265248 CTGGAGTTCTGGGTGGGTGTGGG - Intergenic
1071085380 10:81862999-81863021 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1071387979 10:85141448-85141470 CTGGAGTTCCAGGTGGGCATGGG + Intergenic
1071797085 10:89018887-89018909 CATGAGTTCCAGGTGGGCGTGGG - Intergenic
1071963803 10:90832487-90832509 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
1072278475 10:93845241-93845263 CTCTAGTTCCAGGTGGGCGTGGG + Intergenic
1073635763 10:105196972-105196994 CTGAAGTTCCAGGTGTTCTTTGG + Intronic
1073789793 10:106928405-106928427 CTGGAGTTCCGGGTGGGCGCGGG - Intronic
1074098107 10:110331507-110331529 CACGAGTTCCGGGTGGGCGTGGG + Intergenic
1074316988 10:112369836-112369858 CGAGAGTTCCGGGTGGGCGTGGG + Intergenic
1074999208 10:118782951-118782973 CTGGAGTTCCAGGTGGGCGTGGG + Intergenic
1075255595 10:120923873-120923895 CTGAAGTTCCGGGTGGGCGTGGG + Intergenic
1075269402 10:121035651-121035673 CTGGAGTTCCGGGTGCGCGTGGG - Intergenic
1075305697 10:121365626-121365648 CCCGAGTTCCAGGTGGGCGTGGG + Intergenic
1075349453 10:121710680-121710702 GTGGAGTTGCAGGTGGGGGTGGG + Intergenic
1075376046 10:121978691-121978713 CTAGAGTTCCCTGTGGGCGTGGG - Intergenic
1075505029 10:123013815-123013837 CTAGAGTTCCGGGTGGGCGTGGG - Intronic
1075537553 10:123283666-123283688 CTAGAGTTCCAGGTGGGCGTGGG - Intergenic
1075995643 10:126874093-126874115 CTGGAGTTCCAGGAGGAGGTGGG - Intergenic
1076261683 10:129071664-129071686 CTGGAGTTCCGGGTGGACGTGGG - Intergenic
1076273531 10:129177034-129177056 CAGTAGTTTCAGGTGAGCCTGGG + Intergenic
1076773590 10:132680710-132680732 CTGGATTTCCGGGTGGGCGTGGG + Intronic
1076796557 10:132801248-132801270 CTGGATTTCCGGGTGGGCGTGGG - Intergenic
1077110638 11:860585-860607 CTGGTGTTGCAGGTGGGGGTGGG + Intronic
1077603224 11:3588776-3588798 CTGGAGTTCTGGGTGGGCGTGGG + Intergenic
1077764568 11:5144463-5144485 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
1077805738 11:5589928-5589950 CTGGAGTTCCGGGTGGGCGTGGG + Intronic
1077815593 11:5682996-5683018 CTGGAGTTCCGGGTGGGCGTGGG + Intronic
1078251920 11:9623349-9623371 CTGGAGTTCCGGGTGTGCGTGGG - Intergenic
1078301223 11:10133616-10133638 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
1078387364 11:10904170-10904192 CTGTAGTTCCAGCTAGTCGGGGG - Intergenic
1078743716 11:14091639-14091661 CTGGAGTTCTGGGTGGGCGTGGG - Intronic
1078795798 11:14591111-14591133 CTGGAGTTCCAGGTGGGCATGGG + Intronic
1078891309 11:15560972-15560994 CTAGAGTTCCAGATGGGCCTGGG + Intergenic
1079191001 11:18276404-18276426 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
1079555438 11:21753410-21753432 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1079726242 11:23883743-23883765 CTGGAGTTCTGGGTGGGCGTGGG - Intergenic
1079730587 11:23935036-23935058 CTGGAGTTCTGGGTGGGCGTGGG - Intergenic
1079731778 11:23942589-23942611 CTGGAGTTCTGGGTGGGCGTGGG - Intergenic
1079767805 11:24416331-24416353 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1080012117 11:27470879-27470901 CTGTATTTCCAGGTGGGTGGTGG - Intronic
1080106044 11:28512643-28512665 CTGGAGTTCTGGGTGGGCATGGG - Intergenic
1080107517 11:28526095-28526117 CTGGAGCTCCAGATGGGCATGGG - Intergenic
1080195220 11:29600458-29600480 CTGGCGTTCCGGGTGGGCGTGGG - Intergenic
1080557716 11:33432055-33432077 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1080621422 11:33990148-33990170 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1081125038 11:39311877-39311899 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1081126961 11:39333379-39333401 CTGGAGTTCTAGGTGGGCGTGGG - Intergenic
1081324487 11:41728395-41728417 CTAGAGTTCCGGGTGGGTGTGGG - Intergenic
1081329734 11:41788538-41788560 CTGGGGCTCCAGGTGGGCGTGGG - Intergenic
1081420873 11:42873967-42873989 CTGGAGTTGCGGGTGGGCGTGGG + Intergenic
1081422046 11:42881432-42881454 GTGGAGTTCTGGGTGGGCGTGGG + Intergenic
1081428357 11:42949925-42949947 CTGGAGTTCCGGGTGGGCATGGG + Intergenic
1082272093 11:50183321-50183343 CTGGAGTTCCGGGTGGGCATGGG + Intergenic
1082698784 11:56402231-56402253 CTGGAGTTCTGGGTGGGAGTGGG - Intergenic
1083207263 11:61160294-61160316 CTGTAGTTCCGGGTGGGATCGGG - Intronic
1083546088 11:63550254-63550276 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1084024767 11:66441045-66441067 CGCAAGTTCCGGGTGGGCGTGGG - Intronic
1084089421 11:66870347-66870369 CTGCGGGTCCAGGTGGGCGGCGG + Exonic
1084107385 11:66988843-66988865 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1084186629 11:67476141-67476163 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
1084210435 11:67619085-67619107 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1084259120 11:67963318-67963340 CTGGAGTTCTGGGTGGGGGTGGG + Intergenic
1084406101 11:68974552-68974574 CTGGAGTTCCAGGTGCGAGTGGG - Intergenic
1084813649 11:71631860-71631882 CTGGAGTTCTGGGTGGGCGTGGG - Intergenic
1085245578 11:75098255-75098277 CTGGAGTTCTGGGTGGGCGTGGG + Intergenic
1085375860 11:76060614-76060636 CTGGAGTTCCGGGTGGGCGTGGG + Intronic
1085447269 11:76609341-76609363 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1085757115 11:79211013-79211035 GTGTGGTTCCAGGTTGGGGTCGG - Intronic
1085863102 11:80257611-80257633 CGTGAGTTCCGGGTGGGCGTGGG + Intergenic
1085941102 11:81207644-81207666 CTAGAGTTCCGGGTGGGCGTGGG + Intergenic
1086034884 11:82403949-82403971 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
1086043009 11:82501208-82501230 CTGGAGTTCTGGGTGGGCGTGGG + Intergenic
1086397771 11:86433833-86433855 CTGGAGTTCCGGGTGGGCATGGG - Intergenic
1086724626 11:90167238-90167260 CGAGAGTTCCGGGTGGGCGTGGG + Intronic
1086807990 11:91268805-91268827 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1086908661 11:92446856-92446878 CTGTAGTTCCAGGTAGTTCTAGG + Intronic
1087354516 11:97076649-97076671 CTGGATTTCCGGGTGGGCGTGGG + Intergenic
1087400988 11:97667130-97667152 GGGGAGTTCCAGGTGGGCGCAGG + Intergenic
1088000934 11:104879558-104879580 ATGTAGTTCCAGGTTAGCTTAGG + Intergenic
1088326932 11:108610306-108610328 CTGTAGTTCCAGGGGGGCCGAGG - Intergenic
1088570852 11:111222027-111222049 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1089062143 11:115634205-115634227 CTGGAGTTCCGGGTGGGCTTGGG - Intergenic
1089373597 11:117978799-117978821 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1089466428 11:118689285-118689307 GTGGAGTTCCGGGTTGGCGTGGG - Intergenic
1089563174 11:119356132-119356154 CCGTGGTGCTAGGTGGGCGTTGG - Exonic
1089800215 11:121021708-121021730 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1089809412 11:121119367-121119389 CTGTTATTCTAGGTGGGAGTTGG - Intronic
1090229198 11:125089546-125089568 CTGGAGTTCCGGGTGGGCATGGG + Intronic
1090307708 11:125705014-125705036 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1090586211 11:128215582-128215604 GGCGAGTTCCAGGTGGGCGTGGG - Intergenic
1090588238 11:128237139-128237161 CGTGAGTTCCGGGTGGGCGTGGG + Intergenic
1090776747 11:129972132-129972154 CTGGAGTTCTGGGTGGGCGTGGG - Intronic
1090782703 11:130021721-130021743 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
1091233476 11:134003174-134003196 CTGGAGTTCCGGGGGGGCGTGGG - Intergenic
1091402267 12:188386-188408 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
1091625814 12:2119914-2119936 CCCCCGTTCCAGGTGGGCGTGGG + Intronic
1091931888 12:4403090-4403112 CTGTGCTTGCAGGTGGGAGTGGG - Intergenic
1092089591 12:5793604-5793626 CTGGAATTCCAGGTGGCCATGGG + Intronic
1092135178 12:6142245-6142267 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1092137406 12:6159525-6159547 CTGGAGTTCAGGGTGGGCGTGGG + Intergenic
1092142130 12:6191182-6191204 CTGGAGTTCCAGGTGGGCGTGGG - Intergenic
1092220273 12:6708358-6708380 CTGGAGTTCCGGGTGGCCGTGGG + Intergenic
1092221376 12:6716085-6716107 CTGGAGTTCCGGGTGGGTGTGGG + Intergenic
1092272903 12:7037474-7037496 CTGGAGTTCCAGGTGGGCGTGGG + Intronic
1092336652 12:7639889-7639911 CTGGAGTTCCGGGGGGGCGTGGG + Intergenic
1092350546 12:7752385-7752407 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1092471746 12:8787315-8787337 CTGGAGTTCCGGGCGGGCGTGGG + Intergenic
1092472939 12:8794772-8794794 CTGGAGTTCCGGGCGGGCGTGGG + Intergenic
1092545879 12:9450696-9450718 CGCGAGTTCCCGGTGGGCGTGGG - Intergenic
1092572446 12:9739888-9739910 CTGGAGTTCCGGGTAGGCGTGGG - Intergenic
1092732449 12:11547341-11547363 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
1092834226 12:12472699-12472721 TGCGAGTTCCAGGTGGGCGTGGG - Intergenic
1093034468 12:14320144-14320166 CTGGAGTTCCGGCTGGGCGTGGG + Intergenic
1093189376 12:16057431-16057453 CTGGAGTTCCGGGTGGGCGGGGG + Intergenic
1093266250 12:17007673-17007695 CTGGACTTCCGGGTGGGCGTGGG + Intergenic
1093346248 12:18040303-18040325 CATGAGTTCCGGGTGGGCGTGGG + Intergenic
1093381542 12:18500195-18500217 CTGGAGTTCCAGGTGGGCGTGGG + Intronic
1093527114 12:20115541-20115563 CTGGAGTTCTGGGTGGGCGTGGG - Intergenic
1093581039 12:20784092-20784114 CTGGAGTTCCAGGTAGTCATGGG - Intergenic
1093583295 12:20807742-20807764 CGCCAGTTCCCGGTGGGCGTGGG - Intergenic
1093652526 12:21661578-21661600 CTAGAGTTCCGGGTGGGAGTGGG + Intronic
1093715491 12:22376953-22376975 CTAGAGTTCCGGGTGGGCGTGGG + Intronic
1093793699 12:23285994-23286016 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
1093921642 12:24866125-24866147 CTGGAGTTCCGGGTGGGAGTGGG + Intronic
1093970187 12:25369415-25369437 CTGGAGTTCCGGGTTGGCGTGGG + Intergenic
1093972934 12:25391477-25391499 CTGGAGTTCCGGGTGGCCGTGGG + Intergenic
1094327539 12:29256692-29256714 CTGGAGTTCCGGGTGGGCGTGGG + Intronic
1094338636 12:29386552-29386574 CTGGAGTTCCCGGTGGGCATGGG - Intergenic
1094409811 12:30156920-30156942 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1094448694 12:30561682-30561704 CTGGAGTTCCGGGTGGGCCTGGG + Intergenic
1094507077 12:31071377-31071399 CGCGAGTTCCCGGTGGGCGTGGG + Intergenic
1094589326 12:31806100-31806122 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1094653256 12:32398303-32398325 CTGTAGTTCCAGCTAGTGGTGGG + Intergenic
1094661257 12:32472340-32472362 CTGGAGTTCCGGGTGGGCGTGGG + Intronic
1094666463 12:32525722-32525744 CTGGAGTTCCAGGTGGGCGTGGG + Intronic
1094718219 12:33034243-33034265 CTGGAGTTCCAGGTGGGTGTGGG - Intergenic
1095123074 12:38442001-38442023 CTGGAGTTCTGGGTGGGCATGGG + Intergenic
1095304131 12:40620705-40620727 CGCGAGTTCCGGGTGGGCGTTGG + Intergenic
1095444982 12:42274014-42274036 CTGGAGTTCCGGGTGGGTGTGGG - Intronic
1095533954 12:43224371-43224393 CGTGAGTTCCGGGTGGGCGTGGG + Intergenic
1095587389 12:43863948-43863970 CTAGAGTTCCGGGTGGGCATGGG + Intronic
1095776682 12:46018067-46018089 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1095901519 12:47333433-47333455 CTGGAGTTCCGGGTGGGCATGGG + Intergenic
1097017950 12:56000455-56000477 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
1097128965 12:56796151-56796173 CTGAAGTTCTGGGTGGGCGTGGG - Intergenic
1097664212 12:62461545-62461567 CTGGAATTCCGGGTGGGCATGGG - Intergenic
1097863746 12:64542971-64542993 ATAGAGTTCCGGGTGGGCGTGGG + Intergenic
1097981993 12:65744408-65744430 CACGAGTTCCGGGTGGGCGTGGG + Intergenic
1098168244 12:67719543-67719565 CTGGAGTTCCGGGTGGGCGGGGG - Intergenic
1098515969 12:71376906-71376928 CTGGAGTTCCGGGTGTGCGTGGG + Intronic
1098588647 12:72185089-72185111 CTGGAGTTCTGGGTGGGCGTGGG + Intronic
1098759217 12:74402995-74403017 CTGGAGTTCCGGCTGGGCGTGGG + Intergenic
1099204331 12:79710986-79711008 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1099228187 12:79993536-79993558 CTAGAGTTCCGGGTGGGCGTGGG - Intergenic
1099443816 12:82728820-82728842 CGCGAGTTCCAGGTGGGCATGGG + Intronic
1099478649 12:83140168-83140190 CCTGAGTTCCGGGTGGGCGTGGG + Intergenic
1099523955 12:83696598-83696620 CTGGAGTTCCAGATGGGCGTGGG - Intergenic
1099559640 12:84155433-84155455 CTGGAGTTGCAGGTGGGCGTGGG - Intergenic
1099790690 12:87330264-87330286 CTGGAGTTCGGGGTGGGCGTGGG + Intergenic
1100142316 12:91633993-91634015 CTAGAGTTCCGGGTTGGCGTGGG + Intergenic
1100166638 12:91924201-91924223 CTGGAGTTCCAGGTGGGCATGGG - Intergenic
1100211910 12:92406830-92406852 CTGGAGTTCCAGGTGGGCGTGGG - Intergenic
1100356829 12:93838883-93838905 CTGTAGTCCCAGGTGCTCGGTGG - Intronic
1100545706 12:95600039-95600061 CTGTAGTTCCAGCTACGCGGAGG + Intergenic
1100584675 12:95969183-95969205 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1100600621 12:96108953-96108975 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
1100734642 12:97513049-97513071 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
1101008964 12:100430350-100430372 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1101021599 12:100559430-100559452 CTGGAATTCCGGGTGGGCGTGGG + Intronic
1101274576 12:103185386-103185408 CTGTAGTTGCAGGTGAACTTAGG + Intergenic
1101461987 12:104905824-104905846 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
1101603824 12:106233070-106233092 CTAGAGTTCCGGGTGGGCATGGG + Intergenic
1102309733 12:111835703-111835725 CTGGAGTTCCAGGTGGGCGTGGG + Intergenic
1102387259 12:112520201-112520223 CGCGAGTTCCTGGTGGGCGTGGG - Intergenic
1102718140 12:114992173-114992195 CTGTGGTTCCAGGTATGCTTGGG + Intergenic
1103146173 12:118597487-118597509 CTAGAGTTCCAGGTGGGTGTGGG - Intergenic
1103439258 12:120950652-120950674 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1103459685 12:121093819-121093841 TGCGAGTTCCAGGTGGGCGTGGG - Intergenic
1103668518 12:122592073-122592095 CTGGAGTTCCGGGTGGATGTGGG + Intronic
1103678733 12:122676909-122676931 CGCGAGTTCCAGGTGGGCGTGGG - Intergenic
1103783420 12:123414425-123414447 CTGGAGTTCCGGGTGGGCGTGGG - Exonic
1103853265 12:123946996-123947018 CTGGAGTTCTGGGTGGGCGTGGG + Intronic
1103893027 12:124254145-124254167 CTGTGAGTTCAGGTGGGCGTGGG + Intronic
1104344468 12:127983430-127983452 CGAGAGTTCCGGGTGGGCGTGGG + Intergenic
