ID: 1008270515

View in Genome Browser
Species Human (GRCh38)
Location 6:49483728-49483750
Sequence GCTGTAGTTCCAGGTGGGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1714
Summary {0: 1, 1: 56, 2: 522, 3: 455, 4: 680}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008270515_1008270520 -5 Left 1008270515 6:49483728-49483750 CCACGCCCACCTGGAACTACAGC 0: 1
1: 56
2: 522
3: 455
4: 680
Right 1008270520 6:49483746-49483768 ACAGCTGACCTGCAAGCACCGGG No data
1008270515_1008270522 6 Left 1008270515 6:49483728-49483750 CCACGCCCACCTGGAACTACAGC 0: 1
1: 56
2: 522
3: 455
4: 680
Right 1008270522 6:49483757-49483779 GCAAGCACCGGGCGCAGCCCCGG 0: 2
1: 63
2: 258
3: 487
4: 608
1008270515_1008270519 -6 Left 1008270515 6:49483728-49483750 CCACGCCCACCTGGAACTACAGC 0: 1
1: 56
2: 522
3: 455
4: 680
Right 1008270519 6:49483745-49483767 TACAGCTGACCTGCAAGCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008270515 Original CRISPR GCTGTAGTTCCAGGTGGGCG TGG (reversed) Intronic
900113298 1:1018624-1018646 GCTGGAGTTCCGAGTGGGCGTGG - Intergenic
901045999 1:6396042-6396064 GGGCGAGTTCCAGGTGGGCGTGG - Intergenic
901601500 1:10426672-10426694 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
901783318 1:11608805-11608827 GCTGGAGTTCCGGGTGGGCATGG + Intergenic
902100451 1:13983475-13983497 GCTAGAGTTCCAGGTGGTCGTGG - Intergenic
902963981 1:19984764-19984786 GCGCAAGTTCCGGGTGGGCGTGG - Intergenic
903339974 1:22647669-22647691 GCTGAGGTTGCAGGTGGGCGAGG + Exonic
903624582 1:24721572-24721594 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
903676493 1:25067834-25067856 GCTGTAACTCCAGGCGGGCTCGG - Intergenic
905264678 1:36743480-36743502 GCTGTAGGGCCAGATGGGAGAGG + Intergenic
905375606 1:37518299-37518321 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
905544612 1:38787623-38787645 AGTGTAATTCCAGCTGGGCGCGG + Intergenic
905742867 1:40387900-40387922 GCTGGAGTTCCGGGTGGGCATGG + Intronic
905761170 1:40559184-40559206 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
905886186 1:41493397-41493419 GCTGTGGGCCCAGGTGGGCCTGG + Intergenic
906083236 1:43107822-43107844 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
906563535 1:46778818-46778840 GCTGGAGTTCCGGGTGGGCATGG - Intronic
906722916 1:48022399-48022421 GCTGCAGTTTGAGGTGGTCGTGG + Intergenic
906876123 1:49541381-49541403 GCATGAGTTCCAGGTGGGCATGG + Intronic
907102255 1:51847679-51847701 GCTAGAGTTCCAGGTGGGCGTGG - Intronic
907371168 1:54004536-54004558 GCGCAAGTTCCGGGTGGGCGTGG - Intergenic
908027779 1:59969977-59969999 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
908291311 1:62669937-62669959 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
908888565 1:68817768-68817790 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
909318570 1:74253659-74253681 GCTAGAGTTCTGGGTGGGCGTGG - Intronic
909377098 1:74952360-74952382 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
909904590 1:81178924-81178946 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
910034790 1:82777094-82777116 GCTGGAGTTCCAGGTGGGCGTGG - Intergenic
910250618 1:85194868-85194890 TCTGTAGTACCGGCTGGGCGCGG + Intronic
910550258 1:88467104-88467126 GCTAGAGTTCCGGATGGGCGTGG + Intergenic
910685731 1:89914271-89914293 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
910693157 1:89984930-89984952 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
911001433 1:93170316-93170338 GCTCGAGTTCCGGGTGGGCGTGG + Intronic
911259625 1:95669940-95669962 GCTGGAGTTCCGGGTGGGTGTGG - Intergenic
911402673 1:97395917-97395939 GGTCAAGTTCCAGGTGGGCTAGG - Intronic
911954516 1:104217757-104217779 GCTGGAGTTCCGGGTGGGCATGG - Intergenic
912166126 1:107044803-107044825 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
912312903 1:108641173-108641195 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
912538783 1:110396650-110396672 GCTAGAGTTCCGGGTGGGTGTGG - Intergenic
913161088 1:116146868-116146890 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
913468986 1:119171595-119171617 GCGTGAGTTCCAGGTGGGCATGG + Intergenic
913692137 1:121289417-121289439 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
913987081 1:143575141-143575163 GCTGGAGTTCCGGGTGGGCATGG + Intergenic
913996399 1:143654492-143654514 CCTGAAGCTCCAGGAGGGCGAGG - Intergenic
914145418 1:144990697-144990719 GCTGGAGTTCCGGGTGGGCTTGG + Intronic
914203454 1:145506165-145506187 GCCGGAGTTCAGGGTGGGCGTGG - Intergenic
914438465 1:147681079-147681101 GCTGGAGTTCTGGGTGGGCGTGG - Intergenic
914482576 1:148079319-148079341 GCCGGAGTTCAGGGTGGGCGTGG - Intergenic
914799652 1:150951200-150951222 GCAGGAGTTCCAGGTGAGGGAGG - Intronic
914928037 1:151906184-151906206 GCTGGAGTTCCAGGTGGGTGTGG + Intronic
915104103 1:153521834-153521856 GCTGGAGTTCCGGGTGGGTGTGG + Intergenic
915242341 1:154532386-154532408 GCTAGAGTTCTGGGTGGGCGTGG - Intronic
915260027 1:154670798-154670820 TCTGGAGTTCCGGGTGGGCGTGG + Intergenic
915261197 1:154678085-154678107 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
915666132 1:157446593-157446615 GCTGGATTTCCGGGTGGGCGTGG - Intergenic
915764511 1:158349301-158349323 GCTGGAGTGCAGGGTGGGCGTGG - Intergenic
915767178 1:158374439-158374461 GCTGGGGTTCGGGGTGGGCGTGG - Intergenic
915865580 1:159494921-159494943 GCTGGAGTTCCGAGTGGGCGTGG - Intergenic
916606067 1:166343344-166343366 GCCCGAGTTGCAGGTGGGCGTGG - Intergenic
916910135 1:169337390-169337412 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
916960258 1:169882159-169882181 GCTGGAGTTCTGGGTGGGCGTGG + Intronic
916991646 1:170251050-170251072 GTGCAAGTTCCAGGTGGGCGTGG - Intergenic
917406242 1:174711150-174711172 GCGTGAGTTCCGGGTGGGCGTGG - Intronic
917406315 1:174711445-174711467 GAACGAGTTCCAGGTGGGCGCGG + Intronic
917445431 1:175102613-175102635 GCTGGAGTTCTAGGTGGGCATGG - Intronic
917446386 1:175108770-175108792 GCTGGAGTTCTAGGTGGGCATGG - Intronic
917578574 1:176349583-176349605 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
917860493 1:179138888-179138910 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
917933025 1:179837243-179837265 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
918058978 1:181045882-181045904 GCTGGAGTTCCAAGTGGGCGTGG + Intronic
918659782 1:187074129-187074151 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
918708918 1:187703668-187703690 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
918720809 1:187850249-187850271 GCCAGAGTTCCGGGTGGGCGTGG + Intergenic
918732318 1:188013596-188013618 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
918789948 1:188813135-188813157 GCTAGAGTTCCGGGTGGGCGTGG + Intergenic
918792065 1:188841487-188841509 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
918853236 1:189718610-189718632 GCTGGAGTTCCGGGTGGACGTGG - Intergenic
918951987 1:191151473-191151495 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
918993870 1:191731862-191731884 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
919049812 1:192499373-192499395 GCGTGAGTTCCGGGTGGGCGTGG - Intergenic
919091877 1:192986958-192986980 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
919167977 1:193919225-193919247 GCTGGAGTTCCGGGTGGCCGTGG - Intergenic
919174445 1:194001889-194001911 GCTGGAGTTCCCGGTGGGCGTGG + Intergenic
919201376 1:194358582-194358604 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
919237015 1:194859114-194859136 GTTGGAGTTCCGGGTGGGCGTGG + Intergenic
920150203 1:203900284-203900306 GCTAGAGTTCCGGGTGGGCGTGG + Intergenic
920326274 1:205167274-205167296 CCTGTAGTCCCAGGTGTGCAGGG + Intronic
920479461 1:206307765-206307787 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
920731392 1:208488751-208488773 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
920756655 1:208739726-208739748 GCTGGAGTTCTGGGTGGGCGTGG + Intergenic
920878483 1:209858963-209858985 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
920883173 1:209899113-209899135 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
921094453 1:211874605-211874627 GCTAGAGTTCCAGATGGGTGTGG - Intergenic
921096264 1:211889596-211889618 GCGCGAGTTCCAGGTGGGCGTGG + Intergenic
921396412 1:214673459-214673481 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
921801781 1:219410699-219410721 GCTGGAGTTCCTGGTGGGCGTGG + Intergenic
921897071 1:220412479-220412501 GCTGGAGTTCTGGGTGGGTGTGG + Intergenic
921903872 1:220476007-220476029 GCTGGAGTTCTGGGTGGGCGTGG - Intergenic
921983702 1:221285971-221285993 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
922056805 1:222049794-222049816 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
922417052 1:225431413-225431435 GTGCAAGTTCCAGGTGGGCGTGG + Intergenic
922423186 1:225472754-225472776 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
922485401 1:225969817-225969839 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
922546831 1:226464245-226464267 GTGCGAGTTCCAGGTGGGCGTGG + Intergenic
922748475 1:228060053-228060075 GCTGTGGCTCTGGGTGGGCGTGG + Exonic
922855768 1:228773753-228773775 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
923157258 1:231289788-231289810 GCTGGAGTTCTGGGTGGGCGTGG - Intergenic
923324834 1:232871757-232871779 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
923353157 1:233129171-233129193 GCTAGAGTTCCGGATGGGCGTGG + Intronic
923474856 1:234322847-234322869 GATTTTGTTCCAGGTGGGCTGGG - Intronic
923573785 1:235140332-235140354 GCTGGAGTTCCAGGTGGGCGTGG + Intronic
923930102 1:238684943-238684965 GCTGGAGTTCCAGGTGGGCATGG - Intergenic
924117496 1:240762538-240762560 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
924219261 1:241855890-241855912 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
1063077592 10:2732369-2732391 GCTGGACTTACAGGTGGGCACGG - Intergenic
1063148980 10:3320140-3320162 GCTCGAGTTCTGGGTGGGCGTGG - Intergenic
1063318757 10:5032830-5032852 GCTGGAGTTCCCGGTGGGCAGGG - Intronic
1063322196 10:5060954-5060976 GCGTGAGTTCCAGGTGGGCATGG - Intronic
1063769671 10:9183397-9183419 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1063848683 10:10160944-10160966 GTGTGAGTTCCAGGTGGGCGCGG + Intergenic
1064197764 10:13259653-13259675 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1064449236 10:15426388-15426410 GCACGAGTTCCGGGTGGGCGTGG - Intergenic
1064790381 10:18951590-18951612 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1065441311 10:25756046-25756068 GCTGGAGTTCCAGGTGGGCGTGG + Intergenic
1065554877 10:26905593-26905615 GCGCGAGTTCCAGGTGGGTGTGG + Intergenic
1065590294 10:27256527-27256549 GCGTGAGTTCCGGGTGGGCGTGG + Intergenic
1065743305 10:28815986-28816008 GCTGGAGTTCCGGGTGAGCGTGG - Intergenic
1065752191 10:28897089-28897111 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
1065981593 10:30903111-30903133 GCTAGAGTTCCGGGTGGGCGTGG - Intronic
1065995479 10:31055871-31055893 GCTAGAGTTCTGGGTGGGCGTGG + Intergenic
1066186278 10:33013339-33013361 GGTGGAGTTCCGGGTGGGCGTGG + Intergenic
1066190235 10:33049273-33049295 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1066234019 10:33468081-33468103 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1066544267 10:36482309-36482331 GCTGGAGTTCCAGGTGGGCGTGG - Intergenic
1066567426 10:36734932-36734954 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1066597065 10:37062515-37062537 GCGGGAGTTCCAGGTGGGCGTGG + Intergenic
1066598189 10:37076055-37076077 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
1066648481 10:37634520-37634542 GCGTGAGTTCCAGGTGGGCGCGG + Intergenic
1067146181 10:43695464-43695486 GGTGCAGGTCCGGGTGGGCGAGG + Intergenic
1067363165 10:45600791-45600813 GCTGGAGTTCCCGGTGGGAGTGG + Intergenic
1068216646 10:53990859-53990881 GCACGAGTTCCAGGTGGGTGTGG + Intronic
1068373996 10:56155170-56155192 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1068455516 10:57249887-57249909 GCTGGAGTTCTGGGTGGGCATGG + Intergenic
1068460349 10:57321568-57321590 GCGCAAGTTCCAGGTGGGCGTGG + Intergenic
1068669333 10:59708835-59708857 GCTGAGGGTCCAGGTGGGCGCGG + Intronic
1068863144 10:61867692-61867714 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1068902089 10:62280425-62280447 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1068978112 10:63033636-63033658 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1069186548 10:65429729-65429751 GCTGGAGTTCTGGGTGGGCGTGG - Intergenic
1069988651 10:72300656-72300678 GCGCGAGTTCCCGGTGGGCGTGG + Intergenic
1069992945 10:72326003-72326025 GCTAGAGTTCCGGGTGGGCGTGG + Intergenic
1070121452 10:73581213-73581235 CCTGGAGTTCGAGGTGAGCGTGG + Intronic
1070914598 10:80144789-80144811 GCAGTAGTTCCTGGGGGCCGGGG + Intronic
1070942582 10:80359802-80359824 GCGCAAGTTCCGGGTGGGCGCGG - Intronic
1070973361 10:80585925-80585947 GCTGGATTTCTGGGTGGGCGTGG + Intronic
1071003731 10:80859283-80859305 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1071037505 10:81265227-81265249 GCTGGAGTTCTGGGTGGGTGTGG - Intergenic
1071085381 10:81863000-81863022 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1071387978 10:85141447-85141469 GCTGGAGTTCCAGGTGGGCATGG + Intergenic
1071797086 10:89018888-89018910 GCATGAGTTCCAGGTGGGCGTGG - Intergenic
1071963804 10:90832488-90832510 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
1072278474 10:93845240-93845262 GCTCTAGTTCCAGGTGGGCGTGG + Intergenic
1073577526 10:104639067-104639089 GCCGCAGGCCCAGGTGGGCGCGG - Intergenic
1073789794 10:106928406-106928428 GCTGGAGTTCCGGGTGGGCGCGG - Intronic
1074098106 10:110331506-110331528 GCACGAGTTCCGGGTGGGCGTGG + Intergenic
1074316987 10:112369835-112369857 GCGAGAGTTCCGGGTGGGCGTGG + Intergenic
1074963798 10:118471263-118471285 CCTGTAGTTCAAGATGGGAGCGG + Intergenic
1074999207 10:118782950-118782972 GCTGGAGTTCCAGGTGGGCGTGG + Intergenic
1075255594 10:120923872-120923894 GCTGAAGTTCCGGGTGGGCGTGG + Intergenic
1075269403 10:121035652-121035674 GCTGGAGTTCCGGGTGCGCGTGG - Intergenic
1075305695 10:121365625-121365647 GCCCGAGTTCCAGGTGGGCGTGG + Intergenic
1075376047 10:121978692-121978714 GCTAGAGTTCCCTGTGGGCGTGG - Intergenic
1075505030 10:123013816-123013838 GCTAGAGTTCCGGGTGGGCGTGG - Intronic
1075537554 10:123283667-123283689 GCTAGAGTTCCAGGTGGGCGTGG - Intergenic
1076261684 10:129071665-129071687 GCTGGAGTTCCGGGTGGACGTGG - Intergenic
1076273530 10:129177033-129177055 GCAGTAGTTTCAGGTGAGCCTGG + Intergenic