1104582615 12:130022103-130022125 CTGGAGTTCCGGGTGGGGGTGGG + Intergenic
1104614543 12:130256966-130256988 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1105037727 12:132938802-132938824 CTGGAGTTCCGGGTGGGCGTGGG + Intronic
1105425617 13:20292465-20292487 CTGGAGTTCCGGGTGAGTGTGGG + Intergenic
1105605180 13:21920968-21920990 CTAGAGTTCCGGGTGGGAGTGGG - Intergenic
1105722154 13:23127620-23127642 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1105763124 13:23531582-23531604 CACGAGTTCCGGGTGGGCGTGGG + Intergenic
1105847855 13:24308502-24308524 CCGTGGTCCCAGGTGGGCGGCGG - Intronic
1105876710 13:24561017-24561039 CTGGAGTTCTGGGTGGGCGTGGG - Intergenic
1106161498 13:27204943-27204965 CTGTGCTTCCAGATGGGGGTGGG + Intergenic
1106221352 13:27748626-27748648 CTGGAGTTCCGGGTGGGCATGGG - Intergenic
1106472818 13:30072772-30072794 GTGTAGCTCCAGGTGGAAGTGGG + Intergenic
1106617090 13:31339978-31340000 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1106643453 13:31609138-31609160 CTGGAGTTCCGGGTGGGTGTGGG - Intergenic
1106810924 13:33358029-33358051 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1107259405 13:38472742-38472764 CTGGAGCTCCGGGTGGGCGAGGG - Intergenic
1107590490 13:41898890-41898912 TTGGAGTTCCGGGTGGGCGTGGG - Intronic
1107836088 13:44413624-44413646 CGTGAGTTCCGGGTGGGCGTGGG + Intergenic
1108099203 13:46936366-46936388 CTGGAGTTCTGGGTGGGCATGGG - Intergenic
1108435315 13:50396643-50396665 CTGGAGTTCCGGGTGGGCGTGGG + Intronic
1108686708 13:52826310-52826332 CTCGAGTTCCGGGTGGGCCTGGG + Intergenic
1108845642 13:54676619-54676641 CGCGAGTTCCAGGTGGGCATGGG + Intergenic
1108851638 13:54737588-54737610 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1108858982 13:54829812-54829834 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1108958217 13:56187569-56187591 CGCGGGTTCCAGGTGGGCGTGGG + Intergenic
1109007725 13:56900751-56900773 CTAGAGTTCTGGGTGGGCGTCGG + Intergenic
1109124724 13:58504538-58504560 CTGGAGTTCTGGGTGGGCATGGG - Intergenic
1109141022 13:58714132-58714154 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1109159897 13:58958494-58958516 CTGGAGTTCTGGGTGGGCGTGGG - Intergenic
1109441341 13:62379275-62379297 CTGGAGTTCCAGGTGGGCGTGGG + Intergenic
1109446637 13:62448210-62448232 CTGGAGTTCCGGGTGGGCGTCGG - Intergenic
1109506130 13:63305796-63305818 CTGGAGTTCTGGGTGGGCGTGGG + Intergenic
1109638114 13:65149884-65149906 GCGGAGTTCCGGGTGGGCGTGGG - Intergenic
1109649501 13:65308127-65308149 CTGTTGTTTCAGGTGAGGGTGGG + Intergenic
1109745793 13:66621997-66622019 CTGGAGTTCCGGGTGGGCGTGGG + Intronic
1109854325 13:68108028-68108050 CGCAAGTTCCAGGTGGGCGTGGG - Intergenic
1110024093 13:70512217-70512239 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1110368840 13:74718440-74718462 CTGGAGTTCTGGGTGGCCGTGGG + Intergenic
1110609837 13:77475766-77475788 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
1110751419 13:79119932-79119954 CGGGAGTTCCAGGTGGGTGTGGG - Intergenic
1110792421 13:79600470-79600492 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1110854225 13:80278931-80278953 CACGAGTTCCGGGTGGGCGTGGG - Intergenic
1110862108 13:80355595-80355617 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1110940323 13:81341082-81341104 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1110999867 13:82165262-82165284 CTGGAATTCCGGGTGGGTGTGGG - Intergenic
1111006617 13:82258008-82258030 CTACCGTTCCGGGTGGGCGTAGG + Intergenic
1111103273 13:83613707-83613729 CATGGGTTCCAGGTGGGCGTGGG - Intergenic
1111441881 13:88291868-88291890 CTGGAGTTCCGGGTGGGCATGGG + Intergenic
1111590999 13:90348649-90348671 CTGCAGTTCCGGGTGGGCGTGGG + Intergenic
1111602707 13:90494868-90494890 CTGGAGTTCCGGGTAGGCATGGG + Intergenic
1111748301 13:92296714-92296736 CTGGAGTTCCGTGTGGGCGTGGG + Intronic
1111831135 13:93331046-93331068 CTGTATTTCCAGGAGGTCTTTGG + Intronic
1111841439 13:93455097-93455119 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
1112077780 13:95931748-95931770 CGCGAGTTCCGGGTGGGCGTGGG - Intronic
1112226474 13:97545325-97545347 CTGGAGTTCCCAGTCGGCGTGGG + Intergenic
1112518618 13:100077564-100077586 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1112533194 13:100224361-100224383 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
1112538250 13:100282495-100282517 CTGGAGTTCCAGGTGGGCGTGGG + Intronic
1112613070 13:100975745-100975767 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1112705829 13:102068523-102068545 CTGGAGTTCCGGGTGGGCATGGG + Intronic
1112842677 13:103600030-103600052 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
1113371978 13:109732966-109732988 CTAGAGTTCCGGGTGGGCGTGGG - Intergenic
1113482710 13:110633341-110633363 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
1113506614 13:110821208-110821230 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1113538159 13:111084184-111084206 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1113678031 13:112221765-112221787 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1114560334 14:23585194-23585216 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1114593509 14:23891805-23891827 CTGGAGTTCCGGGTAGGCGTGGG + Intergenic
1114940928 14:27608898-27608920 CTATAGTTGCAGGTGGACTTTGG - Intergenic
1115118258 14:29909045-29909067 CATGAGTTCCGGGTGGGCGTGGG + Intronic
1115421376 14:33199051-33199073 CGCAAGTTCCAGGTGGGCGTGGG - Intronic
1116251056 14:42482701-42482723 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1116390503 14:44384791-44384813 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1116426498 14:44798638-44798660 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
1116452334 14:45080485-45080507 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1116623990 14:47242492-47242514 CTGGAGTTCCGGGTGGGCGTGGG + Intronic
1116656937 14:47665580-47665602 CTGGAGTTCCGGGTGGGCGTGGG + Intronic
1117077843 14:52122292-52122314 CTGGAGTTCCAGGTGGGCGTGGG + Intergenic
1117082571 14:52166795-52166817 CGTGAGGTCCAGGTGGGCGTGGG + Intergenic
1117297548 14:54393503-54393525 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1117302484 14:54443100-54443122 CTGGAGTTCCGGGTTGGCGTGGG + Intergenic
1117323223 14:54643960-54643982 CTGTAGGTCCAGGAGGGACTCGG + Intronic
1117449793 14:55839557-55839579 CGCGAGTTCCAGGTGGGCGTGGG + Intergenic
1117571950 14:57056927-57056949 CTGGAGTTCCCGGTGGGCGTGGG - Intergenic
1117727360 14:58687565-58687587 CATGAGTTCCAGGTGGGCGTGGG - Intergenic
1117742602 14:58833968-58833990 CGCCAGTTCCGGGTGGGCGTGGG + Intergenic
1117860608 14:60089039-60089061 CTGTATTTCCAACTGGGCATAGG + Intergenic
1118215393 14:63803575-63803597 CTGGAGTTCCGGGCGGGCATGGG - Intergenic
1118306309 14:64658227-64658249 CGCGAGTTCCTGGTGGGCGTGGG + Intergenic
1119027760 14:71167588-71167610 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
1119038814 14:71254344-71254366 CTGGAGTTCCGGGTGGGCGTCGG + Intergenic
1119300345 14:73566645-73566667 CTGGAGTTCCAGGTGGGCATGGG - Intergenic
1119486754 14:74994197-74994219 CTGGAGTTCCGGGTGGGCATGGG + Intergenic
1119673475 14:76537062-76537084 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1120209894 14:81624077-81624099 CTAGAGTTCCGGGTGGGCGTGGG - Intergenic
1120330956 14:83092433-83092455 CTGGAGTTCCAGGTAGGCGTGGG + Intergenic
1120429777 14:84399676-84399698 CTCGAGTTCCGGGTGAGCGTGGG - Intergenic
1120439136 14:84513220-84513242 CTGGAGTTCTGGGTGGGTGTGGG - Intergenic
1120632332 14:86905742-86905764 CTAGAGTTCCGGGTGGGCGTGGG - Intergenic
1120844137 14:89111696-89111718 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1121350676 14:93170395-93170417 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1121511570 14:94516617-94516639 CTGTGGTTCCAGGTAAGAGTTGG - Intronic
1122216555 14:100208470-100208492 ATAGAGTTCCGGGTGGGCGTGGG - Intergenic
1122493483 14:102135822-102135844 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
1122894843 14:104751797-104751819 CGTGAGTTCCGGGTGGGCGTGGG - Intergenic
1122913102 14:104843395-104843417 CTGCACTTACAGGTGAGCGTGGG - Intergenic
1123440193 15:20285324-20285346 CTGTGGCTTCAGGTGGGTGTGGG + Intergenic
1123799115 15:23802962-23802984 CTGGAGTTCCGGGTGGGCATGGG + Intergenic
1123914588 15:25010125-25010147 CAGGAGTTCCAGATGAGCGTAGG + Intergenic
1123949157 15:25253505-25253527 CTGGAGTTCCGGGTGGGTGTGGG - Intergenic
1124036348 15:26056961-26056983 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
1124061609 15:26298374-26298396 CACGAGTTCCGGGTGGGCGTGGG - Intergenic
1124198602 15:27656715-27656737 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
1124380369 15:29160188-29160210 CAGGAGTTCCAAGTGGGCGTGGG - Intronic
1124573102 15:30883805-30883827 CTGGAGTTCCGGGTGGGCATGGG + Intergenic
1125112189 15:36047003-36047025 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1125480317 15:40075085-40075107 CTGGAGTTCCAGGTGGGCGTGGG - Intergenic
1125565777 15:40677239-40677261 CTGGAGTTCCGGGTGGGCGAGGG - Intergenic
1125609677 15:40961666-40961688 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1125885568 15:43226860-43226882 CTAGAGTTCCCGGTGGGCGTGGG - Intergenic
1125914578 15:43474190-43474212 CTGGAGTTCCTGGTGGGTGTGGG - Intronic
1125992400 15:44122441-44122463 CTGTAGTCCCAGGTGCACTTGGG + Intronic
1126088966 15:45034883-45034905 CTGGAGTTCCGGGTAGGCGTGGG + Intronic
1126128050 15:45314141-45314163 CTGGAGTTCCGGGTGGGCATGGG + Intergenic
1127766090 15:62186873-62186895 CTAGAGTTCCCAGTGGGCGTGGG - Intergenic
1127916416 15:63459115-63459137 CGGGTGTTCCGGGTGGGCGTGGG + Intergenic
1128110821 15:65075073-65075095 CTGGAGTTCCAGGTGGGCGTGGG + Intronic
1128594115 15:68929198-68929220 CCCGAGTTCCGGGTGGGCGTGGG - Intronic
1128598597 15:68975981-68976003 CTGGAGTTCTGGGTGGGCATGGG - Intronic
1128670001 15:69567668-69567690 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1128813335 15:70587486-70587508 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1128874881 15:71193831-71193853 CTGTAGTCCCAGGGGGGACTAGG - Intronic
1128893094 15:71348479-71348501 CTGTACATCCAGGTGAGTGTTGG + Intronic
1129196912 15:73973797-73973819 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
1129280419 15:74480656-74480678 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1129374027 15:75116258-75116280 CGCGAGTTCCGGGTGGGCGTGGG - Intronic
1129586872 15:76876124-76876146 CTAGAGTTCCTGATGGGCGTGGG - Intronic
1129724413 15:77894284-77894306 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
1129777524 15:78246449-78246471 CTGTAGTTCCGGGTGGGCGTGGG - Intergenic
1129859142 15:78846922-78846944 CTGGAGTTCCAGATGGGCGTGGG + Intronic
1130132836 15:81158671-81158693 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1131212671 15:90511008-90511030 CGTGAGTTCCGGGTGGGCGTGGG + Intergenic
1131472848 15:92711329-92711351 CGCGAGTTCCGGGTGGGCGTGGG - Intronic
1131507764 15:93031876-93031898 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1131652707 15:94419174-94419196 CAGTAGTTCCAGTTTGGTGTGGG - Intronic
1131846146 15:96492149-96492171 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1131892194 15:96984421-96984443 CGCGAGTTCCGGGTGGGCGTCGG - Intergenic
1132510992 16:341312-341334 CTGGAGTCCCGGGTGGGCGTGGG + Intronic
1132557465 16:578927-578949 CTATGGAGCCAGGTGGGCGTGGG + Exonic
1133814289 16:9184473-9184495 CGCAAGTTCCAGGTGGGCGTGGG - Intergenic
1134093637 16:11404712-11404734 CTGAGGTTCCTGGTGGGCTTGGG + Exonic
1134678158 16:16104938-16104960 CGCTAGTTCTGGGTGGGCGTCGG - Intronic
1135262149 16:20989952-20989974 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
1135280824 16:21152646-21152668 CTGGAGTTCCGGGTGGGCGTGGG + Intronic
1135470228 16:22723253-22723275 CGCGAGTTCCAGGTAGGCGTGGG - Intergenic
1135751094 16:25059222-25059244 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1135942712 16:26836366-26836388 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
1136027225 16:27476440-27476462 CAGTCATTCCAGGTGGGTGTCGG - Exonic
1136163272 16:28435418-28435440 CTGGAGGTCCGAGTGGGCGTGGG + Intergenic
1136199694 16:28679569-28679591 CTGGAGGTCCGAGTGGGCGTGGG - Intergenic
1136216041 16:28793742-28793764 CTGGAGGTCCGAGTGGGCGTGGG - Intergenic
1136356621 16:29748406-29748428 CATGAGTTCCGGGTGGGCGTGGG + Intergenic
1137442490 16:48508755-48508777 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1137555849 16:49469979-49470001 CATTGGTTCCAGGTGGGCGTGGG + Intergenic
1138688750 16:58748899-58748921 CTAGAGTTCCAGGTGGGCGTGGG + Intergenic
1138693628 16:58791097-58791119 CTGGAGTTCCAGGTAGGCATGGG - Intergenic
1138781663 16:59795941-59795963 CTTTAGATACAGGTGGGCATTGG + Intergenic
1139018996 16:62724916-62724938 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
1139051458 16:63129683-63129705 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
1139147708 16:64343944-64343966 CTGGAGTTCCGGGTAGGCGTGGG + Intergenic
1139600279 16:67982325-67982347 CTCGAGTTCCGGGTGGGCGTGGG + Intergenic
1139603024 16:67998264-67998286 CTGGAGTTTCGGGTGGGCGTGGG + Intronic
1140722548 16:77784689-77784711 CTGGAGTTCCTGGTGGGCGTGGG - Intergenic
1141465762 16:84204893-84204915 CTGGAGTTCCGGGTAGGCGTGGG - Intergenic
1141468720 16:84223960-84223982 CAGCAGTTCCAGCTGGGCGGGGG + Intronic
1141665958 16:85465228-85465250 CAGGAGCTCCAGGTGGGCGGGGG - Intergenic
1141674725 16:85511763-85511785 CTGGAGTTCCAGGTGTTCCTTGG - Intergenic
1142505645 17:361642-361664 CTGGAGTTCCGGGTGGGCGTGGG + Intronic
1142828832 17:2532408-2532430 CATGAGTTCCGGGTGGGCGTGGG - Intergenic
1143128007 17:4656820-4656842 CGTGAGTTCCGGGTGGGCGTGGG - Intergenic
1143135283 17:4709352-4709374 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
1143510468 17:7392941-7392963 CTGTACTTCCATCTGGGAGTGGG + Exonic