1076773589 10:132680709-132680731 GCTGGATTTCCGGGTGGGCGTGG + Intronic
1076796558 10:132801249-132801271 GCTGGATTTCCGGGTGGGCGTGG - Intergenic
1076892944 10:133293701-133293723 GCTGTACGTGCTGGTGGGCGTGG - Exonic
1077015890 11:399036-399058 GCTGCACTTCCTGGTTGGCGTGG - Exonic
1077110637 11:860584-860606 GCTGGTGTTGCAGGTGGGGGTGG + Intronic
1077201730 11:1310856-1310878 GCTGTAGTTCCCGGAGGACGAGG - Intergenic
1077603223 11:3588775-3588797 GCTGGAGTTCTGGGTGGGCGTGG + Intergenic
1077764567 11:5144462-5144484 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
1077805737 11:5589927-5589949 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
1077815592 11:5682995-5683017 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
1078251921 11:9623350-9623372 GCTGGAGTTCCGGGTGTGCGTGG - Intergenic
1078301224 11:10133617-10133639 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
1078387365 11:10904171-10904193 CCTGTAGTTCCAGCTAGTCGGGG - Intergenic
1078743717 11:14091640-14091662 GCTGGAGTTCTGGGTGGGCGTGG - Intronic
1078795797 11:14591110-14591132 GCTGGAGTTCCAGGTGGGCATGG + Intronic
1078891308 11:15560971-15560993 GCTAGAGTTCCAGATGGGCCTGG + Intergenic
1079191002 11:18276405-18276427 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
1079555439 11:21753411-21753433 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1079708696 11:23653462-23653484 GCACGAGTTCCAGGTGGGCGTGG - Intergenic
1079726243 11:23883744-23883766 GCTGGAGTTCTGGGTGGGCGTGG - Intergenic
1079730588 11:23935037-23935059 GCTGGAGTTCTGGGTGGGCGTGG - Intergenic
1079731779 11:23942590-23942612 GCTGGAGTTCTGGGTGGGCGTGG - Intergenic
1079767806 11:24416332-24416354 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1080106045 11:28512644-28512666 GCTGGAGTTCTGGGTGGGCATGG - Intergenic
1080107518 11:28526096-28526118 GCTGGAGCTCCAGATGGGCATGG - Intergenic
1080195221 11:29600459-29600481 GCTGGCGTTCCGGGTGGGCGTGG - Intergenic
1080557717 11:33432056-33432078 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1080621421 11:33990147-33990169 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1080649090 11:34208882-34208904 GCTGCAGGTCCAGGGGGGCAGGG - Intronic
1081125037 11:39311876-39311898 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1081126962 11:39333380-39333402 GCTGGAGTTCTAGGTGGGCGTGG - Intergenic
1081324488 11:41728396-41728418 GCTAGAGTTCCGGGTGGGTGTGG - Intergenic
1081329735 11:41788539-41788561 GCTGGGGCTCCAGGTGGGCGTGG - Intergenic
1081420872 11:42873966-42873988 GCTGGAGTTGCGGGTGGGCGTGG + Intergenic
1081422045 11:42881431-42881453 GGTGGAGTTCTGGGTGGGCGTGG + Intergenic
1081428356 11:42949924-42949946 GCTGGAGTTCCGGGTGGGCATGG + Intergenic
1081655789 11:44856545-44856567 TCTGTAGTTCCAGGTGGCTAAGG - Intronic
1082272092 11:50183320-50183342 GCTGGAGTTCCGGGTGGGCATGG + Intergenic
1083207264 11:61160295-61160317 TCTGTAGTTCCGGGTGGGATCGG - Intronic
1083546087 11:63550253-63550275 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1083895242 11:65616473-65616495 GCTGGAGTTACAGGTGGCCGTGG - Intronic
1083905738 11:65668867-65668889 CCTGTAATTCTAGCTGGGCGCGG - Intergenic
1083953050 11:65967371-65967393 ACTTTGGTTCCAGGTGGGCTTGG + Exonic
1084024768 11:66441046-66441068 GCGCAAGTTCCGGGTGGGCGTGG - Intronic
1084107384 11:66988842-66988864 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1084186628 11:67476140-67476162 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
1084210434 11:67619084-67619106 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1084259119 11:67963317-67963339 GCTGGAGTTCTGGGTGGGGGTGG + Intergenic
1084386249 11:68844185-68844207 GCTGCAGTTGCAGGCCGGCGCGG - Intronic
1084406102 11:68974553-68974575 GCTGGAGTTCCAGGTGCGAGTGG - Intergenic
1084607331 11:70180096-70180118 GCTGAACTGCCAGGTGGCCGGGG + Intronic
1084813650 11:71631861-71631883 GCTGGAGTTCTGGGTGGGCGTGG - Intergenic
1085053354 11:73390862-73390884 GCTGGAGGCCCAGGTGGGCATGG + Exonic
1085245577 11:75098254-75098276 GCTGGAGTTCTGGGTGGGCGTGG + Intergenic
1085375859 11:76060613-76060635 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
1085447270 11:76609342-76609364 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1085863101 11:80257610-80257632 GCGTGAGTTCCGGGTGGGCGTGG + Intergenic
1085941101 11:81207643-81207665 GCTAGAGTTCCGGGTGGGCGTGG + Intergenic
1086001111 11:81986988-81987010 GCGCGAGTTCCAGGTGGGTGCGG - Intergenic
1086001633 11:81991190-81991212 GCGTGAGTTCCAGGTGGGCACGG - Intergenic
1086034883 11:82403948-82403970 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
1086043008 11:82501207-82501229 GCTGGAGTTCTGGGTGGGCGTGG + Intergenic
1086087538 11:82970721-82970743 GCTAGAGTTCCGGGTGGGCGTGG + Intergenic
1086397772 11:86433834-86433856 GCTGGAGTTCCGGGTGGGCATGG - Intergenic
1086724625 11:90167237-90167259 GCGAGAGTTCCGGGTGGGCGTGG + Intronic
1086807989 11:91268804-91268826 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1087354515 11:97076648-97076670 GCTGGATTTCCGGGTGGGCGTGG + Intergenic
1088570851 11:111222026-111222048 TCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1089062144 11:115634206-115634228 TCTGGAGTTCCGGGTGGGCTTGG - Intergenic
1089373598 11:117978800-117978822 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1089466429 11:118689286-118689308 GGTGGAGTTCCGGGTTGGCGTGG - Intergenic
1089666837 11:120025946-120025968 GCTAGAGTTCCGGGTGGGCGTGG + Intergenic
1089800214 11:121021707-121021729 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1090133576 11:124170996-124171018 GCGTGAGTTCCGGGTGGGCGTGG - Intergenic
1090229197 11:125089545-125089567 GCTGGAGTTCCGGGTGGGCATGG + Intronic
1090307709 11:125705015-125705037 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1090586212 11:128215583-128215605 GGGCGAGTTCCAGGTGGGCGTGG - Intergenic
1090588237 11:128237138-128237160 GCGTGAGTTCCGGGTGGGCGTGG + Intergenic
1090776748 11:129972133-129972155 GCTGGAGTTCTGGGTGGGCGTGG - Intronic
1090782702 11:130021720-130021742 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
1091046592 11:132330952-132330974 ACCTTAGGTCCAGGTGGGCGTGG - Intronic
1091233477 11:134003175-134003197 GCTGGAGTTCCGGGGGGGCGTGG - Intergenic
1091402268 12:188387-188409 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
1092135177 12:6142244-6142266 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1092137405 12:6159524-6159546 GCTGGAGTTCAGGGTGGGCGTGG + Intergenic
1092142131 12:6191183-6191205 GCTGGAGTTCCAGGTGGGCGTGG - Intergenic
1092220272 12:6708357-6708379 GCTGGAGTTCCGGGTGGCCGTGG + Intergenic
1092221375 12:6716084-6716106 GCTGGAGTTCCGGGTGGGTGTGG + Intergenic
1092272902 12:7037473-7037495 GCTGGAGTTCCAGGTGGGCGTGG + Intronic
1092336651 12:7639888-7639910 GCTGGAGTTCCGGGGGGGCGTGG + Intergenic
1092350547 12:7752386-7752408 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1092471745 12:8787314-8787336 GCTGGAGTTCCGGGCGGGCGTGG + Intergenic
1092472938 12:8794771-8794793 GCTGGAGTTCCGGGCGGGCGTGG + Intergenic
1092545880 12:9450697-9450719 GCGCGAGTTCCCGGTGGGCGTGG - Intergenic
1092572447 12:9739889-9739911 GCTGGAGTTCCGGGTAGGCGTGG - Intergenic
1092617180 12:10225945-10225967 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1092732448 12:11547340-11547362 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
1092834227 12:12472700-12472722 GTGCGAGTTCCAGGTGGGCGTGG - Intergenic
1093034467 12:14320143-14320165 GCTGGAGTTCCGGCTGGGCGTGG + Intergenic
1093189375 12:16057430-16057452 GCTGGAGTTCCGGGTGGGCGGGG + Intergenic
1093266249 12:17007672-17007694 GCTGGACTTCCGGGTGGGCGTGG + Intergenic
1093346247 12:18040302-18040324 GCATGAGTTCCGGGTGGGCGTGG + Intergenic
1093381541 12:18500194-18500216 GCTGGAGTTCCAGGTGGGCGTGG + Intronic
1093527115 12:20115542-20115564 GCTGGAGTTCTGGGTGGGCGTGG - Intergenic
1093581040 12:20784093-20784115 GCTGGAGTTCCAGGTAGTCATGG - Intergenic
1093583296 12:20807743-20807765 GCGCCAGTTCCCGGTGGGCGTGG - Intergenic
1093652525 12:21661577-21661599 GCTAGAGTTCCGGGTGGGAGTGG + Intronic
1093715490 12:22376952-22376974 GCTAGAGTTCCGGGTGGGCGTGG + Intronic
1093793698 12:23285993-23286015 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
1093921641 12:24866124-24866146 GCTGGAGTTCCGGGTGGGAGTGG + Intronic
1093970186 12:25369414-25369436 GCTGGAGTTCCGGGTTGGCGTGG + Intergenic
1093972933 12:25391476-25391498 GCTGGAGTTCCGGGTGGCCGTGG + Intergenic
1094327538 12:29256691-29256713 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
1094338637 12:29386553-29386575 GCTGGAGTTCCCGGTGGGCATGG - Intergenic
1094405377 12:30110761-30110783 GCGGGAGTTCCGGGTGGGCAGGG - Intergenic
1094409810 12:30156919-30156941 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1094448693 12:30561681-30561703 GCTGGAGTTCCGGGTGGGCCTGG + Intergenic
1094507076 12:31071376-31071398 GCGCGAGTTCCCGGTGGGCGTGG + Intergenic
1094589327 12:31806101-31806123 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1094652437 12:32391012-32391034 GCGCGAGTTCCAGGTGAGCGCGG - Intergenic
1094661256 12:32472339-32472361 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
1094666462 12:32525721-32525743 GCTGGAGTTCCAGGTGGGCGTGG + Intronic
1094718220 12:33034244-33034266 GCTGGAGTTCCAGGTGGGTGTGG - Intergenic
1095123073 12:38442000-38442022 GCTGGAGTTCTGGGTGGGCATGG + Intergenic
1095444983 12:42274015-42274037 GCTGGAGTTCCGGGTGGGTGTGG - Intronic
1095533953 12:43224370-43224392 GCGTGAGTTCCGGGTGGGCGTGG + Intergenic
1095587388 12:43863947-43863969 GCTAGAGTTCCGGGTGGGCATGG + Intronic
1095776681 12:46018066-46018088 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1095901518 12:47333432-47333454 GCTGGAGTTCCGGGTGGGCATGG + Intergenic
1097017951 12:56000456-56000478 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
1097128966 12:56796152-56796174 GCTGAAGTTCTGGGTGGGCGTGG - Intergenic
1097664213 12:62461546-62461568 GCTGGAATTCCGGGTGGGCATGG - Intergenic
1097863745 12:64542970-64542992 GATAGAGTTCCGGGTGGGCGTGG + Intergenic
1097907267 12:64932815-64932837 TCTGTCCTTCCAGGTGGGAGAGG + Intergenic
1097981992 12:65744407-65744429 GCACGAGTTCCGGGTGGGCGTGG + Intergenic
1098168245 12:67719544-67719566 GCTGGAGTTCCGGGTGGGCGGGG - Intergenic
1098515968 12:71376905-71376927 GCTGGAGTTCCGGGTGTGCGTGG + Intronic
1098588646 12:72185088-72185110 GCTGGAGTTCTGGGTGGGCGTGG + Intronic
1098759216 12:74402994-74403016 GCTGGAGTTCCGGCTGGGCGTGG + Intergenic
1099204330 12:79710985-79711007 CCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1099228188 12:79993537-79993559 GCTAGAGTTCCGGGTGGGCGTGG - Intergenic
1099443815 12:82728819-82728841 GCGCGAGTTCCAGGTGGGCATGG + Intronic
1099478647 12:83140167-83140189 GCCTGAGTTCCGGGTGGGCGTGG + Intergenic
1099523956 12:83696599-83696621 GCTGGAGTTCCAGATGGGCGTGG - Intergenic
1099559641 12:84155434-84155456 GCTGGAGTTGCAGGTGGGCGTGG - Intergenic
1099790689 12:87330263-87330285 GCTGGAGTTCGGGGTGGGCGTGG + Intergenic
1100142315 12:91633992-91634014 GCTAGAGTTCCGGGTTGGCGTGG + Intergenic
1100166639 12:91924202-91924224 GCTGGAGTTCCAGGTGGGCATGG - Intergenic
1100211911 12:92406831-92406853 CCTGGAGTTCCAGGTGGGCGTGG - Intergenic
1100496793 12:95132841-95132863 GCTGTAGTTTCAAATGGGAGGGG - Intronic
1100521438 12:95379656-95379678 GCTGGAGTTCCAGGTGGGCGTGG + Intronic
1100584674 12:95969182-95969204 CCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1100600620 12:96108952-96108974 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
1100734643 12:97513050-97513072 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
1101008963 12:100430349-100430371 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1101021598 12:100559429-100559451 GCTGGAATTCCGGGTGGGCGTGG + Intronic
1101461988 12:104905825-104905847 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
1101603823 12:106233069-106233091 GCTAGAGTTCCGGGTGGGCATGG + Intergenic
1102309732 12:111835702-111835724 GCTGGAGTTCCAGGTGGGCGTGG + Intergenic
1102387260 12:112520202-112520224 GCGCGAGTTCCTGGTGGGCGTGG - Intergenic
1102904000 12:116660773-116660795 GCGCGAGTTCCGGGTGGGCGCGG + Intergenic
1103146174 12:118597488-118597510 GCTAGAGTTCCAGGTGGGTGTGG - Intergenic
1103212416 12:119176504-119176526 TCTGTAATTACAGCTGGGCGGGG - Intergenic
1103439259 12:120950653-120950675 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1103459686 12:121093820-121093842 GTGCGAGTTCCAGGTGGGCGTGG - Intergenic
1103668517 12:122592072-122592094 GCTGGAGTTCCGGGTGGATGTGG + Intronic
1103678734 12:122676910-122676932 GCGCGAGTTCCAGGTGGGCGTGG - Intergenic
1103780996 12:123398837-123398859 GCTGTGGATCCAGGAGGGTGGGG + Intronic
1103783421 12:123414426-123414448 GCTGGAGTTCCGGGTGGGCGTGG - Exonic
1103853264 12:123946995-123947017 GCTGGAGTTCTGGGTGGGCGTGG + Intronic
1104344467 12:127983429-127983451 GCGAGAGTTCCGGGTGGGCGTGG + Intergenic
1104373852 12:128247291-128247313 GCGTGAGTTCCAGGTGGGCACGG + Intergenic
1104582614 12:130022102-130022124 GCTGGAGTTCCGGGTGGGGGTGG + Intergenic
1104614544 12:130256967-130256989 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1104749212 12:131227859-131227881 GCTGGAGTTCCGGGTGAGGGTGG + Intergenic
1105037726 12:132938801-132938823 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
1105365281 13:19758540-19758562 GAAGTATTTCCAGCTGGGCGTGG + Intronic
1105425616 13:20292464-20292486 GCTGGAGTTCCGGGTGAGTGTGG + Intergenic
1105477413 13:20740241-20740263 GCACGAGTTCCAGGTGGGTGCGG - Intronic
1105605181 13:21920969-21920991 GCTAGAGTTCCGGGTGGGAGTGG - Intergenic
1105701565 13:22938950-22938972 GCATGAGTTCCTGGTGGGCGCGG - Intergenic
1105722153 13:23127619-23127641 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1105763123 13:23531581-23531603 GCACGAGTTCCGGGTGGGCGTGG + Intergenic
1105876711 13:24561018-24561040 GCTGGAGTTCTGGGTGGGCGTGG - Intergenic
1106161497 13:27204942-27204964 GCTGTGCTTCCAGATGGGGGTGG + Intergenic
1106221353 13:27748627-27748649 GCTGGAGTTCCGGGTGGGCATGG - Intergenic
1106322945 13:28659207-28659229 GCTGGAGTTCCACGCGGGCTCGG + Intronic
1106617091 13:31339979-31340001 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1106643454 13:31609139-31609161 GCTGGAGTTCCGGGTGGGTGTGG - Intergenic
1106810923 13:33358028-33358050 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1107259406 13:38472743-38472765 GCTGGAGCTCCGGGTGGGCGAGG - Intergenic
1107590491 13:41898891-41898913 CTTGGAGTTCCGGGTGGGCGTGG - Intronic