1143664301 17:8347431-8347453 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1143708684 17:8718388-8718410 CTAGAGTTCTGGGTGGGCGTGGG - Intergenic
1144128061 17:12220954-12220976 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
1144467131 17:15505746-15505768 CTGGAGTTCCGGGTGGGCGTGGG + Intronic
1144623383 17:16832308-16832330 CTTCACTTCCAGGTCGGCGTTGG + Intergenic
1144723189 17:17486402-17486424 CTGGAGTTCCGGCTGGGCGTGGG + Intronic
1144862607 17:18315031-18315053 TTGTAGTTCCAGGTCGCTGTGGG - Intergenic
1144883049 17:18440408-18440430 CTTCACTTCCAGGTCGGCGTTGG - Intergenic
1145094818 17:20016515-20016537 CGTGAGTTCCCGGTGGGCGTGGG + Intronic
1145149182 17:20503978-20504000 CTTCACTTCCAGGTCGGCGTTGG + Intergenic
1146461402 17:33048755-33048777 CTGGAGTTCCAGGTTGGGTTTGG + Intronic
1146740493 17:35279225-35279247 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1147373598 17:40010982-40011004 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1147573591 17:41586397-41586419 CTTCACTTCCAGGTCGGCGTTGG + Exonic
1147577708 17:41612245-41612267 CTTCACTTCCAGGTCGGCGTTGG + Exonic
1147805321 17:43126889-43126911 CGCGAGTTCCAGGTGGGCGCGGG + Intergenic
1147997507 17:44368872-44368894 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1148016843 17:44528014-44528036 CTGGATGTCCGGGTGGGCGTGGG + Intergenic
1148366204 17:47057594-47057616 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1149099281 17:52884270-52884292 CACGAGTTCCAGGTGGGTGTGGG - Intronic
1149916364 17:60613663-60613685 CGCGAGTTCCAGGTGGGCATGGG + Intronic
1150772256 17:68051922-68051944 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1150775801 17:68080706-68080728 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
1150778253 17:68099332-68099354 CTGGAGTTCCGGGTGGGCCAGGG + Intergenic
1150786772 17:68169668-68169690 CTGGAGTTCCGGGTAGGCGTAGG - Intergenic
1150788240 17:68179897-68179919 CTAGAGTTCCAGGTGGGCGTGGG + Intergenic
1150804633 17:68309221-68309243 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
1151440481 17:74125698-74125720 CTGTAGTCCCAGCTGTGCTTGGG - Intergenic
1151567489 17:74907353-74907375 CGCGAGTTCCAGGTGGGCGTGGG - Intergenic
1151782702 17:76257960-76257982 CTGGAGTTCTGGGTGGGCGTGGG - Intergenic
1153070354 18:1098275-1098297 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
1153101561 18:1476249-1476271 CTGACATTCCTGGTGGGCGTTGG + Intergenic
1153644082 18:7178977-7178999 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1153832489 18:8935734-8935756 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1154057267 18:11023957-11023979 CTGGAGTTACGGGTGGGCGTGGG - Intronic
1154255342 18:12777165-12777187 CTAGAGTTCCGGGTGGGCATGGG - Intergenic
1154942974 18:21132767-21132789 CTAGAGTTCCGGATGGGCGTGGG - Intergenic
1155003294 18:21706567-21706589 CGGGAGTTCCGGGTGGGTGTGGG + Intronic
1155053048 18:22165007-22165029 CTGGAGCTCCAGGTGGGAGCTGG - Intergenic
1155208077 18:23577942-23577964 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
1155271982 18:24149865-24149887 CTGGAGTTCCGAGTGGGCATGGG - Intronic
1155295061 18:24376897-24376919 CTGGAGTTCCGTGTGGGCGTGGG - Intronic
1155772849 18:29723566-29723588 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1155852258 18:30788493-30788515 CTGGAGTTCCGGTTGGGCATGGG + Intergenic
1155856402 18:30839469-30839491 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1155976759 18:32139914-32139936 CGTGAGTTCCGGGTGGGCGTGGG + Intronic
1156038643 18:32794624-32794646 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1156150321 18:34234007-34234029 CGCCAGTTCCAGGTGGGCGTGGG + Intergenic
1156390145 18:36642494-36642516 CTGTAGTTCCAGCTAGGAGGCGG + Intronic
1156610513 18:38718695-38718717 CGCAAGTTCCGGGTGGGCGTGGG - Intergenic
1156683547 18:39618505-39618527 CACAAGTTCCAGGTGGGTGTGGG + Intergenic
1156863632 18:41865806-41865828 CTGGAGTTCCAGGTGGGCATGGG + Intergenic
1156943149 18:42795297-42795319 CTGGAGTTCCGGGTGGGCGTGGG + Intronic
1156969649 18:43139571-43139593 CTAGAGTTCCGGGTGGGCATGGG + Intergenic
1157085944 18:44580782-44580804 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1157286733 18:46382080-46382102 CTGTAGAGCCAGGTTGGCTTTGG + Intronic
1157979825 18:52367215-52367237 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
1158282326 18:55841006-55841028 CGCAAGTTTCAGGTGGGCGTGGG - Intergenic
1158351892 18:56572339-56572361 CTGGAGTTCCGGGTAGGCGTGGG + Intergenic
1158553858 18:58459440-58459462 CTAGAGTTCCAGGTGGGCATGGG + Intergenic
1158597357 18:58827992-58828014 CATGAGTTCCGGGTGGGCGTGGG - Intergenic
1158697287 18:59714403-59714425 CTGGAGTTCCGGGTGGGCATGGG - Intergenic
1158705779 18:59790762-59790784 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1158892145 18:61882775-61882797 CTGTAATACCAAGTGGGGGTTGG - Intronic
1159230771 18:65605303-65605325 CTGGAGTTCCGGGTGGGCGGGGG + Intergenic
1159322199 18:66866749-66866771 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
1159472975 18:68880306-68880328 CTGGAGTTCCGGGTGGGCATGGG - Intronic
1159656131 18:71031650-71031672 CTGGAGTTCCAGGTGGGGGTGGG - Intergenic
1159743933 18:72209174-72209196 CTAGAGTTCCGGATGGGCGTGGG + Intergenic
1160176648 18:76600441-76600463 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1160198527 18:76777294-76777316 CTGGACTTCTGGGTGGGCGTGGG + Intergenic
1160561350 18:79758763-79758785 CTGTAGTTCCAGGAGGCACTTGG + Intergenic
1160704759 19:524733-524755 CTGGGGGTCCAGGTGGGCGAGGG - Intergenic
1160704780 19:524788-524810 CTGGGGGTCCAGGTGGGCGAGGG - Intergenic
1160704822 19:524900-524922 CTGGGGGTCCAGGTGGGCGAGGG - Intergenic
1160811708 19:1015635-1015657 CTGGGGTTCCATGTGGCCGTGGG - Intronic
1160992388 19:1865009-1865031 CTGGGGTTGCAGGTGGGCGGGGG - Intergenic
1162091113 19:8280662-8280684 CGCGAGTTCCGGGTGGGCGTGGG - Intronic
1162093347 19:8295500-8295522 CGCGAGTTCCGGGTGGGCGTGGG - Intronic
1162106973 19:8375809-8375831 CTGGAGTTCCGGGTGGGCGTGGG + Intronic
1162237623 19:9321447-9321469 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1162262073 19:9541635-9541657 CTGGAGTTCCAGGTGGGCGTGGG - Intergenic
1162608217 19:11728269-11728291 CTGTTGTTCCAGGTGGTTGAAGG - Intronic
1162632726 19:11941606-11941628 CTGGAGTTCTGGGTGGGCGTGGG - Intronic
1162814756 19:13187020-13187042 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1162987080 19:14277675-14277697 CGTGAGTTCCAGGTGGGTGTGGG + Intergenic
1163181748 19:15608956-15608978 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1163218820 19:15899732-15899754 CTAGAGTTCCAGGTGGGCGTAGG + Intergenic
1164144051 19:22499300-22499322 CTGGAGTTCCGGGTCGGCGTGGG - Intronic
1164270615 19:23668838-23668860 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
1164310434 19:24041363-24041385 CTGGAGTTCCGGGTGGGCGTGGG + Intronic
1164581947 19:29440069-29440091 CGTGAGTTCCAGGTGGGCTTGGG + Intergenic
1164975768 19:32571637-32571659 CTGGAGTTCTGGGTGGGCGTGGG + Intergenic
1165036365 19:33036688-33036710 CGCGAGTTCCAGGTGGGCGTGGG + Intronic
1165266911 19:34668243-34668265 CTGGAGTTCCCGGTGGGCGTGGG + Intronic
1166036249 19:40170452-40170474 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1166487037 19:43222243-43222265 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
1166649750 19:44563516-44563538 CTGGAGTTCCGGATGGGCGTGGG - Intergenic
1167620949 19:50560333-50560355 GTGTAGCTCAAGGTGGGCCTTGG + Intronic
1168266953 19:55228515-55228537 CTGGGGTCCCAGGTGGGGGTGGG - Intronic
1168659859 19:58157352-58157374 CTAGAGTTCCGGATGGGCGTGGG + Intergenic
925018967 2:553680-553702 CTGTAGTCCCAGGAGGAGGTGGG + Intergenic
925098998 2:1229906-1229928 CTGGAGTTCCGGGTGGGCGTAGG - Intronic
925537833 2:4935625-4935647 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
926444553 2:12926821-12926843 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
926616660 2:15002846-15002868 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
926685848 2:15697041-15697063 CGCGAGTTCCAGGTGGGCGTGGG - Intronic
926820591 2:16847663-16847685 CTGTAGTCCCAGGTGGGTCGAGG - Intergenic
926851812 2:17206351-17206373 CTGTAATTCCAGGTTGGCTCTGG + Intergenic
927398193 2:22680186-22680208 CTGAATATCCAGGTGGGCTTTGG - Intergenic
927942211 2:27111778-27111800 CGCGAGTTCCGGGTGGGCGTGGG - Intronic
928100851 2:28436732-28436754 CTGTGATTCCAGGAGGGCGAGGG - Intergenic
928493060 2:31803768-31803790 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
928617967 2:33057738-33057760 CTAGAGTTCCCGGTGAGCGTGGG - Intronic
928701564 2:33903823-33903845 CACGAGTTCCAGGTGGGCATGGG - Intergenic
928880555 2:36092290-36092312 CATGAGTTCCAGGTGGGAGTGGG + Intergenic
928936869 2:36688310-36688332 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
929070030 2:38020561-38020583 CTGGAGTTCCGGGTGGGCGTGGG + Intronic
929138044 2:38643372-38643394 CGCGAGTTCCAGGTGGGCGCGGG - Intergenic
929201832 2:39244324-39244346 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
929233688 2:39585415-39585437 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
929379660 2:41335639-41335661 CTGGAGTTCCAGGTGGGCGTGGG + Intergenic
929556801 2:42930608-42930630 CTGTATTTTCAGGTGAGAGTGGG - Intergenic
929890900 2:45917985-45918007 CTAGAGTTCCGGGTGGGCGTGGG - Intronic
930037988 2:47099781-47099803 CTGGAGTTCCGGGTGGGCATGGG + Intronic
930039185 2:47107329-47107351 CTGGAGTTCCGGGTGGGCATGGG + Intronic
930338785 2:50084519-50084541 CTAGAGTTCCTGGTGAGCGTGGG - Intronic
930468241 2:51780597-51780619 CTGGAGTTCCGGATGGGCGTGGG - Intergenic
930485480 2:52006848-52006870 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
931708667 2:64969053-64969075 CTGGAGATACGGGTGGGCGTGGG + Intergenic
931856635 2:66308525-66308547 CTGGAGTTCCAAATGGGCTTGGG - Intergenic
932178259 2:69622132-69622154 CGCCAGTTCCAGGTGGGCGTGGG + Intronic
932359545 2:71092798-71092820 CTGGAGTTCCGGGTAGGCGTGGG - Intergenic
932475945 2:72005998-72006020 CTGAAGTTCAAGGTGGGGGTAGG - Intergenic
932486448 2:72086930-72086952 CTGGAGTTCCCGGTGGGCGTGGG + Intergenic
932747516 2:74346048-74346070 ATGTAGTTCCAGTTGGACTTAGG + Intronic
932902023 2:75711624-75711646 CTGGAGTTCCGGGTGGGCATGGG + Intergenic
933060860 2:77735065-77735087 CGCGAGTTCCCGGTGGGCGTGGG - Intergenic
933487284 2:82938756-82938778 CTGGAGTTCTGGGTGGGCGTGGG - Intergenic
933511490 2:83246237-83246259 CGTGAGTTCCGGGTGGGCGTGGG - Intergenic
933531612 2:83518219-83518241 CGCGAGTTCCGGGTGGGCGTAGG + Intergenic
933915035 2:86981757-86981779 GTGTATGTGCAGGTGGGCGTGGG + Intronic
934007959 2:87788143-87788165 GTGTATGTGCAGGTGGGCGTGGG - Intronic
934898467 2:98139052-98139074 CTGGAGTTCCGGGTGGCTGTGGG + Intronic
935896882 2:107747650-107747672 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
935922529 2:108031613-108031635 CGCAAGTTCCAGGTGGGCGCAGG + Intergenic
935994877 2:108759105-108759127 GTGTATGTGCAGGTGGGCGTGGG + Intronic
936038864 2:109133899-109133921 CTGTAGTCTCTGGTGGGTGTGGG + Intronic
936130263 2:109832009-109832031 GTGTATGTGCAGGTGGGCGTGGG + Intronic
936172723 2:110190504-110190526 CGTGAGTTCCGGGTGGGCGTGGG - Intronic
936214434 2:110539476-110539498 GTGTATGTGCAGGTGGGCGTGGG - Intronic
936346860 2:111681899-111681921 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
936423570 2:112394039-112394061 GTGTATGTGCAGGTGGGCGTGGG - Intronic
937209621 2:120260062-120260084 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
937711875 2:124987722-124987744 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
938126105 2:128672436-128672458 CTAGAGCTCCGGGTGGGCGTGGG - Intergenic
938726056 2:134109660-134109682 CTAGAGTTCTGGGTGGGCGTGGG - Intergenic
938728751 2:134129987-134130009 CGCAAGTTCCAGGTGGGCGTGGG + Intronic
939003114 2:136758510-136758532 CTCAAGTTCCGAGTGGGCGTGGG + Intergenic
939053243 2:137331918-137331940 CTGGAATTCCGGGTGGGCGTGGG - Intronic
939465101 2:142546110-142546132 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
939509609 2:143089746-143089768 CTGGAGTTCCAGGTGGGCATGGG - Intergenic
939738807 2:145881220-145881242 CTGGAGTTCAGGGTGGGCATGGG - Intergenic
939777379 2:146404003-146404025 CTGGAGTTCCGGGTGGGAGTGGG - Intergenic
939869034 2:147506970-147506992 CGCGAGTTCCAGGTGGGTGTGGG + Intergenic
939898886 2:147826910-147826932 CCAGAGTTCCGGGTGGGCGTGGG + Intergenic
939972563 2:148678699-148678721 CTGGAGTTCCAGGTGGGCGTGGG - Intronic
940112671 2:150171338-150171360 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
940361961 2:152805132-152805154 CGCAAGTTCCGGGTGGGCGTGGG - Intergenic
940666734 2:156618369-156618391 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
940880790 2:158944695-158944717 CTGTAATTCCAGCTGGGCTGAGG + Intergenic
941178870 2:162234908-162234930 CTAGAGTTCTGGGTGGGCGTGGG + Intronic
941240056 2:163026324-163026346 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
941309223 2:163909571-163909593 CTACAGTTCCGGGTGGGCGTGGG + Intergenic
941309759 2:163913663-163913685 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
941397959 2:164995066-164995088 CTGGAGTTCCTGGTGGGCGTGGG - Intergenic
941476615 2:165957379-165957401 CGCGAGTTCCAGGTGGGCGCGGG - Intergenic
941705898 2:168657750-168657772 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
941712149 2:168725209-168725231 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
941820765 2:169841582-169841604 CTGGAGTTCCGGGTGGGCGTGGG + Intronic
942317622 2:174709879-174709901 CTGGAGTTCTGGGCGGGCGTGGG - Intergenic
942754870 2:179328776-179328798 CCGTAGTTCCAGCTGGGCTGAGG - Intergenic
942867260 2:180691436-180691458 CTGGAGTTCCAGGTGGGCGTGGG + Intergenic
943024203 2:182608509-182608531 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
943494782 2:188606705-188606727 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
943680377 2:190761275-190761297 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
943835134 2:192508017-192508039 CTGGAGTTCCAGGTGGGCATGGG + Intergenic
943891333 2:193290355-193290377 CTGTAGTGCCAGGTAGGAATAGG + Intergenic
943906141 2:193502720-193502742 CACCAGTTCCGGGTGGGCGTGGG - Intergenic
943942698 2:194020210-194020232 CGCAAGTTCCAGGTGGGCGTGGG + Intergenic
944228405 2:197370621-197370643 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
944482780 2:200174833-200174855 CGCCAGTTCCGGGTGGGCGTGGG + Intergenic
944728571 2:202496959-202496981 CTGGAGTTCCGGGTGGGCATGGG + Intronic
944843159 2:203643139-203643161 CGCGAGTTCCAGGTGGGTGTGGG - Intergenic
944857959 2:203785885-203785907 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
945401373 2:209387428-209387450 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
945451509 2:210000883-210000905 CGCGAGTTCGAGGTGGGCGTGGG - Intergenic
945575504 2:211524687-211524709 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
945745755 2:213718540-213718562 CTGGAGTTCCGGGTGGGCGTGGG + Intronic
945870192 2:215219107-215219129 CTAGAGTTCCGGGTGGGTGTGGG + Intergenic
945872853 2:215246040-215246062 CTGGAGTTCCGGGTGGGCATGGG - Intergenic
945907916 2:215615197-215615219 CGCAAGTTCCGGGTGGGCGTGGG - Intergenic
946358110 2:219201739-219201761 CTGGAGTTCCAGGTGGGCGTGGG - Intronic
946923594 2:224604013-224604035 CTGGAGTTCCGAGTGGGTGTGGG - Intergenic
946982196 2:225229760-225229782 CTGGAGTTCCGGGAGGGTGTGGG - Intergenic
947411966 2:229850767-229850789 CTGGAGTTCCGGGTGGGTGTGGG + Intronic
947720395 2:232366389-232366411 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
947932086 2:233972779-233972801 ATGGAGTTCCGGGTGGGCGTGGG - Intronic
947938045 2:234024593-234024615 CTAGAGTTCCGGGTGGGCGTGGG - Intergenic
948449142 2:238058169-238058191 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
1169814481 20:9641900-9641922 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
1169849169 20:10031730-10031752 CTGGAGTTCTGGGTGGGCGTGGG + Intronic
1170230892 20:14045094-14045116 CCGAAGTTCCAGGTGGGCGTGGG - Intronic
1170246442 20:14226557-14226579 CTGGAGTTCCGGGTGGGCGTGGG + Intronic
1170649477 20:18226814-18226836 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1170989856 20:21291920-21291942 CTGGAGTTCCCGGTGAGCGTGGG + Intergenic
1171318878 20:24221032-24221054 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1172431885 20:34899114-34899136 CTGGAGTTCCGAGTGGGCGTGGG - Intronic
1173195552 20:40910781-40910803 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1173195659 20:40911232-40911254 CTGGAGTTCCGCGTGGGCGTGGG + Intergenic
1173601569 20:44299182-44299204 CTGGAGTTCCGGGAGGGCGTGGG + Intergenic
1173831483 20:46091900-46091922 CTAGAGTTCCAGGTGGGCGTGGG + Intergenic
1174144015 20:48438217-48438239 CTCTAGCTGCAGGTGGCCGTTGG + Intergenic
1174162905 20:48564374-48564396 CGTGAGTTCCGGGTGGGCGTGGG - Intergenic
1175210039 20:57348445-57348467 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1175254125 20:57628843-57628865 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1175399603 20:58692916-58692938 CTGCAGTTCCAGGCGAGCGCGGG + Exonic
1176189360 20:63800612-63800634 CTAGAGTTCCGGGTGGGTGTGGG + Intronic
1176344851 21:5733784-5733806 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
1176351665 21:5854368-5854390 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
1176499976 21:7590671-7590693 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
1176539172 21:8131854-8131876 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
1176558123 21:8314899-8314921 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
1176663200 21:9660084-9660106 CGCGAGTTCCAGGTGGGCGTGGG + Intergenic
1176966644 21:15218887-15218909 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1177496904 21:21902466-21902488 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1177565855 21:22819151-22819173 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1177637591 21:23807066-23807088 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1177795884 21:25778416-25778438 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
1178074156 21:29000225-29000247 CGTGAGTTCCGGGTGGGCGTGGG + Intergenic
1178082235 21:29077429-29077451 CGTGAGTTCCGGGTGGGCGTGGG - Intergenic
1178326972 21:31654243-31654265 CTGGAGCTCCAGGTGTGCGTGGG + Intergenic
1178398716 21:32265380-32265402 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1178585669 21:33868628-33868650 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
1178983377 21:37283497-37283519 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1179032193 21:37730323-37730345 CTATAGTGCCTGGTGGGCCTGGG + Intronic
1179240917 21:39591321-39591343 CTGTAGTCCCAGCTGAGCCTGGG + Intronic
1180004307 21:45013029-45013051 CCTCAGTTCCAGGTGTGCGTTGG - Intergenic
1180741073 22:18053668-18053690 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1181077687 22:20392668-20392690 CACGAGTTCCGGGTGGGCGTGGG - Intergenic
1181103375 22:20556421-20556443 CTGTAGTCCCAGGTAGTCGGAGG - Intronic
1182057666 22:27372630-27372652 CTGTGGTTTCAGGTGGGCCCAGG - Intergenic
1182816180 22:33166202-33166224 CTGGAGTTCCAGGTGGCCCTAGG - Intronic
1183422152 22:37718151-37718173 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
1183439556 22:37815587-37815609 CTGTACTTTCAGGAGGGGGTTGG + Intronic
1183661478 22:39224056-39224078 CTGCCCTTCCAGGTGGGTGTGGG - Exonic
1183685187 22:39357586-39357608 CTGGAGTTCCGGGTGGGCGTGGG + Intronic
1183990336 22:41593575-41593597 CTAGAGTTCTGGGTGGGCGTGGG + Intergenic
1184584232 22:45436777-45436799 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1184605972 22:45575119-45575141 CTGCTGTGCCAGGTGGGTGTGGG - Intronic
1184906276 22:47488618-47488640 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1185229153 22:49670511-49670533 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
1203244120 22_KI270733v1_random:48209-48231 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
949258951 3:2083681-2083703 CTGGAGTTCGTGGTGGGCGTGGG + Intergenic
949292730 3:2484959-2484981 CGCGAGTTCCAGGTGGCCGTGGG + Intronic
949817342 3:8072429-8072451 CTGTACTTCAAGGTGGGCAGAGG - Intergenic
950068962 3:10136678-10136700 CACAAGTTCCGGGTGGGCGTGGG - Intergenic
950203575 3:11061431-11061453 CGTGAGTTCCAGGTGGGCGTGGG + Intergenic
950207869 3:11094094-11094116 CTAGAGTTCCGGGTGGGCGTGGG + Intergenic
950256679 3:11511907-11511929 CTGGAGTTCTGGGTGGGTGTGGG - Intronic
950256988 3:11513554-11513576 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
950401036 3:12769171-12769193 CTACAGTTCCGGGTGGGCTTGGG - Intronic
950418535 3:12882940-12882962 CTAGAGTTCCGGGTGGGCGTGGG + Intergenic
950513391 3:13447508-13447530 CTGGAGTTCCGGGTGGGTGTGGG - Intergenic
950632617 3:14293256-14293278 CACGAGTTCCGGGTGGGCGTGGG + Intergenic
951184949 3:19702620-19702642 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
951734776 3:25851814-25851836 CGCGAGTTCCAGGTGGGCGTGGG + Intergenic
951844187 3:27067902-27067924 CTCTAGGTCCAGGTTGGCATTGG + Intergenic
951951115 3:28200724-28200746 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
952011299 3:28903477-28903499 CGCGAGTTCCAGGTGGGTGTGGG - Intergenic
952058119 3:29473813-29473835 CTGGACTTCCAGGTGGGCGTGGG - Intronic
952275220 3:31870170-31870192 CTGGAGTTCCAGGTGGGCGTGGG + Intronic
952355362 3:32578803-32578825 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
952360444 3:32625688-32625710 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
952393685 3:32902843-32902865 CTGGAGTTCTGGGTGGGCGTGGG + Intergenic
952398207 3:32939732-32939754 CTGGAGTTCTGGGTGGGCGTGGG + Intergenic
952593610 3:34988413-34988435 CTGGAGTTCCAGGTGGGCGTGGG + Intergenic
952713292 3:36453394-36453416 CGTGAGTTCCGGGTGGGCGTGGG + Intronic
952730613 3:36633956-36633978 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
952795221 3:37233053-37233075 CCGGAGTTCCGGGTGGGCGTGGG + Intergenic
953002864 3:38951201-38951223 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
953089799 3:39713365-39713387 CTGGAGTTCTGGGTGGGCGTGGG + Intergenic
953124538 3:40078236-40078258 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
953307632 3:41844476-41844498 CTGGAGTTCTGGGTGGGCATGGG - Intronic
953522518 3:43656737-43656759 CTGGAGTTCCAGGTGGGCGTGGG - Intronic
953714579 3:45306718-45306740 CTAGAGTTCTGGGTGGGCGTGGG + Intergenic
954040981 3:47887255-47887277 CTGGAGTTCCGGGTGGGCGTGGG + Intronic
954230584 3:49213752-49213774 CTCGAGTTCCAGGTGGGCATGGG - Intronic
954620097 3:51990606-51990628 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
955139088 3:56251150-56251172 CTGTAGTTTCTGGTGGCAGTTGG - Intronic
955183323 3:56691929-56691951 CTGGAGTTCCGTGTGGGCGCGGG + Intergenic
955186401 3:56718983-56719005 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
955210263 3:56934515-56934537 CTGGAGTTCCGGGTGGGTGTGGG + Intronic
955266484 3:57449657-57449679 CTGGAGTTACAGGTGGGCGTGGG - Intronic
956002624 3:64745539-64745561 CAGTAGTCCAAGGTGGGGGTGGG - Intergenic
956195722 3:66651620-66651642 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
956392212 3:68785577-68785599 CGCGAGTTCCAGGTGGGTGTGGG - Intronic
956438800 3:69260324-69260346 CACGAGTTCCGGGTGGGCGTGGG + Intronic
956481434 3:69677502-69677524 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
956563612 3:70611905-70611927 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
956855234 3:73269242-73269264 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
956986947 3:74712106-74712128 CGGGAGTTCCGGGTGGGAGTGGG + Intergenic
957002288 3:74900245-74900267 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
957009211 3:74985437-74985459 CTGTAGTTCTGGGTGGGCGTGGG - Intergenic
957053306 3:75426420-75426442 ATGCAGGCCCAGGTGGGCGTGGG + Intergenic
957074063 3:75587848-75587870 CTGGAGTTCCAGGTGGGCATGGG + Intergenic
957209454 3:77240395-77240417 CGTGAGTTCCGGGTGGGCGTGGG - Intronic
957277442 3:78108439-78108461 ATGGAGTTCCGGGTGGGCCTGGG + Intergenic
957362054 3:79173387-79173409 CGCGAGTTCCAGGTGGGTGTGGG + Intronic
957371459 3:79300268-79300290 CTGGAGTTCCGGGTGGGCGTGGG + Intronic
957419696 3:79951682-79951704 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
957556324 3:81767698-81767720 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
957630921 3:82715379-82715401 CTGGAGTTCCGGGTAGGCGTCGG + Intergenic
957665210 3:83217922-83217944 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
957804933 3:85134172-85134194 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
957830045 3:85504987-85505009 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
957921791 3:86757642-86757664 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
957995074 3:87679146-87679168 CTGAAGTTCCAGGTGGGCGTGGG + Intergenic
958022608 3:88015739-88015761 CTGGAGTTCCGGGTCGGCGTGGG + Intergenic
958419849 3:93917637-93917659 CTGGAGTTCCTGGTGGGCGTGGG + Intronic
958549671 3:95595792-95595814 CACGAGTTCCAGGTGGGTGTGGG - Intergenic
959422714 3:106148676-106148698 CTGGAGTTCCAGGTGGGCATGGG + Intergenic
959462433 3:106643819-106643841 CACGAGTTCCAGGTGGGCGCAGG + Intergenic
960227560 3:115185196-115185218 CTGGAGTTCCGGGTGGGTGTGGG - Intergenic
960282111 3:115791611-115791633 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
960479520 3:118171447-118171469 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
960487294 3:118269731-118269753 CTAGAGTTCCCGGTGGGCGTGGG + Intergenic
960685481 3:120289768-120289790 CGCAAGTTCCAGGTGGGCGTGGG + Intergenic
960761697 3:121078865-121078887 CTGGAGTTCTGGGTGGGCATGGG - Intronic
961280027 3:125758889-125758911 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
961460437 3:127046726-127046748 CTGGAGTTCCGGGTGGGCATGGG + Intergenic
961688771 3:128653444-128653466 CTGGAGTTCTGGGTGGGCCTGGG + Intronic
961700821 3:128743233-128743255 CGGGAGTTCCGGGTGGGTGTGGG - Intronic
961746741 3:129068580-129068602 CGCAAGTTCCGGGTGGGCGTGGG - Intergenic
961874378 3:130010690-130010712 CTGGAGTTCCGAGTGGGCGTGGG + Intergenic
962283775 3:134070570-134070592 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
962383790 3:134916671-134916693 CGCCAGTTCCGGGTGGGCGTGGG - Intronic
962398776 3:135039740-135039762 CTTGAGTTCCGGGTGGGCATGGG - Intronic
962591099 3:136890311-136890333 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
962600531 3:136987898-136987920 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
962671714 3:137714810-137714832 CTAGAGTTCCGGGTGGACGTGGG - Intergenic
962758226 3:138484698-138484720 CTGGAGTTCTGGGTGGGTGTGGG + Intergenic
963397184 3:144749861-144749883 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
963440384 3:145333443-145333465 CTGGAGTTCTGGGTGGGCGTGGG + Intergenic
963509177 3:146225743-146225765 CTGGAGTTCCGGGTGGGCGTCGG - Intronic
963651851 3:147989691-147989713 CTCGAGTTCCGGGTGGGTGTGGG - Intergenic
963743027 3:149098161-149098183 CGGGAGTTCCGGGTGGGCGTGGG - Intergenic
963862142 3:150323017-150323039 CTGGAGTTCCGGGTGGGGGTGGG + Intergenic
964014346 3:151928204-151928226 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
964037516 3:152217352-152217374 CTGGAGTTCCAGGTGGGTGTGGG + Intergenic
964064040 3:152559485-152559507 CACAAGTTCCAGGTGGGTGTGGG + Intergenic
964117996 3:153156031-153156053 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
964139244 3:153378647-153378669 CTGGCGTTCCGGGTGGGCGTGGG - Intergenic
964375032 3:156041368-156041390 CGCGAGTTCCGGGTGGGCGTGGG + Intronic
964393806 3:156224236-156224258 CACGAGTTCCGGGTGGGCGTGGG - Intronic
964443977 3:156740627-156740649 CTGGAGTTCCGGGTGGGCGTCGG + Intergenic