1107836087 13:44413623-44413645 GCGTGAGTTCCGGGTGGGCGTGG + Intergenic
1108099204 13:46936367-46936389 GCTGGAGTTCTGGGTGGGCATGG - Intergenic
1108435314 13:50396642-50396664 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
1108686707 13:52826309-52826331 GCTCGAGTTCCGGGTGGGCCTGG + Intergenic
1108751556 13:53452705-53452727 GCTGGAGTTCCGGGTGGGCATGG - Intergenic
1108845641 13:54676618-54676640 GCGCGAGTTCCAGGTGGGCATGG + Intergenic
1108851639 13:54737589-54737611 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1108858983 13:54829813-54829835 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1108958216 13:56187568-56187590 GCGCGGGTTCCAGGTGGGCGTGG + Intergenic
1109124725 13:58504539-58504561 GCTGGAGTTCTGGGTGGGCATGG - Intergenic
1109141021 13:58714131-58714153 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1109159898 13:58958495-58958517 GCTGGAGTTCTGGGTGGGCGTGG - Intergenic
1109441340 13:62379274-62379296 GCTGGAGTTCCAGGTGGGCGTGG + Intergenic
1109506129 13:63305795-63305817 GCTGGAGTTCTGGGTGGGCGTGG + Intergenic
1109649500 13:65308126-65308148 GCTGTTGTTTCAGGTGAGGGTGG + Intergenic
1109745792 13:66621996-66622018 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
1109854326 13:68108029-68108051 GCGCAAGTTCCAGGTGGGCGTGG - Intergenic
1110024094 13:70512218-70512240 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1110368839 13:74718439-74718461 GCTGGAGTTCTGGGTGGCCGTGG + Intergenic
1110609838 13:77475767-77475789 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
1110751420 13:79119933-79119955 GCGGGAGTTCCAGGTGGGTGTGG - Intergenic
1110792422 13:79600471-79600493 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1110854226 13:80278932-80278954 GCACGAGTTCCGGGTGGGCGTGG - Intergenic
1110862107 13:80355594-80355616 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1110940324 13:81341083-81341105 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1110999868 13:82165263-82165285 GCTGGAATTCCGGGTGGGTGTGG - Intergenic
1111103274 13:83613708-83613730 GCATGGGTTCCAGGTGGGCGTGG - Intergenic
1111138807 13:84086689-84086711 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
1111441880 13:88291867-88291889 GCTGGAGTTCCGGGTGGGCATGG + Intergenic
1111590998 13:90348648-90348670 GCTGCAGTTCCGGGTGGGCGTGG + Intergenic
1111602706 13:90494867-90494889 GCTGGAGTTCCGGGTAGGCATGG + Intergenic
1111748300 13:92296713-92296735 GCTGGAGTTCCGTGTGGGCGTGG + Intronic
1111841440 13:93455098-93455120 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
1112077781 13:95931749-95931771 GCGCGAGTTCCGGGTGGGCGTGG - Intronic
1112226473 13:97545324-97545346 GCTGGAGTTCCCAGTCGGCGTGG + Intergenic
1112518617 13:100077563-100077585 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1112533195 13:100224362-100224384 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
1112538249 13:100282494-100282516 GCTGGAGTTCCAGGTGGGCGTGG + Intronic
1112613069 13:100975744-100975766 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1112705828 13:102068522-102068544 GCTGGAGTTCCGGGTGGGCATGG + Intronic
1112842676 13:103600029-103600051 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
1113371979 13:109732967-109732989 GCTAGAGTTCCGGGTGGGCGTGG - Intergenic
1113482711 13:110633342-110633364 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
1113506613 13:110821207-110821229 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1113514584 13:110883688-110883710 GCTGTTGTAACAGGTGGGAGTGG - Exonic
1113538160 13:111084185-111084207 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1113678030 13:112221764-112221786 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1114560335 14:23585195-23585217 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1114593508 14:23891804-23891826 GCTGGAGTTCCGGGTAGGCGTGG + Intergenic
1115118257 14:29909044-29909066 GCATGAGTTCCGGGTGGGCGTGG + Intronic
1115421377 14:33199052-33199074 GCGCAAGTTCCAGGTGGGCGTGG - Intronic
1116114522 14:40629951-40629973 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1116251057 14:42482702-42482724 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1116390502 14:44384790-44384812 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1116426497 14:44798637-44798659 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
1116452333 14:45080484-45080506 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1116594357 14:46820482-46820504 ACTAGAGTTCCGGGTGGGCGTGG + Intergenic
1116623989 14:47242491-47242513 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
1116653751 14:47626605-47626627 GCGCGAGTTCCGGGTGGGCGTGG + Intronic
1116656936 14:47665579-47665601 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
1117077842 14:52122291-52122313 GCTGGAGTTCCAGGTGGGCGTGG + Intergenic
1117082570 14:52166794-52166816 GCGTGAGGTCCAGGTGGGCGTGG + Intergenic
1117297547 14:54393502-54393524 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1117302483 14:54443099-54443121 GCTGGAGTTCCGGGTTGGCGTGG + Intergenic
1117449792 14:55839556-55839578 GCGCGAGTTCCAGGTGGGCGTGG + Intergenic
1117571951 14:57056928-57056950 GCTGGAGTTCCCGGTGGGCGTGG - Intergenic
1117727361 14:58687566-58687588 GCATGAGTTCCAGGTGGGCGTGG - Intergenic
1117742601 14:58833967-58833989 GCGCCAGTTCCGGGTGGGCGTGG + Intergenic
1118215394 14:63803576-63803598 GCTGGAGTTCCGGGCGGGCATGG - Intergenic
1118306308 14:64658226-64658248 GCGCGAGTTCCTGGTGGGCGTGG + Intergenic
1119027759 14:71167587-71167609 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
1119300346 14:73566646-73566668 GCTGGAGTTCCAGGTGGGCATGG - Intergenic
1119486753 14:74994196-74994218 GCTGGAGTTCCGGGTGGGCATGG + Intergenic
1119673476 14:76537063-76537085 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1119741169 14:77014526-77014548 GCTGCAGTTCCAGGAGGTCTGGG - Intergenic
1120209895 14:81624078-81624100 GCTAGAGTTCCGGGTGGGCGTGG - Intergenic
1120330955 14:83092432-83092454 GCTGGAGTTCCAGGTAGGCGTGG + Intergenic
1120429778 14:84399677-84399699 GCTCGAGTTCCGGGTGAGCGTGG - Intergenic
1120439137 14:84513221-84513243 GCTGGAGTTCTGGGTGGGTGTGG - Intergenic
1120632333 14:86905743-86905765 GCTAGAGTTCCGGGTGGGCGTGG - Intergenic
1120844136 14:89111695-89111717 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1121350677 14:93170396-93170418 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1122216556 14:100208471-100208493 GATAGAGTTCCGGGTGGGCGTGG - Intergenic
1122434957 14:101689129-101689151 GCACGAGTTCCAGGTGGGCGGGG + Intergenic
1122493484 14:102135823-102135845 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
1122894844 14:104751798-104751820 GCGTGAGTTCCGGGTGGGCGTGG - Intergenic
1123799114 15:23802961-23802983 GCTGGAGTTCCGGGTGGGCATGG + Intergenic
1123949158 15:25253506-25253528 GCTGGAGTTCCGGGTGGGTGTGG - Intergenic
1124036347 15:26056960-26056982 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
1124114885 15:26831492-26831514 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
1124198603 15:27656716-27656738 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
1124380370 15:29160189-29160211 GCAGGAGTTCCAAGTGGGCGTGG - Intronic
1124573101 15:30883804-30883826 GCTGGAGTTCCGGGTGGGCATGG + Intergenic
1125112188 15:36047002-36047024 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1125357447 15:38831294-38831316 GGTGTAGTGCCAGCTGGGCTGGG - Intergenic
1125480318 15:40075086-40075108 GCTGGAGTTCCAGGTGGGCGTGG - Intergenic
1125565778 15:40677240-40677262 GCTGGAGTTCCGGGTGGGCGAGG - Intergenic
1125609676 15:40961665-40961687 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1125885569 15:43226861-43226883 GCTAGAGTTCCCGGTGGGCGTGG - Intergenic
1125914579 15:43474191-43474213 GCTGGAGTTCCTGGTGGGTGTGG - Intronic
1126088965 15:45034882-45034904 GCTGGAGTTCCGGGTAGGCGTGG + Intronic
1126128049 15:45314140-45314162 GCTGGAGTTCCGGGTGGGCATGG + Intergenic
1127766091 15:62186874-62186896 GCTAGAGTTCCCAGTGGGCGTGG - Intergenic
1127916415 15:63459114-63459136 GCGGGTGTTCCGGGTGGGCGTGG + Intergenic
1128110820 15:65075072-65075094 GCTGGAGTTCCAGGTGGGCGTGG + Intronic
1128141081 15:65301386-65301408 GCTAGAGTTCCGGGTGGGCGTGG - Intergenic
1128594117 15:68929199-68929221 GCCCGAGTTCCGGGTGGGCGTGG - Intronic
1128598598 15:68975982-68976004 GCTGGAGTTCTGGGTGGGCATGG - Intronic
1128670002 15:69567669-69567691 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1128791693 15:70439056-70439078 GCTGCTATTCCAGGCGGGCGAGG + Intergenic
1128813336 15:70587487-70587509 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1129196911 15:73973796-73973818 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
1129264049 15:74384513-74384535 GCTGAAGCTCCAGGAGGGCAGGG + Intergenic
1129280420 15:74480657-74480679 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1129374028 15:75116259-75116281 GCGCGAGTTCCGGGTGGGCGTGG - Intronic
1129586873 15:76876125-76876147 GCTAGAGTTCCTGATGGGCGTGG - Intronic
1129724414 15:77894285-77894307 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
1129777525 15:78246450-78246472 GCTGTAGTTCCGGGTGGGCGTGG - Intergenic
1129833980 15:78690406-78690428 GCTGTAGCTCCAGGTGAGAGAGG + Intronic
1129859141 15:78846921-78846943 GCTGGAGTTCCAGATGGGCGTGG + Intronic
1130132835 15:81158670-81158692 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1131212670 15:90511007-90511029 GCGTGAGTTCCGGGTGGGCGTGG + Intergenic
1131472849 15:92711330-92711352 GCGCGAGTTCCGGGTGGGCGTGG - Intronic
1131507763 15:93031875-93031897 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1131846147 15:96492150-96492172 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1132510991 16:341311-341333 GCTGGAGTCCCGGGTGGGCGTGG + Intronic
1132734797 16:1379923-1379945 GCTGCAGGTGCAGGTGGGCAGGG - Intronic
1133814290 16:9184474-9184496 GCGCAAGTTCCAGGTGGGCGTGG - Intergenic
1134093636 16:11404711-11404733 GCTGAGGTTCCTGGTGGGCTTGG + Exonic
1134231838 16:12435848-12435870 GGTGTAGTCCCAGCTGGGCAGGG + Intronic
1135262150 16:20989953-20989975 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
1135280823 16:21152645-21152667 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
1135299417 16:21313093-21313115 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1135470229 16:22723254-22723276 GCGCGAGTTCCAGGTAGGCGTGG - Intergenic
1135751095 16:25059223-25059245 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1135942713 16:26836367-26836389 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
1136163271 16:28435417-28435439 GCTGGAGGTCCGAGTGGGCGTGG + Intergenic
1136199695 16:28679570-28679592 GCTGGAGGTCCGAGTGGGCGTGG - Intergenic
1136216042 16:28793743-28793765 GCTGGAGGTCCGAGTGGGCGTGG - Intergenic
1136356620 16:29748405-29748427 GCATGAGTTCCGGGTGGGCGTGG + Intergenic
1137442489 16:48508754-48508776 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1137555848 16:49469978-49470000 GCATTGGTTCCAGGTGGGCGTGG + Intergenic
1138688749 16:58748898-58748920 GCTAGAGTTCCAGGTGGGCGTGG + Intergenic
1138693629 16:58791098-58791120 GCTGGAGTTCCAGGTAGGCATGG - Intergenic
1139018995 16:62724915-62724937 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
1139051457 16:63129682-63129704 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
1139147707 16:64343943-64343965 GCTGGAGTTCCGGGTAGGCGTGG + Intergenic
1139475777 16:67201920-67201942 GCTGTTGTTCCAGGCGGCCGTGG + Intronic
1139600278 16:67982324-67982346 GCTCGAGTTCCGGGTGGGCGTGG + Intergenic
1139603023 16:67998263-67998285 GCTGGAGTTTCGGGTGGGCGTGG + Intronic
1140722549 16:77784690-77784712 GCTGGAGTTCCTGGTGGGCGTGG - Intergenic
1140789860 16:78381082-78381104 GCTGTAGTTCCAGGGCAGCCTGG + Intronic
1141465763 16:84204894-84204916 GCTGGAGTTCCGGGTAGGCGTGG - Intergenic
1141468719 16:84223959-84223981 TCAGCAGTTCCAGCTGGGCGGGG + Intronic
1141665959 16:85465229-85465251 GCAGGAGCTCCAGGTGGGCGGGG - Intergenic
1142495902 17:306220-306242 GCTGGGGTTCCAGGGGGGCTGGG - Intronic
1142505644 17:361641-361663 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
1142828833 17:2532409-2532431 GCATGAGTTCCGGGTGGGCGTGG - Intergenic
1143008404 17:3852053-3852075 ACAGTCGATCCAGGTGGGCGTGG + Intergenic
1143128008 17:4656821-4656843 GCGTGAGTTCCGGGTGGGCGTGG - Intergenic
1143135284 17:4709353-4709375 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
1143664302 17:8347432-8347454 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1144128060 17:12220953-12220975 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
1144467130 17:15505745-15505767 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
1144723188 17:17486401-17486423 GCTGGAGTTCCGGCTGGGCGTGG + Intronic
1144862608 17:18315032-18315054 GTTGTAGTTCCAGGTCGCTGTGG - Intergenic
1145094817 17:20016514-20016536 GCGTGAGTTCCCGGTGGGCGTGG + Intronic
1145978190 17:28996391-28996413 GCTGGAGTGCTGGGTGGGCGGGG - Intronic
1146740494 17:35279226-35279248 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1147373597 17:40010981-40011003 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1147431796 17:40375876-40375898 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1147805320 17:43126888-43126910 GCGCGAGTTCCAGGTGGGCGCGG + Intergenic
1147997506 17:44368871-44368893 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1148016842 17:44528013-44528035 GCTGGATGTCCGGGTGGGCGTGG + Intergenic
1148366205 17:47057595-47057617 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1148936062 17:51165669-51165691 ACTTTAGTGCCAGGTGGGCAGGG + Intronic
1149099282 17:52884271-52884293 GCACGAGTTCCAGGTGGGTGTGG - Intronic
1149753952 17:59172572-59172594 GCTTGAGTTCTGGGTGGGCGTGG + Intronic
1149916363 17:60613662-60613684 GCGCGAGTTCCAGGTGGGCATGG + Intronic
1150219009 17:63485317-63485339 GTTGTAGTTCCAGTTGGCCTCGG - Exonic
1150220875 17:63495325-63495347 GCTGGAGTTCCAGGTGCCCCCGG + Intronic
1150772255 17:68051921-68051943 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1150775800 17:68080705-68080727 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
1150778252 17:68099331-68099353 GCTGGAGTTCCGGGTGGGCCAGG + Intergenic
1150788239 17:68179896-68179918 GCTAGAGTTCCAGGTGGGCGTGG + Intergenic
1150804634 17:68309222-68309244 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
1151567490 17:74907354-74907376 GCGCGAGTTCCAGGTGGGCGTGG - Intergenic
1151701016 17:75742595-75742617 GGTGGAGTTCCAGGAGGGCGTGG + Exonic
1151782703 17:76257961-76257983 GCTGGAGTTCTGGGTGGGCGTGG - Intergenic
1152095432 17:78269295-78269317 GCTGTAGCTGAAGGTGGGAGGGG - Intergenic
1152619077 17:81352354-81352376 GCTGGAGTTCCGCGTGGGCTTGG - Intergenic
1153644083 18:7178978-7179000 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1153832490 18:8935735-8935757 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1154057268 18:11023958-11023980 GCTGGAGTTACGGGTGGGCGTGG - Intronic
1154255343 18:12777166-12777188 GCTAGAGTTCCGGGTGGGCATGG - Intergenic
1154942975 18:21132768-21132790 GCTAGAGTTCCGGATGGGCGTGG - Intergenic
1155003293 18:21706566-21706588 GCGGGAGTTCCGGGTGGGTGTGG + Intronic
1155208078 18:23577943-23577965 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
1155271983 18:24149866-24149888 GCTGGAGTTCCGAGTGGGCATGG - Intronic
1155295062 18:24376898-24376920 GCTGGAGTTCCGTGTGGGCGTGG - Intronic
1155611736 18:27674175-27674197 GCTGGAGTTCCGGGTGGGCGAGG - Intergenic
1155620111 18:27768699-27768721 CCTGTAGTTCCAGGAGGCTGAGG - Intergenic
1155772848 18:29723565-29723587 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1155852257 18:30788492-30788514 GCTGGAGTTCCGGTTGGGCATGG + Intergenic
1155856403 18:30839470-30839492 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1155976758 18:32139913-32139935 GCGTGAGTTCCGGGTGGGCGTGG + Intronic
1156038642 18:32794623-32794645 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1156150320 18:34234006-34234028 GCGCCAGTTCCAGGTGGGCGTGG + Intergenic
1156243070 18:35271959-35271981 GCGCGAGTTCCGGGTGGGCGCGG - Intronic
1156428709 18:37046838-37046860 AAGGTAGTTCCAGCTGGGCGCGG + Intronic
1156610514 18:38718696-38718718 GCGCAAGTTCCGGGTGGGCGTGG - Intergenic
1156683546 18:39618504-39618526 GCACAAGTTCCAGGTGGGTGTGG + Intergenic
1156863631 18:41865805-41865827 GCTGGAGTTCCAGGTGGGCATGG + Intergenic
1156943148 18:42795296-42795318 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
1156969648 18:43139570-43139592 GCTAGAGTTCCGGGTGGGCATGG + Intergenic
1157085943 18:44580781-44580803 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1157541596 18:48514802-48514824 GCTGTAGTTCTAGGTGTGGCAGG + Intergenic
1157979826 18:52367216-52367238 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
1158266413 18:55664939-55664961 GCTAGAGTTCCGGGTGGGCGTGG + Intergenic
1158282327 18:55841007-55841029 GCGCAAGTTTCAGGTGGGCGTGG - Intergenic
1158351891 18:56572338-56572360 GCTGGAGTTCCGGGTAGGCGTGG + Intergenic
1158553857 18:58459439-58459461 GCTAGAGTTCCAGGTGGGCATGG + Intergenic
1158597358 18:58827993-58828015 GCATGAGTTCCGGGTGGGCGTGG - Intergenic
1158697288 18:59714404-59714426 GCTGGAGTTCCGGGTGGGCATGG - Intergenic
1158705780 18:59790763-59790785 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1159230770 18:65605302-65605324 GCTGGAGTTCCGGGTGGGCGGGG + Intergenic
1159322198 18:66866748-66866770 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
1159472976 18:68880307-68880329 GCTGGAGTTCCGGGTGGGCATGG - Intronic
1159656132 18:71031651-71031673 GCTGGAGTTCCAGGTGGGGGTGG - Intergenic
1159743932 18:72209173-72209195 GCTAGAGTTCCGGATGGGCGTGG + Intergenic
1160176649 18:76600442-76600464 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1160198526 18:76777293-76777315 GCTGGACTTCTGGGTGGGCGTGG + Intergenic
1160704760 19:524734-524756 GCTGGGGGTCCAGGTGGGCGAGG - Intergenic
1160704781 19:524789-524811 GCTGGGGGTCCAGGTGGGCGAGG - Intergenic
1160704802 19:524846-524868 GCTGGGGGTCCAGGTGGGAGAGG - Intergenic
1160704823 19:524901-524923 GCTGGGGGTCCAGGTGGGCGAGG - Intergenic
1160704844 19:524956-524978 GCTGGGGGTCCAGGTGGGAGAGG - Intergenic
1160704865 19:525011-525033 GCTGGGGGTCCAGGTGGGAGAGG - Intergenic
1160704886 19:525066-525088 GCTGGGGGTCCAGGTGGGAGAGG - Intergenic
1160704907 19:525123-525145 GCTGGGGGTCCAGGTGGGAGAGG - Intergenic
1160992389 19:1865010-1865032 GCTGGGGTTGCAGGTGGGCGGGG - Intergenic
1161384321 19:3982914-3982936 GCTGCAGCTCCAGCAGGGCGCGG + Exonic
1161392346 19:4028134-4028156 GCTGCAGTTCCCTGTGGGTGTGG - Exonic
1161795728 19:6385626-6385648 GCTGTTGTTCCAGGGGAGCAGGG + Intronic
1162091114 19:8280663-8280685 GCGCGAGTTCCGGGTGGGCGTGG - Intronic
1162093348 19:8295501-8295523 GCGCGAGTTCCGGGTGGGCGTGG - Intronic
1162106972 19:8375808-8375830 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
1162230118 19:9259562-9259584 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1162233140 19:9283766-9283788 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1162237622 19:9321446-9321468 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1162262074 19:9541636-9541658 GCTGGAGTTCCAGGTGGGCGTGG - Intergenic
1162632727 19:11941607-11941629 GCTGGAGTTCTGGGTGGGCGTGG - Intronic
1162814757 19:13187021-13187043 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1162987079 19:14277674-14277696 GCGTGAGTTCCAGGTGGGTGTGG + Intergenic
1163114659 19:15181566-15181588 ACTGCAGCCCCAGGTGGGCGGGG - Exonic
1163181749 19:15608957-15608979 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1164144052 19:22499301-22499323 GCTGGAGTTCCGGGTCGGCGTGG - Intronic
1164270616 19:23668839-23668861 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
1164310433 19:24041362-24041384 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
1164581946 19:29440068-29440090 GCGTGAGTTCCAGGTGGGCTTGG + Intergenic
1164821638 19:31255581-31255603 GCTGTAGTGACAGGTGTCCGTGG - Intergenic
1164975767 19:32571636-32571658 GCTGGAGTTCTGGGTGGGCGTGG + Intergenic
1165036364 19:33036687-33036709 GCGCGAGTTCCAGGTGGGCGTGG + Intronic
1165266910 19:34668242-34668264 GCTGGAGTTCCCGGTGGGCGTGG + Intronic
1165353048 19:35287153-35287175 GCTGTGATTACAGGTGGGCCTGG + Intergenic
1166036250 19:40170453-40170475 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1166487038 19:43222244-43222266 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
1166649751 19:44563517-44563539 GCTGGAGTTCCGGATGGGCGTGG - Intergenic
1167001222 19:46746575-46746597 GGTGTAGACCCGGGTGGGCGAGG - Exonic
1168266954 19:55228516-55228538 GCTGGGGTCCCAGGTGGGGGTGG - Intronic
1168659858 19:58157351-58157373 GCTAGAGTTCCGGATGGGCGTGG + Intergenic
925537834 2:4935626-4935648 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
926444554 2:12926822-12926844 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
926616661 2:15002847-15002869 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
926685849 2:15697042-15697064 GCGCGAGTTCCAGGTGGGCGTGG - Intronic
926850643 2:17193602-17193624 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
927277219 2:21272344-21272366 GCTGTAGGGCCAGGTGGGTGAGG + Intergenic
927777781 2:25915549-25915571 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
927942212 2:27111779-27111801 GCGCGAGTTCCGGGTGGGCGTGG - Intronic
928100852 2:28436733-28436755 CCTGTGATTCCAGGAGGGCGAGG - Intergenic
928313766 2:30231219-30231241 GCTGGAGTTCGGGGTGTGCGTGG + Intergenic
928493059 2:31803767-31803789 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
928617968 2:33057739-33057761 GCTAGAGTTCCCGGTGAGCGTGG - Intronic
928701565 2:33903824-33903846 GCACGAGTTCCAGGTGGGCATGG - Intergenic
928753169 2:34494341-34494363 GCTGGAGTTCCGGGTGGGTGGGG + Intergenic
928880554 2:36092289-36092311 GCATGAGTTCCAGGTGGGAGTGG + Intergenic
928936868 2:36688309-36688331 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
929070029 2:38020560-38020582 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
929138045 2:38643373-38643395 GCGCGAGTTCCAGGTGGGCGCGG - Intergenic
929201831 2:39244323-39244345 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
929233687 2:39585414-39585436 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
929379659 2:41335638-41335660 GCTGGAGTTCCAGGTGGGCGTGG + Intergenic
929890901 2:45917986-45918008 GCTAGAGTTCCGGGTGGGCGTGG - Intronic
930037987 2:47099780-47099802 GCTGGAGTTCCGGGTGGGCATGG + Intronic
930039184 2:47107328-47107350 GCTGGAGTTCCGGGTGGGCATGG + Intronic
930468242 2:51780598-51780620 GCTGGAGTTCCGGATGGGCGTGG - Intergenic
930485479 2:52006847-52006869 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
931708666 2:64969052-64969074 GCTGGAGATACGGGTGGGCGTGG + Intergenic
931773487 2:65519575-65519597 GGTGAGGTTCCAGGTGGGTGAGG - Intergenic
932178258 2:69622131-69622153 GCGCCAGTTCCAGGTGGGCGTGG + Intronic
932239907 2:70148353-70148375 GCTGGAGTTCCCGGTGGGCGGGG + Intergenic
932249808 2:70232896-70232918 GCTGGTGTTCCAGGTAGGTGAGG + Intronic
932359546 2:71092799-71092821 GCTGGAGTTCCGGGTAGGCGTGG - Intergenic
932369167 2:71173412-71173434 GCTGTAGCTCCAGGTGAGAGAGG + Intergenic
932486447 2:72086929-72086951 GCTGGAGTTCCCGGTGGGCGTGG + Intergenic
932521749 2:72421876-72421898 GCTGGAGTTCCGGGTGGGCATGG + Intronic
932902022 2:75711623-75711645 GCTGGAGTTCCGGGTGGGCATGG + Intergenic
933060861 2:77735066-77735088 GCGCGAGTTCCCGGTGGGCGTGG - Intergenic
933442100 2:82326518-82326540 GCACGAGTTCCGGGTGGGCGTGG - Intergenic
933487285 2:82938757-82938779 GCTGGAGTTCTGGGTGGGCGTGG - Intergenic
933511491 2:83246238-83246260 GCGTGAGTTCCGGGTGGGCGTGG - Intergenic
934898466 2:98139051-98139073 GCTGGAGTTCCGGGTGGCTGTGG + Intronic
935385897 2:102500031-102500053 CCTGCAGTTCCAGGTGAGCATGG - Intronic
935790283 2:106584463-106584485 GCGCAAGTTCCAGGTGAGCGCGG + Intergenic
935896883 2:107747651-107747673 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
936038863 2:109133898-109133920 GCTGTAGTCTCTGGTGGGTGTGG + Intronic
936172724 2:110190505-110190527 GCGTGAGTTCCGGGTGGGCGTGG - Intronic
936346859 2:111681898-111681920 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
936942793 2:117903059-117903081 GGTGTCCTTCCAGGTGAGCGGGG + Intergenic
937209622 2:120260063-120260085 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
937711876 2:124987723-124987745 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
937789453 2:125943237-125943259 GCGTGAGTTCCAGGTGGGCACGG - Intergenic
938126106 2:128672437-128672459 GCTAGAGCTCCGGGTGGGCGTGG - Intergenic
938726057 2:134109661-134109683 GCTAGAGTTCTGGGTGGGCGTGG - Intergenic
938728750 2:134129986-134130008 GCGCAAGTTCCAGGTGGGCGTGG + Intronic
939003113 2:136758509-136758531 GCTCAAGTTCCGAGTGGGCGTGG + Intergenic
939053244 2:137331919-137331941 GCTGGAATTCCGGGTGGGCGTGG - Intronic
939229729 2:139410389-139410411 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
939281726 2:140073838-140073860 GCTGGAGTTCCAGGTGGGCGTGG + Intergenic
939465100 2:142546109-142546131 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
939509610 2:143089747-143089769 GCTGGAGTTCCAGGTGGGCATGG - Intergenic
939738808 2:145881221-145881243 GCTGGAGTTCAGGGTGGGCATGG - Intergenic
939777380 2:146404004-146404026 GCTGGAGTTCCGGGTGGGAGTGG - Intergenic
939869033 2:147506969-147506991 GCGCGAGTTCCAGGTGGGTGTGG + Intergenic
939898884 2:147826909-147826931 GCCAGAGTTCCGGGTGGGCGTGG + Intergenic
939972564 2:148678700-148678722 GCTGGAGTTCCAGGTGGGCGTGG - Intronic
940112672 2:150171339-150171361 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
940361962 2:152805133-152805155 GCGCAAGTTCCGGGTGGGCGTGG - Intergenic
940666735 2:156618370-156618392 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
940784625 2:157968183-157968205 GCGCGAGTTCCAGGTGGGCATGG - Intronic
940834918 2:158510676-158510698 GCTGGAGTTCCAGGAGGGCTGGG + Intronic
940905373 2:159164486-159164508 ACTATAGCTCCAGGTGGGTGGGG + Intronic
941178869 2:162234907-162234929 GCTAGAGTTCTGGGTGGGCGTGG + Intronic
941240055 2:163026323-163026345 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
941309222 2:163909570-163909592 GCTACAGTTCCGGGTGGGCGTGG + Intergenic
941309758 2:163913662-163913684 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
941397960 2:164995067-164995089 GCTGGAGTTCCTGGTGGGCGTGG - Intergenic
941476616 2:165957380-165957402 GCGCGAGTTCCAGGTGGGCGCGG - Intergenic
941705899 2:168657751-168657773 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
941712150 2:168725210-168725232 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
941820764 2:169841581-169841603 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
942317623 2:174709880-174709902 GCTGGAGTTCTGGGCGGGCGTGG - Intergenic
942867259 2:180691435-180691457 GCTGGAGTTCCAGGTGGGCGTGG + Intergenic
943024202 2:182608508-182608530 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
943106179 2:183546958-183546980 GCACGAGTTCCGGGTGGGCGTGG - Intergenic
943494783 2:188606706-188606728 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
943680378 2:190761276-190761298 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
943835133 2:192508016-192508038 GCTGGAGTTCCAGGTGGGCATGG + Intergenic
943906142 2:193502721-193502743 GCACCAGTTCCGGGTGGGCGTGG - Intergenic
943942697 2:194020209-194020231 GCGCAAGTTCCAGGTGGGCGTGG + Intergenic
944055170 2:195515727-195515749 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
944228404 2:197370620-197370642 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
944482779 2:200174832-200174854 GCGCCAGTTCCGGGTGGGCGTGG + Intergenic
944728570 2:202496958-202496980 GCTGGAGTTCCGGGTGGGCATGG + Intronic
944843160 2:203643140-203643162 GCGCGAGTTCCAGGTGGGTGTGG - Intergenic
944857960 2:203785886-203785908 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
945401372 2:209387427-209387449 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
945451510 2:210000884-210000906 GCGCGAGTTCGAGGTGGGCGTGG - Intergenic
945575505 2:211524688-211524710 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
945664247 2:212721379-212721401 GCTCGAGTTCCGGGTGGGCACGG - Intergenic
945745754 2:213718539-213718561 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
945869124 2:215207921-215207943 GCGTGAATTCCAGGTGGGCGCGG + Intergenic
945870191 2:215219106-215219128 GCTAGAGTTCCGGGTGGGTGTGG + Intergenic
945872854 2:215246041-215246063 GCTGGAGTTCCGGGTGGGCATGG - Intergenic
945907917 2:215615198-215615220 GCGCAAGTTCCGGGTGGGCGTGG - Intergenic
946358111 2:219201740-219201762 GCTGGAGTTCCAGGTGGGCGTGG - Intronic
946923595 2:224604014-224604036 GCTGGAGTTCCGAGTGGGTGTGG - Intergenic
946982197 2:225229761-225229783 GCTGGAGTTCCGGGAGGGTGTGG - Intergenic
947026599 2:225744177-225744199 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