964452166 3:156822988-156823010 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
964751835 3:160060573-160060595 CTAGAGTTCCAGGTGGGCGTGGG + Intergenic
964802909 3:160574255-160574277 CGCGAGTTCCGGGTGGGCGTAGG - Intergenic
964977734 3:162640120-162640142 CTGGATTGCCAGCTGGGCGTGGG + Intergenic
964982529 3:162703235-162703257 CGCGAGTTCCAGGTGGGCGTGGG - Intergenic
964983177 3:162710821-162710843 CGTGAGTTCCGGGTGGGCGTGGG - Intergenic
965040269 3:163499073-163499095 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
965044162 3:163552632-163552654 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
965077970 3:164003020-164003042 CTGGAGTTCCAGGTGGGCGTGGG + Intergenic
965200370 3:165649628-165649650 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
965220915 3:165924616-165924638 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
965245267 3:166258779-166258801 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
965288013 3:166842861-166842883 TTGGAGTTCCCGGTGGGCGTGGG + Intergenic
965298104 3:166975883-166975905 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
965652333 3:170947272-170947294 CATGAGTTCCAGGTGGGCGTGGG + Intergenic
965753258 3:171999182-171999204 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
965943511 3:174212283-174212305 CTGGAGTTCCGGGTAGGCGTGGG - Intronic
966076044 3:175937424-175937446 CTGGAGTTCCGGGTGTGCGTGGG + Intergenic
966096821 3:176213739-176213761 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
966186179 3:177228891-177228913 CGTGAGTTCCGGGTGGGCGTGGG - Intergenic
966191042 3:177272038-177272060 CTGGAGTTCCGGGTGGGCGGGGG - Intergenic
966724977 3:183100946-183100968 CTGGAGTTCCGGGTGGGCGTGGG + Intronic
966725462 3:183104057-183104079 CTGGAGTTCCGGGTGGGCGTAGG - Intronic
967234125 3:187367880-187367902 CTAGAGTTCTGGGTGGGCGTGGG - Intergenic
967448479 3:189596173-189596195 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
967499179 3:190177360-190177382 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
967818648 3:193819668-193819690 TTGAAGTTCCAGGTGGGAGAAGG + Intergenic
968181624 3:196599348-196599370 CTGGAATTCCGGGTAGGCGTGGG - Intergenic
968469662 4:773611-773633 CAAGAGTTCCGGGTGGGCGTGGG + Intergenic
968716140 4:2161319-2161341 CTGGAGTTCAGGGTGGGCGTGGG + Intronic
968749957 4:2383437-2383459 TTGTAGTTCCACGTGGCTGTGGG - Intronic
969017689 4:4115450-4115472 CTGGAGTTCTGGGTGGGCATGGG + Intergenic
969362330 4:6672773-6672795 CTGGAGTTCAGGGTGGGCGTGGG + Intergenic
969371226 4:6732796-6732818 CTGTTCTTGCAGCTGGGCGTGGG + Intergenic
969440716 4:7215178-7215200 CTGGAGTTCCGGGTGGGCGTGGG + Intronic
969654999 4:8491720-8491742 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
969736300 4:8993161-8993183 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
969755008 4:9143627-9143649 CGCTAGTTCCGGGTGGGCATGGG + Intergenic
969795498 4:9524724-9524746 CTGGAGTTCTGGGTGGGCGTGGG - Intergenic
970391191 4:15614963-15614985 CTGGAGTTCCGGGTGGGCGTGGG + Intronic
970408668 4:15787044-15787066 CGCGAGTTCCAGGTGGGCGTGGG - Intronic
970551319 4:17184662-17184684 CTGTGGTTCCAGGTGTTCCTTGG - Intergenic
970615783 4:17767117-17767139 CGCGAGTTCCGGGTGGGCGTTGG - Intronic
970649354 4:18159580-18159602 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
970673193 4:18418649-18418671 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
970803499 4:20004061-20004083 CTGGAGTTCCAGGTGGGCGTGGG + Intergenic
971281707 4:25246926-25246948 CGCAAGTTCCAGGTGGGCATGGG - Intronic
971377142 4:26064290-26064312 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
971553062 4:27978646-27978668 CTGGAGTTCCGGGTGGGCATGGG - Intergenic
971563538 4:28112829-28112851 CTGGAGTTCCCGGTGGGAATGGG + Intergenic
971564216 4:28117452-28117474 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
971618740 4:28828045-28828067 CGCAAGTTCCAGGTGGACGTGGG + Intergenic
971639800 4:29117402-29117424 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
971709436 4:30092757-30092779 CTGGAGTTTCAGATGGGCGTGGG + Intergenic
971811930 4:31438701-31438723 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
971905220 4:32716536-32716558 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
972022809 4:34335952-34335974 CTGGAGTTCCGGCTGGGCGTGGG - Intergenic
972505804 4:39718813-39718835 CTAGATTTCCAGGTGGGCGTGGG - Intronic
972900103 4:43672407-43672429 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
973037076 4:45420212-45420234 CTGGAGTTCCGGGTTGGCGTGGG + Intergenic
973045362 4:45530505-45530527 CACGAGTTCCAGGTGGGTGTGGG + Intergenic
973146289 4:46831088-46831110 CTAGAGTTCCGGGTGGGCATGGG + Intronic
973308057 4:48675390-48675412 CTGGAGTTCCGGGTGGGCGTGGG + Intronic
973587785 4:52410056-52410078 CTGGAGTTCCGGGTGGGCATAGG - Intergenic
973765119 4:54155434-54155456 CTGGAGTTCCGGGTGGGTGTGGG - Intronic
973817556 4:54632586-54632608 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
973854093 4:54993564-54993586 CGCGAGTTCCAGGTGGGCGTGGG + Intergenic
974128983 4:57730089-57730111 CTGGAGTTCCAGGTGGGAGTGGG - Intergenic
974147393 4:57965474-57965496 CTGGAGTTCCGGATGGGCGTGGG + Intergenic
974187991 4:58465171-58465193 CATGAGTTCCAGGTGGGCGCAGG + Intergenic
974207424 4:58724185-58724207 CACAAGTTCCAGGTGGGCATGGG + Intergenic
974484815 4:62492207-62492229 CTGGAGTTCCGAGTGGGCGTGGG - Intergenic
974590618 4:63943185-63943207 CTGGAGTTCTGGGTGGGCGTGGG - Intergenic
974641768 4:64640784-64640806 CTGGAGTTCCCGGTGGGCGTGGG - Intergenic
974792793 4:66712724-66712746 CTGGAGTTCCGGGTGGGTGTAGG - Intergenic
974804359 4:66860218-66860240 CTGGAGTTCTGGGTGGGCGTGGG + Intergenic
974827730 4:67151929-67151951 CTGGAGTTTCCGGTGGGCGTGGG + Intergenic
974892318 4:67896871-67896893 CTAGAGTTCCGGGTGGGTGTGGG - Intergenic
974992898 4:69115554-69115576 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
975055380 4:69923941-69923963 CTGCAGTTCCGGGTGGGCGTGGG + Intergenic
975298796 4:72765948-72765970 CAGGAGTTCCGTGTGGGCGTGGG + Intergenic
975439976 4:74399374-74399396 CACAAGTTCCGGGTGGGCGTGGG - Intergenic
975595211 4:76043597-76043619 CTGGAGTTCTGGGTGGGCGTGGG - Intronic
975596392 4:76050968-76050990 CTGGAGTTCCGGGTAGGCGTGGG - Intronic
975755850 4:77570714-77570736 CTGGAGTTCTGGGTGGGCGTGGG + Intronic
975994919 4:80302887-80302909 CGCAAGTTCCAGGTGGGCGTGGG + Intronic
976406360 4:84664767-84664789 CTGGAGTTCCAGGTGGGCGTGGG + Intergenic
976520654 4:86021919-86021941 CTGGAGTTGCAGGTAGGCGTGGG - Intronic
976565513 4:86547348-86547370 CGCGAGTTCCGGGTGGGCGTGGG + Intronic
976646890 4:87396257-87396279 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
976980321 4:91218280-91218302 CTGGAGTTCCGGGTGGGTGTGGG - Intronic
977206493 4:94169894-94169916 CTGGAGTTCTGGGTGGGCGTGGG + Intergenic
977606960 4:98993795-98993817 CTAGAGTTCCAGGTGGGCGTGGG - Intergenic
977717374 4:100196831-100196853 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
977750989 4:100609076-100609098 CTGGAGTTCTGGGTGGGCGTGGG - Intronic
977906459 4:102483176-102483198 CTGGAGTTCCAGGTGAGCATGGG + Intergenic
978127767 4:105154900-105154922 CTGTAGTTCCAGGTACTTGTGGG + Intronic
978207216 4:106092702-106092724 TTAGAGTTCCAGGTGGGCGTGGG - Intronic
978241911 4:106525654-106525676 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
978463636 4:108984663-108984685 CGGGAGTTCCGGGTGGGCGTGGG - Intronic
978466228 4:109012523-109012545 CGCGAGTTCCAGGTGGGCGCGGG + Intronic
978514582 4:109557457-109557479 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
978998071 4:115179727-115179749 CTGGGGTTCCGGGTGGGCGTGGG - Intergenic
978999598 4:115200505-115200527 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
979224161 4:118265598-118265620 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
979290843 4:118977360-118977382 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
979308295 4:119173835-119173857 CTGGAGTTCTGGGTGGGCATGGG + Intronic
979424774 4:120551048-120551070 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
979445691 4:120808877-120808899 CGTGAGTTCCAGGTGGGCGTGGG - Intronic
979608993 4:122670266-122670288 TGCGAGTTCCAGGTGGGCGTGGG + Intergenic
979678635 4:123435680-123435702 CGCGAGTTCCAGGTGGGCGTGGG - Intergenic
979688561 4:123537966-123537988 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
979755847 4:124339103-124339125 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
979822538 4:125192000-125192022 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
979825731 4:125229902-125229924 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
979829333 4:125280998-125281020 CGCGAGTTCCAGGTGGGCATGGG + Intergenic
979857527 4:125652040-125652062 CGCGAGTTCCCGGTGGGCGTGGG - Intergenic
979899735 4:126201601-126201623 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
979949531 4:126874749-126874771 CTTGAGCTCCAGGTGGGCATGGG - Intergenic
979991440 4:127379984-127380006 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
980043408 4:127964548-127964570 CTGGAGTTCCGAGTGGGCGTGGG - Intronic
980051959 4:128047869-128047891 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
980227954 4:130012830-130012852 CTGGAGTTCCGGGTGGGCAGGGG + Intergenic
980470252 4:133240719-133240741 CTGGAGTTCCGGGTGGGTGTGGG - Intergenic
980628571 4:135406668-135406690 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
980698728 4:136395397-136395419 CTAGAGTTCCGGGTGGGCGCGGG + Intergenic
980774467 4:137421070-137421092 CTAGAGTTCTGGGTGGGCGTGGG + Intergenic
980815528 4:137942120-137942142 CTGGAGTTCCAGGTGGGCGTGGG + Intergenic
980827341 4:138088880-138088902 CACGAGTTCTAGGTGGGCGTGGG - Intergenic
981048289 4:140286060-140286082 CTGTAATTCCAGGTGCTCGGGGG + Intronic
981146799 4:141333504-141333526 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
981176610 4:141690169-141690191 CTGGAGTTCCGTGTGGGCATGGG - Intronic
981275797 4:142897549-142897571 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
982024328 4:151236282-151236304 CGGGGGTTCCAGGTGTGCGTGGG + Intronic
982408201 4:155044353-155044375 CTGGAGTTCCTGGTGGGCGTGGG + Intergenic
982647653 4:158044220-158044242 CTAGAGTTCCGGGTGGGCGTGGG + Intergenic
982679073 4:158408117-158408139 CTGGAGTTCCGGGTGGGCGTGGG + Intronic
982814608 4:159869345-159869367 CTGGAGTTCTGGGTGGGCGTGGG - Intergenic
982868835 4:160550428-160550450 CTGGAATTCCGGGTGGGCGTGGG - Intergenic
983026074 4:162739590-162739612 CTGGAGTTCCGGGCGGGCGGGGG + Intergenic
983060314 4:163152895-163152917 CTGGAGTTCCGGGTGGGCATGGG + Intronic
983064108 4:163190016-163190038 CTGGAGTTCTGGGTGGGCGTGGG - Intergenic
983230682 4:165126248-165126270 CTGGAGTTCGGGGTGGGCGTGGG - Intronic
983553080 4:169036146-169036168 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
983656714 4:170091279-170091301 CTAGAGTTCCGGGTGGGCGTGGG + Intronic
983734689 4:171043219-171043241 CTAGAGTTCCGAGTGGGCGTGGG + Intergenic
983752819 4:171298324-171298346 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
984069269 4:175092161-175092183 CGCGAGTTCCAGGTGGGCGTGGG + Intergenic
984192863 4:176625474-176625496 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
984238844 4:177193505-177193527 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
984265629 4:177495642-177495664 CTGGAGTTCCGGGTGGGCATGGG + Intergenic
984275765 4:177607419-177607441 CGCCAGTTCCAGGTGGGTGTGGG - Intergenic
984441870 4:179781065-179781087 CTGTAGTGGCAGGTGGGTGCAGG - Intergenic
984662225 4:182386610-182386632 CTGTAGTTCCGGGTGGGCGTGGG + Intronic
984770547 4:183433224-183433246 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
984776130 4:183482974-183482996 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
984805369 4:183746750-183746772 TGCGAGTTCCAGGTGGGCGTGGG - Intergenic
984914275 4:184707167-184707189 CTGTAGTTCTGGGTGAGCTTGGG - Intronic
984948748 4:184990399-184990421 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
985087073 4:186324634-186324656 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
985145409 4:186890164-186890186 CACGAGTTCCGGGTGGGCGTGGG + Intergenic
985195199 4:187421259-187421281 CTGGAGTTCTGGGTGGGCGTGGG - Intergenic
985203226 4:187505680-187505702 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
985366375 4:189236357-189236379 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
985403895 4:189616956-189616978 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
985412122 4:189695965-189695987 CACGAGTTCCCGGTGGGCGTGGG - Intergenic
985971266 5:3380594-3380616 CTGGAGTTCCAGGTGCTCCTGGG - Intergenic
986151977 5:5137835-5137857 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
986697972 5:10375208-10375230 CTGGAGTTCCGGGTGGGCATGGG + Intronic
986912413 5:12574255-12574277 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
986993256 5:13578561-13578583 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
987146276 5:14994116-14994138 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
987156814 5:15096866-15096888 CTGGAGTTCCGGGTGGGCATGGG - Intergenic
987315271 5:16718001-16718023 CTGGAGTTGCGGGTGGGCGTGGG + Intronic
987347453 5:16991249-16991271 CGCGAGTTCCAGGTAGGCGTGGG - Intergenic
987352304 5:17032703-17032725 CGCGAGTTCCCGGTGGGCGTGGG - Intergenic
987365019 5:17140978-17141000 CGGGAGTTCCGGGTGGGCGTGGG + Intronic
987384038 5:17312083-17312105 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
987532810 5:19143081-19143103 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
987543803 5:19287794-19287816 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
987876926 5:23691174-23691196 CTGGAGTTCTGGGTGGACGTGGG + Intergenic
987896269 5:23951346-23951368 CTGGAGTTCCGGGTGGGCGTGGG + Intronic
987990268 5:25200333-25200355 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