947411965 2:229850766-229850788 GCTGGAGTTCCGGGTGGGTGTGG + Intronic
947720394 2:232366388-232366410 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
947932087 2:233972780-233972802 GATGGAGTTCCGGGTGGGCGTGG - Intronic
947938046 2:234024594-234024616 ACTAGAGTTCCGGGTGGGCGTGG - Intergenic
948449143 2:238058170-238058192 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
1169645370 20:7803828-7803850 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
1169814482 20:9641901-9641923 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
1169849168 20:10031729-10031751 GCTGGAGTTCTGGGTGGGCGTGG + Intronic
1170230894 20:14045095-14045117 GCCGAAGTTCCAGGTGGGCGTGG - Intronic
1170246441 20:14226556-14226578 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
1170649476 20:18226813-18226835 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1170732120 20:18984773-18984795 GCTGGAGTTCCAGATGGCAGCGG + Intergenic
1170806877 20:19639946-19639968 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
1170989855 20:21291919-21291941 TCTGGAGTTCCCGGTGAGCGTGG + Intergenic
1171318879 20:24221033-24221055 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1172431886 20:34899115-34899137 GCTGGAGTTCCGAGTGGGCGTGG - Intronic
1172771376 20:37384428-37384450 GCCGTGGCCCCAGGTGGGCGAGG - Intronic
1173195553 20:40910782-40910804 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1173195658 20:40911231-40911253 GCTGGAGTTCCGCGTGGGCGTGG + Intergenic
1173601568 20:44299181-44299203 GCTGGAGTTCCGGGAGGGCGTGG + Intergenic
1173831482 20:46091899-46091921 GCTAGAGTTCCAGGTGGGCGTGG + Intergenic
1174162906 20:48564375-48564397 GCGTGAGTTCCGGGTGGGCGTGG - Intergenic
1174562929 20:51444270-51444292 GCTATAATGTCAGGTGGGCGTGG - Intronic
1174611248 20:51800675-51800697 CCTTTTGTTCCAGGTGGGCCAGG + Intronic
1175066352 20:56291830-56291852 TCTGTAGTTCCAGGAGGCTGAGG - Intergenic
1175210038 20:57348444-57348466 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1175254124 20:57628842-57628864 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1175399602 20:58692915-58692937 GCTGCAGTTCCAGGCGAGCGCGG + Exonic
1175564801 20:59964925-59964947 GGTGTATTTCCAGGTGGCCAAGG - Intronic
1176189359 20:63800611-63800633 GCTAGAGTTCCGGGTGGGTGTGG + Intronic
1176344852 21:5733785-5733807 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
1176351666 21:5854369-5854391 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
1176499975 21:7590670-7590692 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
1176539173 21:8131855-8131877 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
1176558124 21:8314900-8314922 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
1176663199 21:9660083-9660105 GCGCGAGTTCCAGGTGGGCGTGG + Intergenic
1176966645 21:15218888-15218910 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1177496903 21:21902465-21902487 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1177565856 21:22819152-22819174 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1177637590 21:23807065-23807087 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1177669674 21:24208983-24209005 GCGCGAGTTCCGGGTGGGCGCGG - Intergenic
1177795883 21:25778415-25778437 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
1178074155 21:29000224-29000246 GCGTGAGTTCCGGGTGGGCGTGG + Intergenic
1178082236 21:29077430-29077452 GCGTGAGTTCCGGGTGGGCGTGG - Intergenic
1178326971 21:31654242-31654264 GCTGGAGCTCCAGGTGTGCGTGG + Intergenic
1178398715 21:32265379-32265401 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1178585670 21:33868629-33868651 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
1178983378 21:37283498-37283520 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1179032192 21:37730322-37730344 GCTATAGTGCCTGGTGGGCCTGG + Intronic
1180069477 21:45429189-45429211 GCTGTAGTCTCGGCTGGGCGCGG - Intronic
1180233534 21:46442564-46442586 GCTGGAGTCCCACCTGGGCGAGG - Exonic
1180741074 22:18053669-18053691 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1181077688 22:20392669-20392691 GCACGAGTTCCGGGTGGGCGTGG - Intergenic
1182658333 22:31907065-31907087 GCAGTTGTGCCAGGTGGCCGGGG + Intergenic
1183422153 22:37718152-37718174 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
1183462965 22:37963809-37963831 GATGTAGTCCCAGCCGGGCGCGG + Intronic
1183633857 22:39049227-39049249 GCTGTGGTTCCAGCTGGGAGAGG + Intronic
1183685186 22:39357585-39357607 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
1183980195 22:41534952-41534974 GGTGTTGTTCCTGGTGGGAGGGG + Intronic
1183990335 22:41593574-41593596 GCTAGAGTTCTGGGTGGGCGTGG + Intergenic
1184177663 22:42798281-42798303 GCTGCAGTTCAAGGAGGGCGTGG - Intronic
1184231929 22:43162995-43163017 GCTGCAGTCCCTGGTGGGCCGGG - Exonic
1184584231 22:45436776-45436798 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1184605973 22:45575120-45575142 GCTGCTGTGCCAGGTGGGTGTGG - Intronic
1184906277 22:47488619-47488641 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1185229154 22:49670512-49670534 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
1203244121 22_KI270733v1_random:48210-48232 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
949258950 3:2083680-2083702 GCTGGAGTTCGTGGTGGGCGTGG + Intergenic
949292729 3:2484958-2484980 GCGCGAGTTCCAGGTGGCCGTGG + Intronic
949528746 3:4932622-4932644 GCTGTAGTCCCAGCTGCTCGGGG + Intergenic
950068963 3:10136679-10136701 GCACAAGTTCCGGGTGGGCGTGG - Intergenic
950203574 3:11061430-11061452 GCGTGAGTTCCAGGTGGGCGTGG + Intergenic
950207868 3:11094093-11094115 GCTAGAGTTCCGGGTGGGCGTGG + Intergenic
950256680 3:11511908-11511930 GCTGGAGTTCTGGGTGGGTGTGG - Intronic
950256989 3:11513555-11513577 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
950401037 3:12769172-12769194 GCTACAGTTCCGGGTGGGCTTGG - Intronic
950418534 3:12882939-12882961 GCTAGAGTTCCGGGTGGGCGTGG + Intergenic
950513392 3:13447509-13447531 GCTGGAGTTCCGGGTGGGTGTGG - Intergenic
950632616 3:14293255-14293277 GCACGAGTTCCGGGTGGGCGTGG + Intergenic
951146606 3:19234552-19234574 GCGGGAGTTCCGCGTGGGCGAGG - Intronic
951184948 3:19702619-19702641 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
951551904 3:23882847-23882869 GCGAGAGTTCCGGGTGGGCGTGG - Intronic
951734775 3:25851813-25851835 GCGCGAGTTCCAGGTGGGCGTGG + Intergenic
951951116 3:28200725-28200747 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
952011300 3:28903478-28903500 GCGCGAGTTCCAGGTGGGTGTGG - Intergenic
952058120 3:29473814-29473836 GCTGGACTTCCAGGTGGGCGTGG - Intronic
952275219 3:31870169-31870191 GCTGGAGTTCCAGGTGGGCGTGG + Intronic
952355361 3:32578802-32578824 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
952360443 3:32625687-32625709 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
952393684 3:32902842-32902864 GCTGGAGTTCTGGGTGGGCGTGG + Intergenic
952398206 3:32939731-32939753 GCTGGAGTTCTGGGTGGGCGTGG + Intergenic
952593609 3:34988412-34988434 GCTGGAGTTCCAGGTGGGCGTGG + Intergenic
952713291 3:36453393-36453415 GCGTGAGTTCCGGGTGGGCGTGG + Intronic
952730612 3:36633955-36633977 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
952795219 3:37233052-37233074 GCCGGAGTTCCGGGTGGGCGTGG + Intergenic
953002863 3:38951200-38951222 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
953018761 3:39100704-39100726 GCTGCAGGGCCAGGTGGGTGGGG - Intronic
953089798 3:39713364-39713386 GCTGGAGTTCTGGGTGGGCGTGG + Intergenic
953124539 3:40078237-40078259 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
953307633 3:41844477-41844499 GCTGGAGTTCTGGGTGGGCATGG - Intronic
953522519 3:43656738-43656760 GCTGGAGTTCCAGGTGGGCGTGG - Intronic
953714578 3:45306717-45306739 GCTAGAGTTCTGGGTGGGCGTGG + Intergenic
954040980 3:47887254-47887276 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
954124221 3:48519203-48519225 GCTCTAGTTCCTGGTGGGTAAGG + Exonic
954230585 3:49213753-49213775 GCTCGAGTTCCAGGTGGGCATGG - Intronic
954620096 3:51990605-51990627 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
955183322 3:56691928-56691950 GCTGGAGTTCCGTGTGGGCGCGG + Intergenic
955186400 3:56718982-56719004 CCTGGAGTTCCGGGTGGGCGTGG + Intergenic
955210262 3:56934514-56934536 GCTGGAGTTCCGGGTGGGTGTGG + Intronic
955266485 3:57449658-57449680 GCTGGAGTTACAGGTGGGCGTGG - Intronic
955449459 3:59050906-59050928 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
956195721 3:66651619-66651641 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
956392213 3:68785578-68785600 GCGCGAGTTCCAGGTGGGTGTGG - Intronic
956438799 3:69260323-69260345 GCACGAGTTCCGGGTGGGCGTGG + Intronic
956481433 3:69677501-69677523 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
956563611 3:70611904-70611926 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
956855233 3:73269241-73269263 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
956986946 3:74712105-74712127 GCGGGAGTTCCGGGTGGGAGTGG + Intergenic
957002289 3:74900246-74900268 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
957009212 3:74985438-74985460 GCTGTAGTTCTGGGTGGGCGTGG - Intergenic
957074062 3:75587847-75587869 GCTGGAGTTCCAGGTGGGCATGG + Intergenic
957209455 3:77240396-77240418 GCGTGAGTTCCGGGTGGGCGTGG - Intronic
957270986 3:78029980-78030002 GCGGAGGTTCCAGGTGGGCGCGG + Intergenic
957277441 3:78108438-78108460 GATGGAGTTCCGGGTGGGCCTGG + Intergenic
957362053 3:79173386-79173408 GCGCGAGTTCCAGGTGGGTGTGG + Intronic
957371458 3:79300267-79300289 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
957386428 3:79502305-79502327 GCGCGAGTTCCGGGTGGGCGGGG + Intronic
957419697 3:79951683-79951705 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
957556325 3:81767699-81767721 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
957665211 3:83217923-83217945 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
957804934 3:85134173-85134195 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
957830046 3:85504988-85505010 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
957921790 3:86757641-86757663 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
957995073 3:87679145-87679167 GCTGAAGTTCCAGGTGGGCGTGG + Intergenic
958022607 3:88015738-88015760 GCTGGAGTTCCGGGTCGGCGTGG + Intergenic
958419848 3:93917636-93917658 GCTGGAGTTCCTGGTGGGCGTGG + Intronic
958549672 3:95595793-95595815 GCACGAGTTCCAGGTGGGTGTGG - Intergenic
959325348 3:104929865-104929887 CCTGTAGTTCCAGCTTGGTGGGG - Intergenic
959422713 3:106148675-106148697 GCTGGAGTTCCAGGTGGGCATGG + Intergenic
959991137 3:112633423-112633445 GCTTAAATTCCAAGTGGGCGAGG - Intronic
960227561 3:115185197-115185219 GCTGGAGTTCCGGGTGGGTGTGG - Intergenic
960282110 3:115791610-115791632 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
960487293 3:118269730-118269752 GCTAGAGTTCCCGGTGGGCGTGG + Intergenic
960685480 3:120289767-120289789 GCGCAAGTTCCAGGTGGGCGTGG + Intergenic
960761698 3:121078866-121078888 GCTGGAGTTCTGGGTGGGCATGG - Intronic
961280028 3:125758890-125758912 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
961460436 3:127046725-127046747 GCTGGAGTTCCGGGTGGGCATGG + Intergenic
961587039 3:127939227-127939249 GCTGCAGTTCCAAGAGGGTGTGG + Intronic
961688770 3:128653443-128653465 GCTGGAGTTCTGGGTGGGCCTGG + Intronic
961700822 3:128743234-128743256 GCGGGAGTTCCGGGTGGGTGTGG - Intronic
961746742 3:129068581-129068603 GCGCAAGTTCCGGGTGGGCGTGG - Intergenic
961874377 3:130010689-130010711 GCTGGAGTTCCGAGTGGGCGTGG + Intergenic
962283776 3:134070571-134070593 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
962383791 3:134916672-134916694 GCGCCAGTTCCGGGTGGGCGTGG - Intronic
962398777 3:135039741-135039763 GCTTGAGTTCCGGGTGGGCATGG - Intronic
962591100 3:136890312-136890334 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
962600532 3:136987899-136987921 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
962671715 3:137714811-137714833 GCTAGAGTTCCGGGTGGACGTGG - Intergenic
962711946 3:138094852-138094874 GCGGCAGCTCCAGGTGGGCAGGG - Exonic
962758225 3:138484697-138484719 GCTGGAGTTCTGGGTGGGTGTGG + Intergenic
963397183 3:144749860-144749882 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
963440383 3:145333442-145333464 GCTGGAGTTCTGGGTGGGCGTGG + Intergenic
963651852 3:147989692-147989714 GCTCGAGTTCCGGGTGGGTGTGG - Intergenic
963743028 3:149098162-149098184 GCGGGAGTTCCGGGTGGGCGTGG - Intergenic
963862141 3:150323016-150323038 GCTGGAGTTCCGGGTGGGGGTGG + Intergenic
964014345 3:151928203-151928225 TCTGGAGTTCCGGGTGGGCGTGG + Intergenic
964032296 3:152152464-152152486 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
964037515 3:152217351-152217373 ACTGGAGTTCCAGGTGGGTGTGG + Intergenic
964064039 3:152559484-152559506 GCACAAGTTCCAGGTGGGTGTGG + Intergenic
964117997 3:153156032-153156054 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
964139245 3:153378648-153378670 GCTGGCGTTCCGGGTGGGCGTGG - Intergenic
964375031 3:156041367-156041389 GCGCGAGTTCCGGGTGGGCGTGG + Intronic
964393807 3:156224237-156224259 GCACGAGTTCCGGGTGGGCGTGG - Intronic
964452167 3:156822989-156823011 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
964751834 3:160060572-160060594 GCTAGAGTTCCAGGTGGGCGTGG + Intergenic
964977733 3:162640119-162640141 GCTGGATTGCCAGCTGGGCGTGG + Intergenic
964982530 3:162703236-162703258 GCGCGAGTTCCAGGTGGGCGTGG - Intergenic
964983178 3:162710822-162710844 GCGTGAGTTCCGGGTGGGCGTGG - Intergenic
965040268 3:163499072-163499094 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
965044163 3:163552633-163552655 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
965077969 3:164003019-164003041 GCTGGAGTTCCAGGTGGGCGTGG + Intergenic
965109453 3:164402211-164402233 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
965200371 3:165649629-165649651 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
965220239 3:165918760-165918782 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
965220916 3:165924617-165924639 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
965245268 3:166258780-166258802 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
965288012 3:166842860-166842882 GTTGGAGTTCCCGGTGGGCGTGG + Intergenic
965298103 3:166975882-166975904 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
965652332 3:170947271-170947293 GCATGAGTTCCAGGTGGGCGTGG + Intergenic
965753259 3:171999183-171999205 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
965943512 3:174212284-174212306 GCTGGAGTTCCGGGTAGGCGTGG - Intronic
966076043 3:175937423-175937445 ACTGGAGTTCCGGGTGTGCGTGG + Intergenic
966096822 3:176213740-176213762 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
966183058 3:177204206-177204228 GCGTGAGTTCCAAGTGGGCGGGG - Intergenic
966186180 3:177228892-177228914 GCGTGAGTTCCGGGTGGGCGTGG - Intergenic
966191043 3:177272039-177272061 GCTGGAGTTCCGGGTGGGCGGGG - Intergenic
966372438 3:179263320-179263342 GTCCGAGTTCCAGGTGGGCGTGG - Intronic
966724976 3:183100945-183100967 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
967234126 3:187367881-187367903 GCTAGAGTTCTGGGTGGGCGTGG - Intergenic
967448478 3:189596172-189596194 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
967499180 3:190177361-190177383 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
968049462 3:195644241-195644263 GCTGGAGATCCAGGTGGGAGAGG + Intergenic
968097172 3:195940251-195940273 GCTGATGTTCCAGGTTGACGCGG - Intergenic
968097940 3:195945385-195945407 GCTGGAGATCCAGGTGGGAGAGG - Intergenic
968105843 3:196000516-196000538 GCTGAAGTTCCAGGTTGACGCGG - Intergenic
968106405 3:196004765-196004787 GCTGGAGATCCAGGTGGGACAGG - Intergenic
968181625 3:196599349-196599371 GCTGGAATTCCGGGTAGGCGTGG - Intergenic
968305155 3:197645691-197645713 GCTGGAGATCCAGGTGGGAGAGG - Intergenic
968469661 4:773610-773632 GCAAGAGTTCCGGGTGGGCGTGG + Intergenic
968613244 4:1566500-1566522 GCTGGAGTCACAGGTGGGTGTGG + Intergenic
968613250 4:1566516-1566538 GGTGTGGTTCCAGGTGGGTGGGG + Intergenic
968613328 4:1566818-1566840 GGTGTAGCTCCAGGTGAGCGGGG + Intergenic
968716139 4:2161318-2161340 GCTGGAGTTCAGGGTGGGCGTGG + Intronic
968745900 4:2359943-2359965 GCTGTCCTTCCAGGTGGATGGGG - Intronic
969017688 4:4115449-4115471 GCTGGAGTTCTGGGTGGGCATGG + Intergenic
969058801 4:4418962-4418984 CCTGTATTTCCAGGTAGACGTGG + Exonic
969303180 4:6309337-6309359 GCGAGAGTTCCGGGTGGGCGGGG - Intergenic
969362329 4:6672772-6672794 GCTGGAGTTCAGGGTGGGCGTGG + Intergenic
969371225 4:6732795-6732817 GCTGTTCTTGCAGCTGGGCGTGG + Intergenic
969440715 4:7215177-7215199 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
969655000 4:8491721-8491743 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
969736301 4:8993162-8993184 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
969755007 4:9143626-9143648 GCGCTAGTTCCGGGTGGGCATGG + Intergenic
969795499 4:9524725-9524747 GCTGGAGTTCTGGGTGGGCGTGG - Intergenic
970108297 4:12609682-12609704 GCGAGAGTTCCGGGTGGGCGAGG + Intergenic
970391190 4:15614962-15614984 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
970408669 4:15787045-15787067 GCGCGAGTTCCAGGTGGGCGTGG - Intronic
970535745 4:17028207-17028229 TCTGAAGTTCCAGGTGGACATGG - Intergenic
970574603 4:17414599-17414621 GCGCGAGTTCCAGGTGGGCTCGG - Intergenic
970649355 4:18159581-18159603 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
970673194 4:18418650-18418672 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
970803498 4:20004060-20004082 GCTGGAGTTCCAGGTGGGCGTGG + Intergenic
970817910 4:20179336-20179358 GTGCGAGTTCCAGGTGGGCGTGG - Intergenic
971281708 4:25246927-25246949 GCGCAAGTTCCAGGTGGGCATGG - Intronic
971377143 4:26064291-26064313 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
971553063 4:27978647-27978669 GCTGGAGTTCCGGGTGGGCATGG - Intergenic
971563537 4:28112828-28112850 GCTGGAGTTCCCGGTGGGAATGG + Intergenic
971564217 4:28117453-28117475 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
971639799 4:29117401-29117423 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
971709435 4:30092756-30092778 GCTGGAGTTTCAGATGGGCGTGG + Intergenic
971811929 4:31438700-31438722 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
971905221 4:32716537-32716559 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
972022810 4:34335953-34335975 GCTGGAGTTCCGGCTGGGCGTGG - Intergenic
972496471 4:39639110-39639132 GATGTAGTTCCGGTTGGGAGGGG + Intergenic
972505805 4:39718814-39718836 GCTAGATTTCCAGGTGGGCGTGG - Intronic
972900102 4:43672406-43672428 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
973037075 4:45420211-45420233 GCTGGAGTTCCGGGTTGGCGTGG + Intergenic
973045361 4:45530504-45530526 GCACGAGTTCCAGGTGGGTGTGG + Intergenic
973146288 4:46831087-46831109 GCTAGAGTTCCGGGTGGGCATGG + Intronic
973308056 4:48675389-48675411 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
973765120 4:54155435-54155457 GCTGGAGTTCCGGGTGGGTGTGG - Intronic
973817555 4:54632585-54632607 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
973854092 4:54993563-54993585 GCGCGAGTTCCAGGTGGGCGTGG + Intergenic
974128984 4:57730090-57730112 GCTGGAGTTCCAGGTGGGAGTGG - Intergenic
974147392 4:57965473-57965495 GCTGGAGTTCCGGATGGGCGTGG + Intergenic
974207423 4:58724184-58724206 GCACAAGTTCCAGGTGGGCATGG + Intergenic
974484816 4:62492208-62492230 GCTGGAGTTCCGAGTGGGCGTGG - Intergenic
974590619 4:63943186-63943208 GCTGGAGTTCTGGGTGGGCGTGG - Intergenic
974641769 4:64640785-64640807 GCTGGAGTTCCCGGTGGGCGTGG - Intergenic
974781772 4:66561793-66561815 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
974804358 4:66860217-66860239 GCTGGAGTTCTGGGTGGGCGTGG + Intergenic
974827729 4:67151928-67151950 GCTGGAGTTTCCGGTGGGCGTGG + Intergenic
974892319 4:67896872-67896894 GCTAGAGTTCCGGGTGGGTGTGG - Intergenic
974992899 4:69115555-69115577 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
975055379 4:69923940-69923962 GCTGCAGTTCCGGGTGGGCGTGG + Intergenic
975298795 4:72765947-72765969 GCAGGAGTTCCGTGTGGGCGTGG + Intergenic
975439977 4:74399375-74399397 GCACAAGTTCCGGGTGGGCGTGG - Intergenic
975595212 4:76043598-76043620 GCTGGAGTTCTGGGTGGGCGTGG - Intronic
975596393 4:76050969-76050991 GCTGGAGTTCCGGGTAGGCGTGG - Intronic
975755849 4:77570713-77570735 GCTGGAGTTCTGGGTGGGCGTGG + Intronic
975994918 4:80302886-80302908 GCGCAAGTTCCAGGTGGGCGTGG + Intronic
976406359 4:84664766-84664788 GCTGGAGTTCCAGGTGGGCGTGG + Intergenic
976520655 4:86021920-86021942 GCTGGAGTTGCAGGTAGGCGTGG - Intronic
976565512 4:86547347-86547369 GCGCGAGTTCCGGGTGGGCGTGG + Intronic
976646891 4:87396258-87396280 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
976980322 4:91218281-91218303 GCTGGAGTTCCGGGTGGGTGTGG - Intronic
977206492 4:94169893-94169915 GCTGGAGTTCTGGGTGGGCGTGG + Intergenic
977393824 4:96447735-96447757 GTTATAGTTCCACGTGGCCGGGG - Intergenic
977606961 4:98993796-98993818 GCTAGAGTTCCAGGTGGGCGTGG - Intergenic
977717375 4:100196832-100196854 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
977750990 4:100609077-100609099 GCTGGAGTTCTGGGTGGGCGTGG - Intronic
977906458 4:102483175-102483197 GCTGGAGTTCCAGGTGAGCATGG + Intergenic
978080225 4:104582031-104582053 GCTGGAGTTCCGGGTGGGTGTGG + Intergenic
978207217 4:106092703-106092725 GTTAGAGTTCCAGGTGGGCGTGG - Intronic
978241912 4:106525655-106525677 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
978463637 4:108984664-108984686 GCGGGAGTTCCGGGTGGGCGTGG - Intronic
978466227 4:109012522-109012544 GCGCGAGTTCCAGGTGGGCGCGG + Intronic
978514581 4:109557456-109557478 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
978998072 4:115179728-115179750 GCTGGGGTTCCGGGTGGGCGTGG - Intergenic
978999599 4:115200506-115200528 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
979224160 4:118265597-118265619 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
979290844 4:118977361-118977383 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
979308294 4:119173834-119173856 GCTGGAGTTCTGGGTGGGCATGG + Intronic
979424775 4:120551049-120551071 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
979445692 4:120808878-120808900 GCGTGAGTTCCAGGTGGGCGTGG - Intronic
979608992 4:122670265-122670287 GTGCGAGTTCCAGGTGGGCGTGG + Intergenic
979678636 4:123435681-123435703 GCGCGAGTTCCAGGTGGGCGTGG - Intergenic
979688560 4:123537965-123537987 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
979755846 4:124339102-124339124 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
979822537 4:125191999-125192021 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
979825732 4:125229903-125229925 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
979829332 4:125280997-125281019 GCGCGAGTTCCAGGTGGGCATGG + Intergenic
979857528 4:125652041-125652063 GCGCGAGTTCCCGGTGGGCGTGG - Intergenic
979899736 4:126201602-126201624 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
979949532 4:126874750-126874772 GCTTGAGCTCCAGGTGGGCATGG - Intergenic
979991439 4:127379983-127380005 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
980043409 4:127964549-127964571 GCTGGAGTTCCGAGTGGGCGTGG - Intronic
980051960 4:128047870-128047892 ACTGGAGTTCCGGGTGGGCGTGG - Intergenic
980141756 4:128925656-128925678 ACTGTAGTCCCAGGAGGGCAGGG - Intronic
980227953 4:130012829-130012851 GCTGGAGTTCCGGGTGGGCAGGG + Intergenic
980470253 4:133240720-133240742 GCTGGAGTTCCGGGTGGGTGTGG - Intergenic
980628570 4:135406667-135406689 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
980698727 4:136395396-136395418 GCTAGAGTTCCGGGTGGGCGCGG + Intergenic
980774466 4:137421069-137421091 GCTAGAGTTCTGGGTGGGCGTGG + Intergenic
980815527 4:137942119-137942141 ACTGGAGTTCCAGGTGGGCGTGG + Intergenic
980827342 4:138088881-138088903 GCACGAGTTCTAGGTGGGCGTGG - Intergenic
981048288 4:140286059-140286081 TCTGTAATTCCAGGTGCTCGGGG + Intronic
981146800 4:141333505-141333527 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
981176611 4:141690170-141690192 GCTGGAGTTCCGTGTGGGCATGG - Intronic
981275796 4:142897548-142897570 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
982024327 4:151236281-151236303 GCGGGGGTTCCAGGTGTGCGTGG + Intronic
982408200 4:155044352-155044374 GCTGGAGTTCCTGGTGGGCGTGG + Intergenic
982647652 4:158044219-158044241 GCTAGAGTTCCGGGTGGGCGTGG + Intergenic
982679072 4:158408116-158408138 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
982814609 4:159869346-159869368 GCTGGAGTTCTGGGTGGGCGTGG - Intergenic
982868836 4:160550429-160550451 GCTGGAATTCCGGGTGGGCGTGG - Intergenic
982921240 4:161277291-161277313 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
982985735 4:162203637-162203659 GCTAGAGTTCCGGGTGGGCGTGG + Intergenic
983026073 4:162739589-162739611 GCTGGAGTTCCGGGCGGGCGGGG + Intergenic
983060313 4:163152894-163152916 GCTGGAGTTCCGGGTGGGCATGG + Intronic
983064109 4:163190017-163190039 GCTGGAGTTCTGGGTGGGCGTGG - Intergenic
983230683 4:165126249-165126271 GCTGGAGTTCGGGGTGGGCGTGG - Intronic
983553081 4:169036147-169036169 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
983656713 4:170091278-170091300 GCTAGAGTTCCGGGTGGGCGTGG + Intronic
983734688 4:171043218-171043240 GCTAGAGTTCCGAGTGGGCGTGG + Intergenic
983752818 4:171298323-171298345 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
983842976 4:172480805-172480827 GCTGTAGTTCAAGTTGGCCTTGG + Intronic
984069268 4:175092160-175092182 GCGCGAGTTCCAGGTGGGCGTGG + Intergenic
984192864 4:176625475-176625497 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
984238845 4:177193506-177193528 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
984265628 4:177495641-177495663 GCTGGAGTTCCGGGTGGGCATGG + Intergenic
984275766 4:177607420-177607442 GCGCCAGTTCCAGGTGGGTGTGG - Intergenic
984662224 4:182386609-182386631 GCTGTAGTTCCGGGTGGGCGTGG + Intronic
984770546 4:183433223-183433245 CCTGGAGTTCCGGGTGGGCGTGG + Intergenic
984776131 4:183482975-183482997 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
984805370 4:183746751-183746773 GTGCGAGTTCCAGGTGGGCGTGG - Intergenic
984948749 4:184990400-184990422 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
985087072 4:186324633-186324655 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
985145408 4:186890163-186890185 GCACGAGTTCCGGGTGGGCGTGG + Intergenic
985195200 4:187421260-187421282 GCTGGAGTTCTGGGTGGGCGTGG - Intergenic
985203225 4:187505679-187505701 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
985366374 4:189236356-189236378 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
985403896 4:189616957-189616979 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
985412123 4:189695966-189695988 GCACGAGTTCCCGGTGGGCGTGG - Intergenic
985423560 4:189807193-189807215 GCGCGGGTTCCAGGTGGGCGCGG - Intergenic
985506125 5:281505-281527 GCTGGAGATCCAGGTGGGAGAGG + Intronic
985742218 5:1625069-1625091 GCTGGAGATCCAGGTGGGAGAGG - Intergenic
985950988 5:3221168-3221190 ACAGCAGATCCAGGTGGGCGGGG - Intergenic
986151976 5:5137834-5137856 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
986211561 5:5678309-5678331 GCTTGGGTTCCAGGTGGGAGAGG + Intergenic
986298030 5:6455757-6455779 GCTGTGGTTACTGGTGGGTGAGG - Intronic
986697971 5:10375207-10375229 GCTGGAGTTCCGGGTGGGCATGG + Intronic
986912414 5:12574256-12574278 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
986912557 5:12574786-12574808 GCGTGAGTTCCGGGTGGGCGTGG - Intergenic
986993255 5:13578560-13578582 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
987146277 5:14994117-14994139 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
987156815 5:15096867-15096889 GCTGGAGTTCCGGGTGGGCATGG - Intergenic
987315270 5:16718000-16718022 GCTGGAGTTGCGGGTGGGCGTGG + Intronic
987347454 5:16991250-16991272 GCGCGAGTTCCAGGTAGGCGTGG - Intergenic
987352305 5:17032704-17032726 GCGCGAGTTCCCGGTGGGCGTGG - Intergenic
987365018 5:17140977-17140999 GCGGGAGTTCCGGGTGGGCGTGG + Intronic
987384039 5:17312084-17312106 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
987532811 5:19143082-19143104 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
987543802 5:19287793-19287815 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
987876925 5:23691173-23691195 GCTGGAGTTCTGGGTGGACGTGG + Intergenic
987896268 5:23951345-23951367 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
987990269 5:25200334-25200356 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
988073463 5:26324470-26324492 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
988087015 5:26485591-26485613 GTTGGAGTTCCGGGTGGACGTGG - Intergenic
988132132 5:27119946-27119968 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
988143082 5:27267509-27267531 GCATGAGTTCCGGGTGGGCGTGG - Intergenic