988073464 5:26324471-26324493 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
988087014 5:26485590-26485612 TTGGAGTTCCGGGTGGACGTGGG - Intergenic
988132133 5:27119947-27119969 CTGGAGTTCCGGGTGGGCGTGGG + Intronic
988143081 5:27267508-27267530 CATGAGTTCCGGGTGGGCGTGGG - Intergenic
988155080 5:27439761-27439783 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
988279578 5:29127933-29127955 CTGGAGTTCCGGGTGGGTGTGGG - Intergenic
988684760 5:33515697-33515719 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
988883562 5:35531676-35531698 CTGGAGTTCCAGGTGGGCGTAGG + Intergenic
988915920 5:35893178-35893200 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
989346773 5:40438709-40438731 CTGGAGTTCCGGGTGGGCGTCGG + Intergenic
989956823 5:50369488-50369510 CTGGAGTTCTGGGTGGGTGTGGG + Intergenic
989957906 5:50376882-50376904 CTGGAGTTCTGGGTGGGTGTGGG + Intergenic
989965805 5:50465064-50465086 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
990323204 5:54649332-54649354 CCAGAGTTCCGGGTGGGCGTGGG - Intergenic
990345237 5:54865127-54865149 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
990461500 5:56035539-56035561 CTGGAGTTCCGGGTGGGCATGGG + Intergenic
991168642 5:63594067-63594089 CTGAAGTACCAGGTGGGGGTGGG + Intergenic
991214923 5:64150130-64150152 CTAGAGTTCCGGGTGGGCGTGGG + Intergenic
991567594 5:68020714-68020736 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
992050340 5:72935288-72935310 CGTGAGTTCCGGGTGGGCGTGGG + Intergenic
992296716 5:75333735-75333757 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
992751328 5:79865479-79865501 CTGTAGTCCCAGGTTGAGGTGGG - Intergenic
992947289 5:81823103-81823125 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
992947425 5:81823772-81823794 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
993031842 5:82714730-82714752 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
993202231 5:84830607-84830629 CGGGAGTTCCAGGTGGGCGTTGG - Intergenic
993320957 5:86466991-86467013 CTGGAGTTCCAGGTGGGCATGGG - Intergenic
993328603 5:86569834-86569856 CTGGAGTTCAGGGTGGGCTTGGG - Intergenic
993529214 5:89003928-89003950 CTGGAGTTCCGGATGGGCGTGGG - Intergenic
993678619 5:90847783-90847805 CGCGAGTTCCGGGTGGGCGTGGG - Intronic
993770259 5:91917327-91917349 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
993822010 5:92631383-92631405 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
994096316 5:95851217-95851239 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
994229941 5:97301198-97301220 CTGGAGTTCCAGCTGGGCATGGG + Intergenic
994239849 5:97407229-97407251 CACGAGTTCCGGGTGGGCGTGGG + Intergenic
994254814 5:97580303-97580325 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
994507086 5:100656813-100656835 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
994509865 5:100689177-100689199 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
994605627 5:101962756-101962778 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
994620315 5:102154990-102155012 CTAGAGTTCCGGGTGGGCGTGGG + Intergenic
994669728 5:102752117-102752139 CTAGAGTTCCGGGTGGGCGTGGG + Intergenic
994701724 5:103142347-103142369 CTGGAGTTCTGGGTGGGCGTGGG - Intronic
994768660 5:103954121-103954143 GCGGAGTTCCGGGTGGGCGTGGG - Intergenic
994769811 5:103966635-103966657 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
994935266 5:106246303-106246325 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
995032296 5:107494295-107494317 CTGGAGTTCCGGGTGGGCGTGGG + Intronic
995206675 5:109488121-109488143 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
995326428 5:110894293-110894315 CGCGAGTTCCCGGTGGGCGTGGG - Intergenic
995568652 5:113457194-113457216 CTGGAGTTCCAGGTGGGCCTGGG + Intronic
995596474 5:113753428-113753450 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
995656485 5:114432731-114432753 CTGGAGTTCCGGGTGGGCGTGGG + Intronic
995679895 5:114704599-114704621 CTGGAGTTCCGGGTGGGCATGGG - Intergenic
995700339 5:114928886-114928908 CGTGAGTTCCAGGTGGACGTGGG + Intergenic
995920373 5:117304711-117304733 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
995975786 5:118033829-118033851 CTAGAGTTCCGGGTGGGCGTGGG + Intergenic
996107023 5:119517154-119517176 CTTGAGTTCTGGGTGGGCGTGGG + Intronic
996234199 5:121107227-121107249 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
996298582 5:121954262-121954284 CGCTAGTTCCGGGTGGGCGCAGG - Intergenic
996435666 5:123430597-123430619 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
996478717 5:123949498-123949520 CGGGAGTTCCGGGTGGGCATGGG - Intergenic
996531535 5:124532655-124532677 CTGGAGCTGCAGGTGGGCATCGG - Intergenic
996567173 5:124892466-124892488 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
996585977 5:125088753-125088775 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
996747122 5:126854841-126854863 CGTGAGTTCCGGGTGGGCGTGGG - Intergenic
996815552 5:127569505-127569527 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
997158221 5:131580344-131580366 CACAAGTTCCGGGTGGGCGTGGG - Intronic
997375480 5:133394403-133394425 CCTGAGTTCCAGGTGGGCATGGG + Intronic
997760534 5:136444263-136444285 TTGGAGTTCCGGGTGGGTGTGGG + Intergenic
999348528 5:150845514-150845536 CACGAGTTCCGGGTGGGCGTGGG + Intergenic
999406155 5:151309237-151309259 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
999855308 5:155587061-155587083 CTGGAGTTCCAGGTGGGCGTGGG - Intergenic
1000066009 5:157693888-157693910 CTGGAGTTCCAGGTGGGCGTGGG + Intergenic
1000212341 5:159119223-159119245 CGTGAGTTCCGGGTGGGCGTGGG + Intergenic
1000329216 5:160194207-160194229 CTGGAGTTGCCGGTGGGCGTGGG - Intronic
1000891842 5:166810506-166810528 CTGGAGTTCTGGGTGGGTGTGGG - Intergenic
1000902509 5:166927257-166927279 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
1001129623 5:169053129-169053151 CTGTAGCTACAGTTGGGAGTTGG + Intronic
1001636423 5:173213495-173213517 CTAGAGTTCTGGGTGGGCGTGGG + Intergenic
1002004660 5:176222335-176222357 CTGGAGTTCCGGGTAGGCGTGGG - Intergenic
1002024590 5:176388401-176388423 CTGGGGTTCCGGGTGGCCGTGGG - Intronic
1002221718 5:177688285-177688307 CTGGAGTTCCGGGTAGGCGTGGG + Intergenic
1002757989 6:179623-179645 CTAGAGTTCCGGGTGGGCGTGGG + Intergenic
1002789402 6:426511-426533 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
1002790753 6:435848-435870 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
1002793185 6:450036-450058 CTACAGTTCCGGGTGGGCGTGGG + Intergenic
1003060700 6:2860194-2860216 CTGGAGTTCCGGGTGGACGTGGG + Intergenic
1003061925 6:2870377-2870399 CATGAGTTCCAGGTGGGCGCAGG - Intergenic
1003069645 6:2935859-2935881 CTAGAGTTCCGGGTGGGCGTGGG + Intergenic
1003070198 6:2939680-2939702 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1003081888 6:3027752-3027774 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1003100166 6:3170816-3170838 CTAGAGTTCCAGGTGGGCGTGGG + Intergenic
1003170874 6:3721075-3721097 CTGGAGTTCCGGGTGGGCCTGGG - Intergenic
1003178463 6:3771688-3771710 CTAGAGTTCCGGGTGGGCGTGGG + Intergenic
1003213727 6:4090192-4090214 CGCCAGTTCCGGGTGGGCGTGGG + Intronic
1003327144 6:5100568-5100590 CTGTGGTTAGAGGTGGGGGTGGG + Intergenic
1003489243 6:6606736-6606758 CGCGAGTTCCGGGTGGGCGTGGG - Intronic
1003506697 6:6745984-6746006 CGCAAGTTCCGGGTGGGCGTGGG - Intergenic
1003508861 6:6762790-6762812 CTAGAGTTCCGGGTGGGCGTGGG - Intergenic
1003578314 6:7317044-7317066 CGCGAGTTCCGGGTGGGCGTGGG - Intronic
1003581421 6:7344267-7344289 CTGGAGTTCCGGGTAGGCGTGGG + Intronic
1003671515 6:8164387-8164409 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1003717674 6:8666018-8666040 CTGGAGTTCCGGGTGGGCATGGG + Intergenic
1003736874 6:8887217-8887239 CTGGAGTTCGGGGTGGGCATGGG + Intergenic
1003747986 6:9024328-9024350 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1003770182 6:9290746-9290768 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1003836235 6:10074988-10075010 CGCGAGTTCCGGGTGGGCGTGGG - Intronic
1003845707 6:10171773-10171795 CTGGAGTTCCGGGTGGGCATGGG + Intronic
1003897036 6:10617327-10617349 CGTGAGTTCCGGGTGGGCGTGGG - Intronic
1003901568 6:10659936-10659958 CTAGAGTTCCGGGTGGGCGTGGG + Intergenic
1003908104 6:10720644-10720666 TTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1003947256 6:11087267-11087289 CTGGAGCTCCGGGTGGGCGTGGG + Intergenic
1003982493 6:11402892-11402914 CTAGAGTTCCCGGTGGGCGTGGG - Intergenic
1003983994 6:11417304-11417326 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
1004053177 6:12108700-12108722 CTGGAGCTCCGGGTGGGCGTGGG - Intronic
1004196608 6:13511340-13511362 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
1004224375 6:13772540-13772562 CTGGAGTTCCAGGTGGGCGTGGG + Intergenic
1004233730 6:13855027-13855049 CTGGAGTTCCGGTTGGGCGTAGG - Intergenic
1004235566 6:13872232-13872254 CTAGAGTTCCGCGTGGGCGTGGG - Intergenic
1004452411 6:15759068-15759090 CTAGAGTTCCGGGTGGGCGTGGG - Intergenic
1004486293 6:16069497-16069519 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1004499696 6:16198400-16198422 CTAGATTTCCGGGTGGGCGTGGG - Intergenic
1004502112 6:16218307-16218329 CTGCAGTTCCGGGTGGGCGTGGG - Intergenic
1004511624 6:16288304-16288326 CTGGAGTTCCGGGTGGGTGTGGG + Intronic
1004663290 6:17728810-17728832 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
1004665550 6:17745617-17745639 CTGGAGTTCCGGGTGGGCGCGGG - Intergenic
1004689116 6:17976498-17976520 CTGGAGTTCTGGGTGGGCGTGGG - Intronic
1004861400 6:19807278-19807300 CGCGAGTTCCAGGTGGGCGTGGG - Intergenic
1004866080 6:19854736-19854758 CTGGAGTTCCGCGTGGGCGTGGG - Intergenic
1004905413 6:20233268-20233290 CGCGAGTTCCAGGTGGGCGTGGG + Intergenic
1004906190 6:20239113-20239135 CGCGAGTTCCAGGTGGGCGTGGG + Intergenic
1004906958 6:20245080-20245102 CTGGAGTTCCAGGTGGGCGTGGG - Intergenic
1004908497 6:20259618-20259640 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
1004914426 6:20318969-20318991 CGCGAGTTCCGGGTGGGCGTAGG + Intergenic
1005042283 6:21610171-21610193 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
1005059259 6:21761209-21761231 CGCGAGTTCCAGGTGGGTGTGGG + Intergenic
1005117752 6:22356719-22356741 CGCGAGTTCCAGGTGGGTGTGGG - Intergenic
1005332904 6:24766246-24766268 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1005561421 6:27045336-27045358 CACGAGTTCCGGGTGGGCGTGGG + Intergenic
1005596234 6:27381368-27381390 CTGGAGTTCCGGTTGGGCGTGGG - Intronic
1005600899 6:27425138-27425160 CTGGAGTTCCGGGAGGGCGTGGG - Intergenic
1005749086 6:28866750-28866772 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
1005749955 6:28872903-28872925 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1005758917 6:28950103-28950125 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1005759783 6:28957895-28957917 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1005977029 6:30807752-30807774 CGGGAGTTCCGGGTGGGCGTGGG - Intergenic
1005978264 6:30816608-30816630 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1006005756 6:31000540-31000562 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1006008280 6:31020771-31020793 CTGCAGTTCCAGGTAGGCGTGGG + Intronic
1006033613 6:31195511-31195533 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1006127944 6:31852107-31852129 CGCAAGTTCCGGGTGGGCGTGGG + Intergenic
1006351124 6:33521809-33521831 CTCGAGTTCCGGGTGGGCGCGGG - Intergenic
1006352617 6:33532440-33532462 CTGAAGTTCCAGGTGGGCGTGGG + Intergenic
1006477807 6:34269076-34269098 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1006695987 6:35931317-35931339 CTGGAGTTCCAGGTGGGCGTGGG + Intergenic
1006978389 6:38124629-38124651 CTAGAGTTCCAGATGGGCATGGG - Intronic
1007738713 6:43998148-43998170 CGCAAGTTCCGGGTGGGCGTGGG + Intergenic
1008005616 6:46406076-46406098 CTGGAGTTCTGGGTGGGCGTGGG - Intronic
1008038758 6:46774649-46774671 CTGGAGTTCTGGGTGGGCGTGGG + Intergenic
1008270514 6:49483727-49483749 CTGTAGTTCCAGGTGGGCGTGGG - Intronic
1008284369 6:49629859-49629881 CTGGAGTTCTGGGTGGGCATGGG - Intronic
1008308334 6:49933729-49933751 CTAGAGTTCCAGGTGGGCATGGG + Intergenic
1008770973 6:54979286-54979308 CTGGAATTCCGGGTGGGCGTGGG + Intergenic
1009407121 6:63326764-63326786 CTGGAGTTCTGGGTGGGCGTGGG - Intergenic
1009418852 6:63443255-63443277 CACCAGTTCCAGGTGGGCGCGGG - Intergenic
1009470258 6:64023827-64023849 CGCGAGTTCCAGGTGGGCGTGGG + Intronic
1009685314 6:66949266-66949288 CTGGAGTTCCGGGTGGGTGTGGG + Intergenic
1009872240 6:69467252-69467274 CTAGAGTTCCAGATGGGCGTGGG + Intergenic
1009968687 6:70604215-70604237 CTGTGGTGCCAGGTGGGAATGGG - Intergenic
1010066274 6:71686210-71686232 CGGGAGTTCCGGGTGGGCGTGGG + Intergenic
1010199338 6:73269183-73269205 CTGGAGTTCCGGGTGGGCATGGG - Intronic
1010617356 6:78029849-78029871 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1011143667 6:84189418-84189440 CTGGAGTTCCGGGTGGGCATGGG + Intronic
1011246499 6:85326029-85326051 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1011338369 6:86285086-86285108 CGTGAGTTCCAGGTGGGTGTGGG - Intergenic
1011601589 6:89065074-89065096 CTGGAGTTCCAGGGGGGCGTGGG + Intergenic
1011931781 6:92723548-92723570 CGTGAGTTCCGGGTGGGCGTGGG + Intergenic
1011974743 6:93282697-93282719 CGCGAGTTCCCGGTGGGCGTGGG + Intronic
1012189364 6:96261255-96261277 CTGGAGTTCTGGGTGGGCGTGGG - Intergenic
1012547866 6:100440319-100440341 CTTTAGTGCCAGATGGGCCTGGG - Intronic
1012733557 6:102910950-102910972 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
1012733901 6:102914740-102914762 CGGTGGTTCCATGTGGGGGTGGG + Intergenic
1012760526 6:103294713-103294735 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1012850975 6:104446386-104446408 CGTGAGTTCCGGGTGGGCGTGGG + Intergenic