988155081 5:27439762-27439784 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
988177238 5:27743510-27743532 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
988279579 5:29127934-29127956 GCTGGAGTTCCGGGTGGGTGTGG - Intergenic
988491283 5:31707604-31707626 GCAGTAGCTCCACGTGGGTGTGG - Intronic
988684761 5:33515698-33515720 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
988915921 5:35893179-35893201 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
989559655 5:42836417-42836439 GCACGAGTTCCTGGTGGGCGCGG + Intronic
989956822 5:50369487-50369509 GCTGGAGTTCTGGGTGGGTGTGG + Intergenic
989957905 5:50376881-50376903 GCTGGAGTTCTGGGTGGGTGTGG + Intergenic
989965804 5:50465063-50465085 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
990323206 5:54649333-54649355 GCCAGAGTTCCGGGTGGGCGTGG - Intergenic
990345236 5:54865126-54865148 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
990461499 5:56035538-56035560 GCTGGAGTTCCGGGTGGGCATGG + Intergenic
990490052 5:56295401-56295423 GCTGGAGTTCCGGTTGGGCGTGG + Intergenic
990553825 5:56909996-56910018 GCGGTGGCTTCAGGTGGGCGGGG + Intronic
991168641 5:63594066-63594088 GCTGAAGTACCAGGTGGGGGTGG + Intergenic
991214922 5:64150129-64150151 GCTAGAGTTCCGGGTGGGCGTGG + Intergenic
991567595 5:68020715-68020737 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
992050339 5:72935287-72935309 GCGTGAGTTCCGGGTGGGCGTGG + Intergenic
992296715 5:75333734-75333756 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
992947290 5:81823104-81823126 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
992947424 5:81823771-81823793 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
993031841 5:82714729-82714751 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
993320958 5:86466992-86467014 GCTGGAGTTCCAGGTGGGCATGG - Intergenic
993328604 5:86569835-86569857 GCTGGAGTTCAGGGTGGGCTTGG - Intergenic
993529215 5:89003929-89003951 GCTGGAGTTCCGGATGGGCGTGG - Intergenic
993678620 5:90847784-90847806 GCGCGAGTTCCGGGTGGGCGTGG - Intronic
993770258 5:91917326-91917348 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
993822009 5:92631382-92631404 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
994096315 5:95851216-95851238 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
994229940 5:97301197-97301219 GCTGGAGTTCCAGCTGGGCATGG + Intergenic
994239848 5:97407228-97407250 GCACGAGTTCCGGGTGGGCGTGG + Intergenic
994254815 5:97580304-97580326 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
994507085 5:100656812-100656834 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
994509866 5:100689178-100689200 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
994605628 5:101962757-101962779 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
994620314 5:102154989-102155011 GCTAGAGTTCCGGGTGGGCGTGG + Intergenic
994669727 5:102752116-102752138 GCTAGAGTTCCGGGTGGGCGTGG + Intergenic
994701725 5:103142348-103142370 GCTGGAGTTCTGGGTGGGCGTGG - Intronic
994769812 5:103966636-103966658 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
994928792 5:106154355-106154377 GCTGGAGTTCCGCGTAGGCGTGG + Intergenic
994935265 5:106246302-106246324 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
995032295 5:107494294-107494316 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
995206676 5:109488122-109488144 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
995326429 5:110894294-110894316 GCGCGAGTTCCCGGTGGGCGTGG - Intergenic
995457313 5:112366189-112366211 GCTGTGGTTGCAGGTGGCAGGGG - Intronic
995568651 5:113457193-113457215 GCTGGAGTTCCAGGTGGGCCTGG + Intronic
995582612 5:113617366-113617388 GTGCGAGTTCCAGGTGGGCGGGG + Intergenic
995596475 5:113753429-113753451 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
995656484 5:114432730-114432752 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
995679896 5:114704600-114704622 GCTGGAGTTCCGGGTGGGCATGG - Intergenic
995700338 5:114928885-114928907 GCGTGAGTTCCAGGTGGACGTGG + Intergenic
995920372 5:117304710-117304732 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
995975785 5:118033828-118033850 GCTAGAGTTCCGGGTGGGCGTGG + Intergenic
996107022 5:119517153-119517175 GCTTGAGTTCTGGGTGGGCGTGG + Intronic
996234198 5:121107226-121107248 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
996435665 5:123430596-123430618 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
996478718 5:123949499-123949521 GCGGGAGTTCCGGGTGGGCATGG - Intergenic
996567172 5:124892465-124892487 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
996585976 5:125088752-125088774 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
996747123 5:126854842-126854864 GCGTGAGTTCCGGGTGGGCGTGG - Intergenic
996815551 5:127569504-127569526 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
997158222 5:131580345-131580367 GCACAAGTTCCGGGTGGGCGTGG - Intronic
997363966 5:133313516-133313538 GCTGTAGCTCCAGCTGAGTGAGG - Intronic
997375478 5:133394402-133394424 GCCTGAGTTCCAGGTGGGCATGG + Intronic
997760533 5:136444262-136444284 GTTGGAGTTCCGGGTGGGTGTGG + Intergenic
999348527 5:150845513-150845535 GCACGAGTTCCGGGTGGGCGTGG + Intergenic
999406154 5:151309236-151309258 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
999799567 5:155020072-155020094 GCTGTAGCTCCAGGAGGGCGGGG + Intergenic
999855309 5:155587062-155587084 GCTGGAGTTCCAGGTGGGCGTGG - Intergenic
1000066008 5:157693887-157693909 GCTGGAGTTCCAGGTGGGCGTGG + Intergenic
1000212340 5:159119222-159119244 GCGTGAGTTCCGGGTGGGCGTGG + Intergenic
1000329217 5:160194208-160194230 GCTGGAGTTGCCGGTGGGCGTGG - Intronic
1000891843 5:166810507-166810529 GCTGGAGTTCTGGGTGGGTGTGG - Intergenic
1000902510 5:166927258-166927280 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
1001146885 5:169192841-169192863 GCTGGAGTTGCAGGTGAGGGTGG - Intronic
1001380328 5:171301969-171301991 CCTGGAGTTCCACGTGGGAGTGG + Intergenic
1001636422 5:173213494-173213516 GCTAGAGTTCTGGGTGGGCGTGG + Intergenic
1002004661 5:176222336-176222358 GCTGGAGTTCCGGGTAGGCGTGG - Intergenic
1002024591 5:176388402-176388424 GCTGGGGTTCCGGGTGGCCGTGG - Intronic
1002221717 5:177688284-177688306 GCTGGAGTTCCGGGTAGGCGTGG + Intergenic
1002616421 5:180459221-180459243 GCAGAAGTTCTGGGTGGGCGCGG + Intergenic
1002757988 6:179622-179644 GCTAGAGTTCCGGGTGGGCGTGG + Intergenic
1002789403 6:426512-426534 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
1002790754 6:435849-435871 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
1002793184 6:450035-450057 GCTACAGTTCCGGGTGGGCGTGG + Intergenic
1003060699 6:2860193-2860215 GCTGGAGTTCCGGGTGGACGTGG + Intergenic
1003069644 6:2935858-2935880 GCTAGAGTTCCGGGTGGGCGTGG + Intergenic
1003070197 6:2939679-2939701 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1003081887 6:3027751-3027773 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1003100165 6:3170815-3170837 GCTAGAGTTCCAGGTGGGCGTGG + Intergenic
1003111248 6:3253620-3253642 GCGCGAGTTCCGGGTGGGCGCGG + Intronic
1003170875 6:3721076-3721098 GCTGGAGTTCCGGGTGGGCCTGG - Intergenic
1003177259 6:3761438-3761460 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
1003178462 6:3771687-3771709 GCTAGAGTTCCGGGTGGGCGTGG + Intergenic
1003213726 6:4090191-4090213 GCGCCAGTTCCGGGTGGGCGTGG + Intronic
1003224488 6:4191600-4191622 GCTAGAGTTCCAGGTGGGCGTGG - Intergenic
1003327143 6:5100567-5100589 GCTGTGGTTAGAGGTGGGGGTGG + Intergenic
1003489244 6:6606737-6606759 GCGCGAGTTCCGGGTGGGCGTGG - Intronic
1003506698 6:6745985-6746007 GCGCAAGTTCCGGGTGGGCGTGG - Intergenic
1003508862 6:6762791-6762813 GCTAGAGTTCCGGGTGGGCGTGG - Intergenic
1003578315 6:7317045-7317067 GCGCGAGTTCCGGGTGGGCGTGG - Intronic
1003581420 6:7344266-7344288 GCTGGAGTTCCGGGTAGGCGTGG + Intronic
1003671514 6:8164386-8164408 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1003717673 6:8666017-8666039 GCTGGAGTTCCGGGTGGGCATGG + Intergenic
1003736873 6:8887216-8887238 GCTGGAGTTCGGGGTGGGCATGG + Intergenic
1003747985 6:9024327-9024349 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1003770183 6:9290747-9290769 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1003836236 6:10074989-10075011 GCGCGAGTTCCGGGTGGGCGTGG - Intronic
1003845706 6:10171772-10171794 GCTGGAGTTCCGGGTGGGCATGG + Intronic
1003897037 6:10617328-10617350 GCGTGAGTTCCGGGTGGGCGTGG - Intronic
1003901567 6:10659935-10659957 GCTAGAGTTCCGGGTGGGCGTGG + Intergenic
1003908103 6:10720643-10720665 GTTGGAGTTCCGGGTGGGCGTGG + Intergenic
1003947255 6:11087266-11087288 GCTGGAGCTCCGGGTGGGCGTGG + Intergenic
1003982494 6:11402893-11402915 GCTAGAGTTCCCGGTGGGCGTGG - Intergenic
1003983995 6:11417305-11417327 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
1004036941 6:11933130-11933152 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1004053178 6:12108701-12108723 GCTGGAGCTCCGGGTGGGCGTGG - Intronic
1004196609 6:13511341-13511363 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
1004224374 6:13772539-13772561 GCTGGAGTTCCAGGTGGGCGTGG + Intergenic
1004235567 6:13872233-13872255 GCTAGAGTTCCGCGTGGGCGTGG - Intergenic
1004338237 6:14783878-14783900 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
1004452412 6:15759069-15759091 GCTAGAGTTCCGGGTGGGCGTGG - Intergenic
1004486294 6:16069498-16069520 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1004499697 6:16198401-16198423 GCTAGATTTCCGGGTGGGCGTGG - Intergenic
1004502113 6:16218308-16218330 GCTGCAGTTCCGGGTGGGCGTGG - Intergenic
1004511623 6:16288303-16288325 GCTGGAGTTCCGGGTGGGTGTGG + Intronic
1004587461 6:17016071-17016093 GCGCAAGTTCCGGGTGGGCGCGG - Intergenic
1004663289 6:17728809-17728831 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
1004665551 6:17745618-17745640 GCTGGAGTTCCGGGTGGGCGCGG - Intergenic
1004689117 6:17976499-17976521 GCTGGAGTTCTGGGTGGGCGTGG - Intronic
1004861401 6:19807279-19807301 GCGCGAGTTCCAGGTGGGCGTGG - Intergenic
1004866081 6:19854737-19854759 GCTGGAGTTCCGCGTGGGCGTGG - Intergenic
1004905412 6:20233267-20233289 ACGCGAGTTCCAGGTGGGCGTGG + Intergenic
1004906189 6:20239112-20239134 GCGCGAGTTCCAGGTGGGCGTGG + Intergenic
1004906959 6:20245081-20245103 GCTGGAGTTCCAGGTGGGCGTGG - Intergenic
1004908496 6:20259617-20259639 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
1005042284 6:21610172-21610194 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
1005059258 6:21761208-21761230 GCGCGAGTTCCAGGTGGGTGTGG + Intergenic
1005117753 6:22356720-22356742 GCGCGAGTTCCAGGTGGGTGTGG - Intergenic
1005332905 6:24766247-24766269 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1005561420 6:27045335-27045357 GCACGAGTTCCGGGTGGGCGTGG + Intergenic
1005596235 6:27381369-27381391 GCTGGAGTTCCGGTTGGGCGTGG - Intronic
1005600900 6:27425139-27425161 GCTGGAGTTCCGGGAGGGCGTGG - Intergenic
1005749087 6:28866751-28866773 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
1005749956 6:28872904-28872926 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1005758918 6:28950104-28950126 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1005759782 6:28957894-28957916 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1005977030 6:30807753-30807775 GCGGGAGTTCCGGGTGGGCGTGG - Intergenic
1005978265 6:30816609-30816631 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1006005755 6:31000539-31000561 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1006007799 6:31016841-31016863 GCACTAGTTCCAGGTGGGCGTGG + Intronic
1006008279 6:31020770-31020792 GCTGCAGTTCCAGGTAGGCGTGG + Intronic
1006033612 6:31195510-31195532 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1006127943 6:31852106-31852128 GCGCAAGTTCCGGGTGGGCGTGG + Intergenic
1006348450 6:33502749-33502771 GCGCGAGTTCCAGGTGGGTGTGG + Intergenic
1006351125 6:33521810-33521832 GCTCGAGTTCCGGGTGGGCGCGG - Intergenic
1006352616 6:33532439-33532461 GCTGAAGTTCCAGGTGGGCGTGG + Intergenic
1006477806 6:34269075-34269097 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1006695986 6:35931316-35931338 GCTGGAGTTCCAGGTGGGCGTGG + Intergenic
1006978390 6:38124630-38124652 GCTAGAGTTCCAGATGGGCATGG - Intronic
1007071817 6:39043515-39043537 CCTGTAATTCCAGGTGTGGGAGG + Intergenic
1007738712 6:43998147-43998169 GCGCAAGTTCCGGGTGGGCGTGG + Intergenic
1008005617 6:46406077-46406099 GCTGGAGTTCTGGGTGGGCGTGG - Intronic
1008038757 6:46774648-46774670 GCTGGAGTTCTGGGTGGGCGTGG + Intergenic
1008270515 6:49483728-49483750 GCTGTAGTTCCAGGTGGGCGTGG - Intronic
1008284370 6:49629860-49629882 GCTGGAGTTCTGGGTGGGCATGG - Intronic
1008308333 6:49933728-49933750 GCTAGAGTTCCAGGTGGGCATGG + Intergenic
1008680088 6:53862838-53862860 GCTGTTGTTCCGGGTGTGCAGGG - Intronic
1008770972 6:54979285-54979307 GCTGGAATTCCGGGTGGGCGTGG + Intergenic
1009054301 6:58316594-58316616 GCTGGAGTTCCAGGTGCCCCAGG - Intergenic
1009407122 6:63326765-63326787 GCTGGAGTTCTGGGTGGGCGTGG - Intergenic
1009418853 6:63443256-63443278 GCACCAGTTCCAGGTGGGCGCGG - Intergenic
1009470257 6:64023826-64023848 GCGCGAGTTCCAGGTGGGCGTGG + Intronic
1009587631 6:65627592-65627614 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
1009615517 6:65999677-65999699 GCGTGAGTTCCAGGTGGACGTGG - Intergenic
1009685313 6:66949265-66949287 GCTGGAGTTCCGGGTGGGTGTGG + Intergenic
1009872239 6:69467251-69467273 GCTAGAGTTCCAGATGGGCGTGG + Intergenic
1010066273 6:71686209-71686231 GCGGGAGTTCCGGGTGGGCGTGG + Intergenic
1010199339 6:73269184-73269206 GCTGGAGTTCCGGGTGGGCATGG - Intronic
1010235674 6:73572847-73572869 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1010617355 6:78029848-78029870 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1011143666 6:84189417-84189439 GCTGGAGTTCCGGGTGGGCATGG + Intronic
1011195290 6:84774204-84774226 GCTCTAGTTCCCGGGCGGCGCGG + Intergenic
1011246498 6:85326028-85326050 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1011338370 6:86285087-86285109 GCGTGAGTTCCAGGTGGGTGTGG - Intergenic
1011601588 6:89065073-89065095 GCTGGAGTTCCAGGGGGGCGTGG + Intergenic
1011931780 6:92723547-92723569 GCGTGAGTTCCGGGTGGGCGTGG + Intergenic
1011974742 6:93282696-93282718 GCGCGAGTTCCCGGTGGGCGTGG + Intronic
1012131269 6:95496992-95497014 GCGCAAGTTCCAGGTGGGCACGG + Intergenic
1012189365 6:96261256-96261278 GCTGGAGTTCTGGGTGGGCGTGG - Intergenic
1012547867 6:100440320-100440342 GCTTTAGTGCCAGATGGGCCTGG - Intronic