1012968427 6:105700612-105700634 TTGTAGTTCCACGTGGGCTGGGG - Intergenic
1013025746 6:106269716-106269738 CTGGAGTTCCGGGTGGGTGTGGG - Intronic
1013080210 6:106805815-106805837 CTGGAGTTCTGGGTGGGCATGGG + Intergenic
1013081510 6:106817072-106817094 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1013143592 6:107364555-107364577 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
1013410799 6:109881451-109881473 CTGGAGTTCTGGGTGGGCGTGGG - Intergenic
1013853360 6:114541993-114542015 CACGAGTTCCAGGTGGGTGTGGG - Intergenic
1013955369 6:115834910-115834932 CTGGAGTTCCGGGTGGGCATGGG - Intergenic
1013957222 6:115855246-115855268 CATGAGTTCCAGGTGGGCGCGGG + Intergenic
1013960069 6:115889155-115889177 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1013963465 6:115928349-115928371 CACGAGTTCCGGGTGGGCGTGGG - Intergenic
1014055863 6:117014811-117014833 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1014240716 6:119015374-119015396 CTGGAGTTCTGGGTGGGTGTGGG + Intronic
1014507739 6:122280631-122280653 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1014718540 6:124892023-124892045 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1014921096 6:127214900-127214922 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1015572278 6:134633855-134633877 CTGGAGTTCTGGGTGGGCGTGGG - Intergenic
1015600322 6:134904781-134904803 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1015962153 6:138660967-138660989 CTGTAGTCCCAGTTGGGACTGGG + Intronic
1016067396 6:139698225-139698247 CTGGAGTTCCGGGTGGGCCTGGG - Intergenic
1016069912 6:139726658-139726680 CTGGAGTTCCAGGTGGGCGTGGG - Intergenic
1016092856 6:139999894-139999916 CTGGAGTTCTGGGTGGGCGTGGG - Intergenic
1016858942 6:148698354-148698376 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1016859082 6:148698890-148698912 CGCCAGTTCCGGGTGGGCGTGGG - Intergenic
1017298959 6:152834394-152834416 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1017325062 6:153133672-153133694 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1017581247 6:155867065-155867087 CTGGAGTTCTAGGTGGGCGTGGG - Intergenic
1017839534 6:158210098-158210120 CTGGAGTTCTGAGTGGGCGTGGG - Intergenic
1018064262 6:160114811-160114833 CTGGAATTCCGGGTGGGCGTGGG - Intergenic
1018545652 6:164933350-164933372 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1018624671 6:165765596-165765618 CTGGAGTTCCAGGTGGGCGTGGG - Intronic
1018696454 6:166395289-166395311 CTGTGGATCCAGCTGGGCGTGGG - Intergenic
1019177011 6:170165172-170165194 CTGTAGCTGGAAGTGGGCGTAGG - Intergenic
1019944296 7:4314248-4314270 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1019965778 7:4497240-4497262 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1020008262 7:4793578-4793600 CGCGAGTTCCGGGTGGGCGTGGG + Intronic
1020163917 7:5793635-5793657 CTAGAGTTCCGGGTGGGCGTGGG + Intergenic
1020552297 7:9621756-9621778 CGTGAGTTCCGGGTGGGCGTGGG - Intergenic
1021324099 7:19245534-19245556 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1021513837 7:21461555-21461577 CTAGAGTTCCGGGTGGGTGTGGG - Intronic
1021520719 7:21536845-21536867 CACAAGTTCCGGGTGGGCGTGGG - Intergenic
1021567366 7:22028730-22028752 CGTGAGTTCCGGGTGGGCGTGGG + Intergenic
1021576831 7:22112710-22112732 CTGTAGTTCCAGCTGCTCGGGGG + Intergenic
1021686786 7:23194037-23194059 CTGGAGTTCCGAGTGGGCGTGGG - Intronic
1021761304 7:23905024-23905046 CTAGAGTTCCGGGTGGGCGTGGG - Intergenic
1021788374 7:24175218-24175240 CAGGAGTTCAAGGTTGGCGTGGG + Intergenic
1022174161 7:27857322-27857344 CACGAGTTCCGGGTGGGCGTGGG - Intronic
1022750411 7:33219024-33219046 CTGGAGTTCCGGGTGGGTGTGGG + Intronic
1023279524 7:38555291-38555313 CTGTAGTCCCAGCTGTGGGTAGG + Intronic
1023396230 7:39754249-39754271 CTAGAGTTCCAGGTGGGCGTGGG - Intergenic
1024269050 7:47628527-47628549 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1024691252 7:51805885-51805907 CTGGAGTTCCTGGTGGGCGTGGG + Intergenic
1024700662 7:51901205-51901227 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1024741757 7:52362701-52362723 CTCTAGTTCCGGGTGGGCTTGGG + Intergenic
1024748229 7:52431550-52431572 CACGAGTTTCAGGTGGGCGTGGG - Intergenic
1024794320 7:53003984-53004006 CTGGAGTTCCCAGTGGGCATGGG + Intergenic
1024834020 7:53495071-53495093 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1024903957 7:54354612-54354634 CTGGTGTTTCCGGTGGGCGTGGG + Intergenic
1026187114 7:68090724-68090746 CTGGAGTTCTGGGTGGGCGTGGG - Intergenic
1026202921 7:68231081-68231103 GCGGAGTTCCGGGTGGGCGTGGG + Intergenic
1026335874 7:69393879-69393901 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1026512317 7:71037645-71037667 CTGGAGTTCAGGGTGGGCGTGGG + Intergenic
1026516540 7:71078040-71078062 GTGCAGTTCCGGGTGGGCATGGG + Intergenic
1026596584 7:71738389-71738411 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1027238035 7:76309747-76309769 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
1027241900 7:76336041-76336063 CTGTAGTTCCAGGTTGAGGCAGG - Intronic
1027561643 7:79739350-79739372 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1027564065 7:79768274-79768296 CTGGAGTTCTGGGTGGGCGTGGG - Intergenic
1027579742 7:79977919-79977941 CTGGAGTTCTGGGTGGGCCTGGG - Intergenic
1027665869 7:81042759-81042781 CTGGAGTTCCGGGTGGGTGTGGG + Intergenic
1027667556 7:81057793-81057815 CTGGAGTTCCGGGTGGGCATGGG - Intergenic
1027668725 7:81071159-81071181 CTCGAGTTCCAGGTGGGCATGGG + Intergenic
1027698310 7:81437398-81437420 CTGCAGCTCCGGGTGGGCATGGG - Intergenic
1027868071 7:83673368-83673390 CTGGAGTTCCAGGTGGGCGTGGG + Intergenic
1028070066 7:86440617-86440639 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1028142476 7:87288774-87288796 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1028303317 7:89229038-89229060 CGCGAGTTCCAGGTGGGCGTGGG - Intronic
1028392644 7:90334471-90334493 CTAGAGTTCTGGGTGGGCGTGGG + Intergenic
1028511246 7:91627703-91627725 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1028719444 7:94012177-94012199 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
1028778301 7:94705545-94705567 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1028805247 7:95018736-95018758 CTGCATTTCCCTGTGGGCGTTGG + Intronic
1028845500 7:95475293-95475315 TTCTACATCCAGGTGGGCGTGGG - Intergenic
1028852547 7:95552776-95552798 CTGGAGTTCCGGGTGGGTGTGGG - Intergenic
1028989477 7:97034390-97034412 CTAGAGTTCCAGGTGGGCCTGGG + Intergenic
1029076130 7:97935980-97936002 CTGGAGTTCCAGGTGGGCGTGGG + Intergenic
1029407067 7:100381778-100381800 CTAGAGTTCTGGGTGGGCGTGGG + Intronic
1029567487 7:101348625-101348647 CTGGAGTTCTGGGTGGGCGTGGG + Intergenic
1029809645 7:103034513-103034535 CGGGAGTTCCGGGTGGGCGTGGG - Intronic
1029832399 7:103275235-103275257 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1030050802 7:105535669-105535691 CTGTAGTCTCAGGTGGGCTGAGG - Intronic
1030102141 7:105956067-105956089 CGCTAGTTCCAGGTGGGTGTGGG - Intronic
1030215744 7:107042628-107042650 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
1030292670 7:107888037-107888059 CTAGAGTTCCGGGTGGGCGTGGG + Intergenic
1030367039 7:108657527-108657549 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
1030600007 7:111582253-111582275 CTGGAGTTTCGGGTGGGCGTGGG - Intergenic
1030733456 7:113017393-113017415 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1030780388 7:113593370-113593392 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1030980704 7:116182232-116182254 CGCTAGTTCCGGGTGGGCGTGGG - Intergenic
1031292279 7:119951821-119951843 CTGGAGTTCCGGGTGGGCGGGGG - Intergenic
1031378772 7:121060020-121060042 CTGGAGTTCCGGGTGGGCGTGGG + Intronic
1031409186 7:121421780-121421802 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1031605543 7:123763481-123763503 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
1031902841 7:127429216-127429238 CTCAAGTTCCGGGTGGGCGTGGG + Intronic
1031916352 7:127566413-127566435 CTGTAATTCCAGTTGGGGTTTGG - Intergenic
1032248050 7:130230072-130230094 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1032339626 7:131058813-131058835 CACGAGTTCCGGGTGGGCGTGGG + Intergenic
1032561631 7:132898917-132898939 CTGGAGTTCCGGGTGGGTGTGGG - Intronic
1033065061 7:138146214-138146236 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
1033394109 7:140957254-140957276 CTGGAGTTCCGGGTGGGTGTGGG - Intergenic
1033664130 7:143424707-143424729 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1033758623 7:144418208-144418230 CATGAGTTCCAGGTGGGCGTGGG - Intergenic
1033779300 7:144650470-144650492 CGCGAGTTCCAGGTGGGTGTGGG + Intronic
1033866662 7:145697679-145697701 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
1034091017 7:148363858-148363880 CTGGAGTTCCGGGTGGGCGTGGG + Intronic
1034097888 7:148426459-148426481 CTGGAGTTCTGGGTGGGCGTGGG + Intergenic
1034154992 7:148949131-148949153 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1034167780 7:149039007-149039029 CTGAAGTTCCGGCTGGGCGTGGG - Intergenic
1034632161 7:152539170-152539192 CTGGAGTTCCGGGTGGGTGTGGG - Intergenic
1035151210 7:156874314-156874336 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
1035241024 7:157529276-157529298 CTCCAGTTCCAAGTGGGCGGAGG - Intergenic
1035833889 8:2727885-2727907 CGCGAGTTCCCGGTGGGCGTGGG + Intergenic
1035999219 8:4582877-4582899 CTGGAGTTCCGGGTGGGCGTGGG + Intronic
1036135039 8:6152757-6152779 CACAAGTTCCGGGTGGGCGTGGG + Intergenic
1036260454 8:7235748-7235770 CTGGAGTTCTGGATGGGCGTGGG + Intergenic
1036306161 8:7603774-7603796 CTGGAGTTCTGGATGGGCGTGGG - Intergenic
1036312491 8:7694304-7694326 CTGGAGTTCTGGATGGGCGTGGG + Intergenic
1036357006 8:8051759-8051781 CTGGAGTTCTGGATGGGCGTGGG - Intergenic
1036441060 8:8781702-8781724 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1036801346 8:11794855-11794877 CGCAAGTTCCGGGTGGGCGTGGG + Intergenic
1036831344 8:12022712-12022734 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1036848433 8:12185346-12185368 ATGTAGGCCCGGGTGGGCGTGGG + Intronic
1036869793 8:12427627-12427649 ATGTAGGCCCGGGTGGGCGTGGG + Intronic
1036901564 8:12673503-12673525 CTGAAGTTCCAGGTGGGCATGGG + Intergenic
1036914954 8:12796345-12796367 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1037239528 8:16760818-16760840 CTCGAGTTCCAGGTGGGTGTGGG - Intergenic
1037241526 8:16783956-16783978 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1037263868 8:17037128-17037150 CTGGAGTTCCAGGTGGGCGTGGG - Intronic
1037595769 8:20353009-20353031 CTGGAGTTTTAGGTGGGCCTGGG - Intergenic
1037810947 8:22086604-22086626 CTGGAGTTCCGGGTGGGCTTGGG + Intergenic
1037894065 8:22640300-22640322 CTGTAGTCCCAGCTGTACGTGGG - Intronic
1037957581 8:23071096-23071118 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1037971367 8:23174111-23174133 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1037983503 8:23272168-23272190 CTGGAGTTCCGGGTGGGCGTTGG + Intronic
1038174045 8:25164546-25164568 CTGGAGTTCCAGGTGGGCGTGGG + Intergenic
1038638252 8:29304303-29304325 CTGGAGTTCCCGGTGGGCATGGG + Intergenic
1038639378 8:29311515-29311537 CTGGAGTTCCAGGTGGGTGTGGG + Intergenic
1038649838 8:29392498-29392520 CTGTGCTTGCAGGTGGGAGTGGG + Intergenic
1038847622 8:31244416-31244438 CGTGAGTTCCGGGTGGGCGTGGG - Intergenic
1038870674 8:31489906-31489928 CTGGAGTTCTGGGTGGGCATGGG + Intergenic
1039068712 8:33631728-33631750 CTAGAGTTCTGGGTGGGCGTGGG + Intergenic
1039069141 8:33634143-33634165 CTGGAGTTCCGTGTGGGCGTGGG - Intergenic
1039637273 8:39180164-39180186 CTGGAGTTCCGGGTGGGCGTGGG + Intronic
1040003719 8:42600372-42600394 CGCGAGTTCCAGGTGGGCATGGG - Intergenic
1040026528 8:42786825-42786847 CGTGAGTTCCAGGTGGGCGTGGG + Intronic
1040622262 8:49103329-49103351 CTAGAGTTCCAGGTGGGCATGGG - Intergenic
1040723100 8:50349968-50349990 CTGGAGTTCTGGGTGGGCGTGGG + Intronic
1040804322 8:51377567-51377589 CGCGAGTTCCGGGTGGGCGTGGG + Intronic
1040952727 8:52953167-52953189 CTGGAGTTCTGGGTGGGCATGGG - Intergenic
1040952866 8:52953863-52953885 CACGAGTTCCGGGTGGGCGTGGG + Intergenic
1040954948 8:52970157-52970179 CTGGAGTTCCAGGTGGGCGTGGG - Intergenic
1040965599 8:53077938-53077960 CGTGAGTTCCAGGTGGGCGCGGG - Intergenic
1041034683 8:53776209-53776231 CTGGAGTTCTGGGTGGGCGTGGG - Intronic
1041623530 8:59999914-59999936 CACGAGTTCCAGGTGGGCATGGG + Intergenic
1041914504 8:63126159-63126181 CTGGAGTTCCGGGTGGGCGGGGG + Intergenic
1041918906 8:63162039-63162061 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1042354304 8:67809444-67809466 CTGCAGTTCTAGGTGGACGCTGG + Intergenic
1042512592 8:69626782-69626804 CTGGAGTTCCGGATGGGCGTGGG - Intronic
1043110096 8:76169658-76169680 CTGGAGTTCCAGGTGGGCGTGGG + Intergenic
1043129965 8:76447924-76447946 CCGGAGTTCTGGGTGGGCGTGGG - Intergenic
1043224048 8:77700775-77700797 CGCAGGTTCCAGGTGGGCGTGGG + Intergenic
1043346433 8:79303544-79303566 CTGGAGTTCCCGGTGGGCGTGGG + Intergenic
1043352515 8:79377515-79377537 CTGGAGTTCCGGGTGGGCTTGGG - Intergenic
1043435296 8:80231858-80231880 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1043640145 8:82441472-82441494 CTCCAGTTCCGGGTGGGCGTGGG + Intergenic
1043709854 8:83402988-83403010 CTGGAGTTCTGGGTGGGCGTGGG + Intergenic
1043857137 8:85276112-85276134 CACGAGTTCCGGGTGGGCGTGGG + Intronic
1044075797 8:87820884-87820906 CTGCAGTTCCGGGTGGGCGTGGG + Intergenic
1044088463 8:87971197-87971219 CACGAGTTCCGGGTGGGCGTGGG + Intergenic
1044633502 8:94300644-94300666 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1044788656 8:95823688-95823710 CTGGAGTTCCAGGTGGGCGTGGG + Intergenic
1044853557 8:96452382-96452404 CAAGAGTTCCGGGTGGGCGTGGG + Intergenic
1044862174 8:96534120-96534142 AGTGAGTTCCAGGTGGGCGTGGG - Intronic
1044880688 8:96719396-96719418 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
1045232350 8:100317091-100317113 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
1045467788 8:102485822-102485844 CTGGAGTTCCGAGTGGGCGTGGG - Intergenic
1046149375 8:110202881-110202903 CTGGAGTTCCGGGTGGGCGTAGG - Intergenic
1046265417 8:111823593-111823615 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1046285064 8:112083245-112083267 CTGGAGTTCTGGGTGGGCATGGG - Intergenic
1046288879 8:112132742-112132764 CTGGAGTTGCGGGCGGGCGTGGG + Intergenic
1046445309 8:114311401-114311423 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1046450688 8:114386206-114386228 CTGAAGTTCCGGGTGGGCGTGGG + Intergenic
1046621195 8:116531137-116531159 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
1046661226 8:116950046-116950068 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
1047100200 8:121667723-121667745 CGCGAGTTCCGGGTGGGCGTAGG - Intergenic
1047124712 8:121948086-121948108 CTAGAGTTCCGGGTGGGCGTGGG + Intergenic
1047631732 8:126714947-126714969 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1048281070 8:133106066-133106088 CTTTAGCTCTAGGTGGGGGTGGG + Intronic
1048655434 8:136530720-136530742 CGCGAGTTCCGGGTGGGCGTAGG - Intergenic
1048757528 8:137755431-137755453 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1048789145 8:138084185-138084207 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1049087666 8:140490825-140490847 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1049500286 8:142959527-142959549 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1050249933 9:3733862-3733884 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
1050920594 9:11196929-11196951 CTGGAGTTCCAGGTGCGCGTGGG + Intergenic
1051305117 9:15700352-15700374 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
1051314217 9:15810714-15810736 CGCGAGTTCCGGGTGGGCGTGGG - Intronic
1051369775 9:16348519-16348541 CTCTGGTTCCAAGTGGGCATGGG + Intergenic
1051383277 9:16480558-16480580 CTGGAGTTCCGGGTGGGCGTGGG + Intronic
1051439834 9:17072655-17072677 CTGGAGTTCTGGGTGGGCGTGGG + Intergenic
1051459454 9:17295140-17295162 CTAGAGTTCCGGGTGGGCGTGGG - Intronic
1051463775 9:17353985-17354007 CTGGAGTTTCGGGTGGGCGTGGG + Intronic
1051549799 9:18315640-18315662 CGCGAGTTCCAGGTGGGCGCGGG - Intergenic
1051892671 9:21959301-21959323 CTGGAGTTCCGGGTGGGCGTGGG + Intronic
1052075428 9:24135136-24135158 CTGGAGTTCCAGATGGGCGTGGG + Intergenic
1052313412 9:27092704-27092726 CACGAGTTCCGGGTGGGCGTGGG + Intergenic
1052979519 9:34437974-34437996 CTGGAGTTCCGAGTGGGCGTGGG + Intronic
1052985375 9:34483075-34483097 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
1053027313 9:34740547-34740569 CTGGAGTTCCAGGTGGGCGTGGG - Intergenic
1053393381 9:37751928-37751950 CTAGAGTTCCGGGTGGGCGTGGG + Intronic
1053436074 9:38075427-38075449 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
1053475222 9:38377628-38377650 CGGGAGTTCCGGGTGGGCGTGGG + Intergenic
1053547943 9:39042668-39042690 CTGGAGTTCCGGGTGGGCATGGG - Intergenic
1053812063 9:41862709-41862731 CTGGAGTTCTGGGTGGGCATGGG - Intergenic
1054618532 9:67324730-67324752 CTGGAGTTCTGGGTGGGCATGGG + Intergenic
1054722421 9:68617073-68617095 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1055049334 9:71963589-71963611 CTGGAGTTCCGGGTGGGCGTGGG + Intronic
1055102593 9:72480512-72480534 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
1055557605 9:77490693-77490715 CTGGGGTTCCGGGTGGGCGTGGG - Intronic
1055651347 9:78410047-78410069 CTGGAGTTCTGGGTGGGCGTTGG + Intergenic
1055814192 9:80185607-80185629 CTAGAGTTCCGGGTGGGCGTGGG - Intergenic
1055925596 9:81507423-81507445 CGCGAGTTCCAGGTGGGCGAGGG + Intergenic
1056080992 9:83093617-83093639 CTGGAGTTCCGGGTGGGCATGGG - Intergenic
1056216248 9:84408529-84408551 CTAGAGTTTCAAGTGGGCGTGGG + Intergenic
1056305737 9:85289097-85289119 CTAGAGTTCCGGGTGGGCATGGG + Intergenic
1056677264 9:88686225-88686247 CGCGAGTTCCAGGTAGGCGTGGG - Intergenic
1056703826 9:88934562-88934584 CTGTGGTTCCAGGTGTCCCTGGG - Intergenic
1056771423 9:89480729-89480751 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
1056913995 9:90729523-90729545 CTAGAGTTCCAGGTGCGCGTGGG + Intergenic
1057118145 9:92545321-92545343 CTAGAGTTCTGGGTGGGCGTGGG + Intronic
1057383948 9:94591454-94591476 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
1057511110 9:95680380-95680402 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1057543886 9:96002030-96002052 CTGGAGTTCCAGGTGGGCGTGGG - Intronic
1058174897 9:101724426-101724448 CTGGAGTTCTGGGTGGGCGTGGG - Intronic
1058235709 9:102487250-102487272 CGTGAGTTCCGGGTGGGCGTGGG - Intergenic
1058286540 9:103186962-103186984 CTGGAGTTCCGCGTGGGCGTGGG + Intergenic
1058365160 9:104200644-104200666 CGCAAGTTCCAGGTGGGCGTGGG + Intergenic
1058585393 9:106501602-106501624 CGCGATTTCCAGGTGGGCGTGGG - Intergenic
1058727497 9:107817843-107817865 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
1058786467 9:108393555-108393577 CTGGAGTTCCGGATGGGCGTGGG + Intergenic
1058799345 9:108530195-108530217 CTGGAGTTCTGGGTGGCCGTGGG + Intergenic
1059810592 9:117852076-117852098 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1059991588 9:119870593-119870615 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1060594258 9:124839032-124839054 CTGGAGTTCCGGATGGGTGTGGG - Intergenic
1060694827 9:125699742-125699764 CTGTAGTTCCAGGCTGAGGTAGG - Intronic
1061231164 9:129316611-129316633 CTGGAGATCCAGGCGGGCCTTGG - Intergenic
1061453914 9:130683675-130683697 CTGAAGTTCCAAGTGGGGCTGGG - Intergenic
1061483800 9:130910170-130910192 CTGGAGTTCCAGGTGGGCATGGG + Intronic
1062146236 9:134991342-134991364 CTGGACTTCCGGGTGGGGGTGGG - Intergenic
1062434938 9:136542805-136542827 CTGTAGCTCCTGGGGGGCGGAGG + Intronic
1203460450 Un_GL000220v1:31296-31318 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
1203662899 Un_KI270753v1:61681-61703 CGCGAGTTCCAGGTGGGCGTGGG - Intergenic
1203670472 Un_KI270755v1:7016-7038 CACGAGTTCCCGGTGGGCGTGGG + Intergenic
1186116112 X:6306682-6306704 CTGTAGTTCCAGGTACTCGGGGG + Intergenic
1186152626 X:6690818-6690840 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1186282104 X:8003582-8003604 CTAGAGTTCTGGGTGGGCGTGGG - Intergenic
1186293164 X:8121638-8121660 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
1186323280 X:8452802-8452824 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1187005869 X:15232042-15232064 CTGGAGTTCTGGGTGGGGGTGGG - Intergenic
1187139019 X:16575503-16575525 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1187304581 X:18083852-18083874 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1187410641 X:19048008-19048030 CCGCAGTTCTAGGTGGGCTTTGG + Intronic
1187557603 X:20367161-20367183 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1187903989 X:24049741-24049763 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1188111985 X:26204852-26204874 CGCGAGTTCCGGGTGGGCGTGGG + Intergenic
1188171337 X:26931728-26931750 CTGAAGTTCCTGGTGGGGGTGGG - Intergenic
1188189502 X:27157054-27157076 CTGGAGTTCCGGGTGGGCATGGG + Intergenic
1189209813 X:39275666-39275688 TGCAAGTTCCAGGTGGGCGTGGG + Intergenic
1189896859 X:45665079-45665101 CGCCAGTTCCAGGTGGGTGTGGG - Intergenic
1190045899 X:47111315-47111337 CTGGAGTTCTGGGTGGGCGTGGG - Intergenic
1190413995 X:50163641-50163663 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1191053932 X:56222863-56222885 CTAGAATTCCGGGTGGGCGTGGG - Intergenic
1191618663 X:63192881-63192903 CTGGAGTTCCGGATGGGCGTGGG - Intergenic
1192186738 X:68952210-68952232 CTGGAGTTCCAGGTGGACGTGGG + Intergenic
1192778095 X:74266010-74266032 CTGTAGTCCCAGGCTGACGTAGG - Intergenic
1192869687 X:75173909-75173931 CTGGAGTTCCGGGTAGGCGTGGG - Intergenic
1192870593 X:75179829-75179851 CTGGAGTTCCGGGTAGGTGTGGG - Intergenic
1193021959 X:76801064-76801086 CTGGAGTTCCAGGTTGGACTTGG + Intergenic
1193076931 X:77364559-77364581 CTGTAGTTCCAGGAAGGAATGGG - Intergenic
1193271038 X:79530623-79530645 CTAGAGTTCCGGGTGAGCGTGGG + Intergenic
1193538187 X:82738515-82738537 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1193708988 X:84856914-84856936 CGGTAGTTCCAGGTGGGTGTGGG - Intergenic
1193719962 X:84974943-84974965 GGCAAGTTCCAGGTGGGCGTGGG + Intergenic
1193804074 X:85972669-85972691 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
1194025610 X:88746637-88746659 CACGAGTTCCGGGTGGGCGTGGG - Intergenic
1194071624 X:89331341-89331363 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1194118058 X:89926846-89926868 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1194121231 X:89965957-89965979 CTGGAGTTCCGGGTAGGCGTGGG - Intergenic
1194650852 X:96512563-96512585 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1195222219 X:102756220-102756242 CAGTAGTTGCAGGTGGGAATGGG - Intergenic
1195256292 X:103094163-103094185 CTGGAGTTCTGGGTGGGCGTGGG + Intergenic
1195258058 X:103107661-103107683 CTGGAGTTCCAGGTGGGCGTGGG - Intergenic
1195259382 X:103117370-103117392 CTGGAGTTCTGGGTGGGCGTGGG - Intergenic
1195896394 X:109749630-109749652 CTGGAGTTCCAGGTGGGCGTGGG - Intergenic
1195909624 X:109876160-109876182 CGCGAGTTCCAGGTGGGCGTGGG - Intergenic
1196319562 X:114270871-114270893 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1196582665 X:117394730-117394752 CTGGAGTTCCGAGTGGGCGTGGG + Intergenic
1196705945 X:118717251-118717273 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1196707627 X:118729232-118729254 CTGTTGTTTCAGGTGTGTGTGGG - Intronic
1196714584 X:118799005-118799027 CTGGAGTTCCGGGTGGGCATGGG + Intergenic
1196728962 X:118922296-118922318 CTGGAGTTCTGGGTGGGCGTGGG - Intergenic
1196741491 X:119029563-119029585 CTGGAGTTCCCGGTGGGCGTGGG + Intergenic
1196762006 X:119208784-119208806 CTGGAGTTCCCCGTGGGCGTGGG - Intergenic
1196762373 X:119211191-119211213 CTGGAGTTCCCCGTGGGCGTGGG - Intergenic
1196775176 X:119331923-119331945 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1196775477 X:119333644-119333666 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1196781492 X:119387896-119387918 CTGGAGTTCCAGGTGGGCGTGGG - Intergenic
1196794010 X:119488175-119488197 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1196827306 X:119751140-119751162 CTGGAGTTCTGGGTGGGCGTGGG - Intergenic
1196845029 X:119890640-119890662 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1196860889 X:120026097-120026119 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
1197000317 X:121431840-121431862 CTGGAGTTTCGGGTGGGCGTGGG - Intergenic
1197340022 X:125255696-125255718 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1197376830 X:125690891-125690913 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1197533799 X:127663281-127663303 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
1197607897 X:128606654-128606676 CGAGAGTTCCGGGTGGGCGTGGG + Intergenic
1198060890 X:133044426-133044448 CTAGAGTTCCGGGTGGGCATGGG + Intronic
1198256107 X:134925692-134925714 GCTGAGTTCCAGGTGGGCGTGGG + Intergenic
1198664339 X:139004337-139004359 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
1198872326 X:141188810-141188832 CGCAAGTTGCAGGTGGGCGTGGG - Intergenic
1198972621 X:142298557-142298579 CTGGAGTTCCGGGTGGACGTGGG - Intergenic
1199009970 X:142746035-142746057 CTGGAGTTCCGGGTGGGCATGGG - Intergenic
1199028826 X:142972448-142972470 CTGGAGTTACGGGTGGGCGTGGG - Intergenic
1199050256 X:143229002-143229024 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1199134191 X:144231521-144231543 CGCGAGTTCCGGGTGGGCGTGGG - Intergenic
1199175512 X:144783682-144783704 CTGGAGTTCCAGGTGGGCGTGGG + Intergenic
1199356277 X:146867193-146867215 CTGGAGTTCCAGGTGGGCGTGGG - Intergenic
1199831313 X:151551499-151551521 CTGGAGTTCCGGGTGGGCATGGG - Intergenic
1199954561 X:152733588-152733610 CTGTAGATCCTGGTGGGGTTGGG - Intronic
1200470937 Y:3584415-3584437 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1200474088 Y:3623408-3623430 CTGGAGTTCCCGGTAGGCGTGGG - Intergenic
1200725865 Y:6667070-6667092 CTGGAGTTCCGGGTGGGTGGGGG - Intergenic
1200740308 Y:6846852-6846874 CTGTAGTTCCAGGTGTCACTGGG + Intergenic
1200824326 Y:7622528-7622550 CTGGGGTTCCGGGTGGGCGTGGG - Intergenic
1200888652 Y:8298666-8298688 CTGGAGTTCTGGGTGGGCGTGGG + Intergenic
1201423072 Y:13820516-13820538 CTGGAGTTCCGGGTGGGTGTGGG - Intergenic
1201468318 Y:14309336-14309358 CATGAGTTCCAGGTGGGCGTGGG + Intergenic
1201479906 Y:14428139-14428161 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1201487044 Y:14505700-14505722 CTGAAGTTTCCGGTGGGCGTGGG + Intergenic
1201488133 Y:14512863-14512885 CTGGAATTCCAGGTGAGCGTGGG + Intergenic
1201495717 Y:14590095-14590117 CTGGAGTTCCGGGTGGGCGTGGG - Intronic
1201496961 Y:14598508-14598530 CTGGAGTTCTGGGTGGGCGTGGG - Intronic
1201573005 Y:15433893-15433915 CTGGAGTTCTGGGTGGGTGTGGG + Intergenic
1201715776 Y:17043156-17043178 CTGGAGTTCCGGGTGGGCGTGGG + Intergenic
1201885760 Y:18880224-18880246 CAGGAGTTCTGGGTGGGCGTGGG + Intergenic
1201982648 Y:19924027-19924049 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1202109813 Y:21407250-21407272 CTGGAGTTCCAGGTGGGCGTGGG + Intergenic
1202137125 Y:21676974-21676996 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1202235729 Y:22708559-22708581 CTGGGGTTCCGGGTGGGCGTGGG + Intergenic
1202272684 Y:23086074-23086096 CTTGAGTTCCGGGTGGGTGTGGG - Intergenic
1202293342 Y:23334608-23334630 CTTGAGTTCCGGGTGGGTGTGGG + Intergenic
1202307434 Y:23487609-23487631 CTGGAGTTCCGGGTGGGCGTGGG - Intergenic
1202425681 Y:24719818-24719840 CTTGAGTTCCGGGTGGGTGTGGG - Intergenic
1202445108 Y:24950267-24950289 CTTGAGTTCCGGGTGGGTGTGGG + Intergenic
1202563371 Y:26182977-26182999 CTGGGGTTCCGGGTGGGCGTGGG + Intergenic