1012733558 6:102910951-102910973 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
1012760527 6:103294714-103294736 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1012850974 6:104446385-104446407 GCGTGAGTTCCGGGTGGGCGTGG + Intergenic
1012968428 6:105700613-105700635 CTTGTAGTTCCACGTGGGCTGGG - Intergenic
1013025747 6:106269717-106269739 GCTGGAGTTCCGGGTGGGTGTGG - Intronic
1013080209 6:106805814-106805836 GCTGGAGTTCTGGGTGGGCATGG + Intergenic
1013081511 6:106817073-106817095 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1013143593 6:107364556-107364578 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
1013237038 6:108206449-108206471 GCTGTAGTTACAGGTGCCAGAGG + Intergenic
1013410800 6:109881452-109881474 GCTGGAGTTCTGGGTGGGCGTGG - Intergenic
1013853361 6:114541994-114542016 GCACGAGTTCCAGGTGGGTGTGG - Intergenic
1013955370 6:115834911-115834933 GCTGGAGTTCCGGGTGGGCATGG - Intergenic
1013957221 6:115855245-115855267 GCATGAGTTCCAGGTGGGCGCGG + Intergenic
1013960068 6:115889154-115889176 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1014055862 6:117014810-117014832 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1014240715 6:119015373-119015395 GCTGGAGTTCTGGGTGGGTGTGG + Intronic
1014460277 6:121686724-121686746 GCGCAAGTTCCGGGTGGGCGTGG - Intergenic
1014507738 6:122280630-122280652 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1014718539 6:124892022-124892044 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1014788448 6:125644501-125644523 GCGGGAGTTCCGGGTGGGCGTGG + Intergenic
1014921097 6:127214901-127214923 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1015572279 6:134633856-134633878 GCTGGAGTTCTGGGTGGGCGTGG - Intergenic
1015600321 6:134904780-134904802 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1016067397 6:139698226-139698248 GCTGGAGTTCCGGGTGGGCCTGG - Intergenic
1016069913 6:139726659-139726681 GCTGGAGTTCCAGGTGGGCGTGG - Intergenic
1016092857 6:139999895-139999917 GCTGGAGTTCTGGGTGGGCGTGG - Intergenic
1016104753 6:140148431-140148453 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
1016217171 6:141618261-141618283 GCGGGAGTTCTGGGTGGGCGTGG + Intergenic
1016482342 6:144495454-144495476 GCTGGAGTTCCGGGTGGGCTTGG - Intronic
1016858943 6:148698355-148698377 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1016859083 6:148698891-148698913 GCGCCAGTTCCGGGTGGGCGTGG - Intergenic
1016995643 6:149960846-149960868 CCTGGAGTTGCAAGTGGGCGGGG - Intergenic
1017002980 6:150008660-150008682 CCTGGAGTTGCAAGTGGGCGGGG + Intergenic
1017012549 6:150072326-150072348 CCTGGAGTTGCAAGTGGGCGGGG + Intergenic
1017298958 6:152834393-152834415 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1017325061 6:153133671-153133693 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1017581248 6:155867066-155867088 ACTGGAGTTCTAGGTGGGCGTGG - Intergenic
1017839535 6:158210099-158210121 GCTGGAGTTCTGAGTGGGCGTGG - Intergenic
1018064263 6:160114812-160114834 GCTGGAATTCCGGGTGGGCGTGG - Intergenic
1018545651 6:164933349-164933371 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1018624672 6:165765597-165765619 GCTGGAGTTCCAGGTGGGCGTGG - Intronic
1018696455 6:166395290-166395312 ACTGTGGATCCAGCTGGGCGTGG - Intergenic
1019000289 6:168744096-168744118 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1019944297 7:4314249-4314271 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1019965779 7:4497241-4497263 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1020008261 7:4793577-4793599 GCGCGAGTTCCGGGTGGGCGTGG + Intronic
1020163916 7:5793634-5793656 GCTAGAGTTCCGGGTGGGCGTGG + Intergenic
1020552298 7:9621757-9621779 GCGTGAGTTCCGGGTGGGCGTGG - Intergenic
1020784465 7:12556469-12556491 GCGCGAGTTCCGGGTGGGCGGGG - Intergenic
1021324098 7:19245533-19245555 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1021513838 7:21461556-21461578 GCTAGAGTTCCGGGTGGGTGTGG - Intronic
1021520720 7:21536846-21536868 GCACAAGTTCCGGGTGGGCGTGG - Intergenic
1021567365 7:22028729-22028751 GCGTGAGTTCCGGGTGGGCGTGG + Intergenic
1021576830 7:22112709-22112731 CCTGTAGTTCCAGCTGCTCGGGG + Intergenic
1021686787 7:23194038-23194060 GCTGGAGTTCCGAGTGGGCGTGG - Intronic
1021761305 7:23905025-23905047 GCTAGAGTTCCGGGTGGGCGTGG - Intergenic
1022174162 7:27857323-27857345 GCACGAGTTCCGGGTGGGCGTGG - Intronic
1022750410 7:33219023-33219045 GCTGGAGTTCCGGGTGGGTGTGG + Intronic
1023127917 7:36973793-36973815 GCTGGAGTTCCAGATGGGCGTGG + Intronic
1023396231 7:39754250-39754272 GCTAGAGTTCCAGGTGGGCGTGG - Intergenic
1023949886 7:44835072-44835094 GCTGTGGTTACAGCTGGGCACGG - Intronic
1024213754 7:47228879-47228901 GTTGTAGGTGGAGGTGGGCGGGG - Intergenic
1024269049 7:47628526-47628548 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1024691251 7:51805884-51805906 GCTGGAGTTCCTGGTGGGCGTGG + Intergenic
1024700663 7:51901206-51901228 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1024741756 7:52362700-52362722 GCTCTAGTTCCGGGTGGGCTTGG + Intergenic
1024748230 7:52431551-52431573 GCACGAGTTTCAGGTGGGCGTGG - Intergenic
1024794319 7:53003983-53004005 GCTGGAGTTCCCAGTGGGCATGG + Intergenic
1024834019 7:53495070-53495092 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1024903956 7:54354611-54354633 GCTGGTGTTTCCGGTGGGCGTGG + Intergenic
1025962097 7:66231651-66231673 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
1026010085 7:66629339-66629361 GGGGGAGTTGCAGGTGGGCGGGG - Intronic
1026187115 7:68090725-68090747 GCTGGAGTTCTGGGTGGGCGTGG - Intergenic
1026335873 7:69393878-69393900 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1026512316 7:71037644-71037666 GCTGGAGTTCAGGGTGGGCGTGG + Intergenic
1026596585 7:71738390-71738412 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1026634211 7:72067077-72067099 ATTATAGTTCCAGCTGGGCGTGG - Intronic
1026657819 7:72272676-72272698 ACTGTAGTTCCAAGTGTGGGTGG - Intronic
1026904161 7:74053297-74053319 GCTGCGGTTCCAGGTGAGCTGGG + Exonic
1027238036 7:76309748-76309770 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
1027263832 7:76483088-76483110 GCTGCGGTCCCAGGTGGGAGAGG - Exonic
1027315205 7:76981201-76981223 GCTGCGGTCCCAGGTGGGAGAGG - Intergenic
1027482561 7:78717096-78717118 GTTGTAGGTCCAGGCGGGAGAGG - Intronic
1027561642 7:79739349-79739371 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1027564066 7:79768275-79768297 GCTGGAGTTCTGGGTGGGCGTGG - Intergenic
1027579743 7:79977920-79977942 GCTGGAGTTCTGGGTGGGCCTGG - Intergenic
1027665868 7:81042758-81042780 GCTGGAGTTCCGGGTGGGTGTGG + Intergenic
1027667557 7:81057794-81057816 GCTGGAGTTCCGGGTGGGCATGG - Intergenic
1027668724 7:81071158-81071180 GCTCGAGTTCCAGGTGGGCATGG + Intergenic
1027698311 7:81437399-81437421 GCTGCAGCTCCGGGTGGGCATGG - Intergenic
1027868070 7:83673367-83673389 GCTGGAGTTCCAGGTGGGCGTGG + Intergenic
1027956030 7:84880630-84880652 GCGCAAGTTCCGGGTGGGCGTGG + Intergenic
1028070065 7:86440616-86440638 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1028142475 7:87288773-87288795 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1028303318 7:89229039-89229061 GCGCGAGTTCCAGGTGGGCGTGG - Intronic
1028392643 7:90334470-90334492 GCTAGAGTTCTGGGTGGGCGTGG + Intergenic
1028511247 7:91627704-91627726 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1028719445 7:94012178-94012200 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
1028778300 7:94705544-94705566 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1028852548 7:95552777-95552799 GCTGGAGTTCCGGGTGGGTGTGG - Intergenic
1028989476 7:97034389-97034411 GCTAGAGTTCCAGGTGGGCCTGG + Intergenic
1029076129 7:97935979-97936001 GCTGGAGTTCCAGGTGGGCGTGG + Intergenic
1029407066 7:100381777-100381799 GCTAGAGTTCTGGGTGGGCGTGG + Intronic
1029567486 7:101348624-101348646 GCTGGAGTTCTGGGTGGGCGTGG + Intergenic
1029714876 7:102320309-102320331 GCTGTGGGTACAGGTGGGTGTGG - Exonic
1029809646 7:103034514-103034536 GCGGGAGTTCCGGGTGGGCGTGG - Intronic
1029832400 7:103275236-103275258 TCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1030102142 7:105956068-105956090 GCGCTAGTTCCAGGTGGGTGTGG - Intronic
1030215745 7:107042629-107042651 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
1030292669 7:107888036-107888058 GCTAGAGTTCCGGGTGGGCGTGG + Intergenic
1030367040 7:108657528-108657550 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
1030600008 7:111582254-111582276 GCTGGAGTTTCGGGTGGGCGTGG - Intergenic
1030733455 7:113017392-113017414 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1030780387 7:113593369-113593391 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1030980705 7:116182233-116182255 GCGCTAGTTCCGGGTGGGCGTGG - Intergenic
1031292280 7:119951822-119951844 GCTGGAGTTCCGGGTGGGCGGGG - Intergenic
1031378771 7:121060019-121060041 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
1031409185 7:121421779-121421801 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1031605544 7:123763482-123763504 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
1031902840 7:127429215-127429237 GCTCAAGTTCCGGGTGGGCGTGG + Intronic
1032248049 7:130230071-130230093 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1032339625 7:131058812-131058834 GCACGAGTTCCGGGTGGGCGTGG + Intergenic
1032561632 7:132898918-132898940 GCTGGAGTTCCGGGTGGGTGTGG - Intronic
1033065060 7:138146213-138146235 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
1033394110 7:140957255-140957277 GCTGGAGTTCCGGGTGGGTGTGG - Intergenic
1033472111 7:141659570-141659592 GAAGAAGTTCCAGGTGGGAGTGG - Exonic
1033664131 7:143424708-143424730 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1033758624 7:144418209-144418231 GCATGAGTTCCAGGTGGGCGTGG - Intergenic
1033779299 7:144650469-144650491 GCGCGAGTTCCAGGTGGGTGTGG + Intronic
1033866663 7:145697680-145697702 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
1034091016 7:148363857-148363879 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
1034097887 7:148426458-148426480 GCTGGAGTTCTGGGTGGGCGTGG + Intergenic
1034154991 7:148949130-148949152 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1034167781 7:149039008-149039030 GCTGAAGTTCCGGCTGGGCGTGG - Intergenic
1034632162 7:152539171-152539193 GCTGGAGTTCCGGGTGGGTGTGG - Intergenic
1034656068 7:152730587-152730609 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1035122760 7:156582069-156582091 ACTAAAGTTCCAGCTGGGCGTGG - Intergenic
1035151211 7:156874315-156874337 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
1035213123 7:157343574-157343596 CCTGTAGTTCCAGGTGAGGCAGG - Intronic
1035833888 8:2727884-2727906 GCGCGAGTTCCCGGTGGGCGTGG + Intergenic
1035999218 8:4582876-4582898 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
1036135038 8:6152756-6152778 GCACAAGTTCCGGGTGGGCGTGG + Intergenic
1036260453 8:7235747-7235769 GCTGGAGTTCTGGATGGGCGTGG + Intergenic
1036306162 8:7603775-7603797 GCTGGAGTTCTGGATGGGCGTGG - Intergenic
1036312490 8:7694303-7694325 GCTGGAGTTCTGGATGGGCGTGG + Intergenic
1036357007 8:8051760-8051782 GCTGGAGTTCTGGATGGGCGTGG - Intergenic
1036441061 8:8781703-8781725 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1036461682 8:8959210-8959232 GCTCCAGTTCCAGGTGGCTGGGG + Intergenic
1036801345 8:11794854-11794876 GCGCAAGTTCCGGGTGGGCGTGG + Intergenic
1036831343 8:12022711-12022733 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1036901563 8:12673502-12673524 GCTGAAGTTCCAGGTGGGCATGG + Intergenic
1036914953 8:12796344-12796366 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1037239529 8:16760819-16760841 GCTCGAGTTCCAGGTGGGTGTGG - Intergenic
1037241525 8:16783955-16783977 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1037263869 8:17037129-17037151 GCTGGAGTTCCAGGTGGGCGTGG - Intronic
1037810946 8:22086603-22086625 GCTGGAGTTCCGGGTGGGCTTGG + Intergenic
1037957582 8:23071097-23071119 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1037971368 8:23174112-23174134 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1038174044 8:25164545-25164567 GCTGGAGTTCCAGGTGGGCGTGG + Intergenic
1038638251 8:29304302-29304324 GCTGGAGTTCCCGGTGGGCATGG + Intergenic
1038639377 8:29311514-29311536 GCTGGAGTTCCAGGTGGGTGTGG + Intergenic
1038847623 8:31244417-31244439 GCGTGAGTTCCGGGTGGGCGTGG - Intergenic
1038870673 8:31489905-31489927 GCTGGAGTTCTGGGTGGGCATGG + Intergenic
1039068711 8:33631727-33631749 GCTAGAGTTCTGGGTGGGCGTGG + Intergenic
1039069142 8:33634144-33634166 GCTGGAGTTCCGTGTGGGCGTGG - Intergenic
1039284841 8:36028875-36028897 GCTGGAGTTCTGGGTGGGCGTGG + Intergenic
1039637272 8:39180163-39180185 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
1040003720 8:42600373-42600395 GCGCGAGTTCCAGGTGGGCATGG - Intergenic
1040026527 8:42786824-42786846 GCGTGAGTTCCAGGTGGGCGTGG + Intronic
1040622263 8:49103330-49103352 GCTAGAGTTCCAGGTGGGCATGG - Intergenic
1040723099 8:50349967-50349989 GCTGGAGTTCTGGGTGGGCGTGG + Intronic
1040804321 8:51377566-51377588 GCGCGAGTTCCGGGTGGGCGTGG + Intronic
1040952728 8:52953168-52953190 GCTGGAGTTCTGGGTGGGCATGG - Intergenic
1040952865 8:52953862-52953884 GCACGAGTTCCGGGTGGGCGTGG + Intergenic
1040954949 8:52970158-52970180 GCTGGAGTTCCAGGTGGGCGTGG - Intergenic
1040965600 8:53077939-53077961 GCGTGAGTTCCAGGTGGGCGCGG - Intergenic
1041034684 8:53776210-53776232 GCTGGAGTTCTGGGTGGGCGTGG - Intronic
1041623529 8:59999913-59999935 GCACGAGTTCCAGGTGGGCATGG + Intergenic
1041914503 8:63126158-63126180 GCTGGAGTTCCGGGTGGGCGGGG + Intergenic
1041918905 8:63162038-63162060 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1042169508 8:65978103-65978125 GCGCAAGTTCCAGGTGGGCATGG - Intergenic
1042512593 8:69626783-69626805 GCTGGAGTTCCGGATGGGCGTGG - Intronic
1042987468 8:74600292-74600314 GATGGAGTTTCAGGTGGGCATGG + Intronic
1043073376 8:75665776-75665798 GCTGGAGTTCCAGGTGGGCGTGG - Intergenic
1043110095 8:76169657-76169679 GCTGGAGTTCCAGGTGGGCGTGG + Intergenic
1043129967 8:76447925-76447947 GCCGGAGTTCTGGGTGGGCGTGG - Intergenic
1043224047 8:77700774-77700796 GCGCAGGTTCCAGGTGGGCGTGG + Intergenic
1043346432 8:79303543-79303565 GCTGGAGTTCCCGGTGGGCGTGG + Intergenic
1043352516 8:79377516-79377538 GCTGGAGTTCCGGGTGGGCTTGG - Intergenic
1043435295 8:80231857-80231879 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1043640144 8:82441471-82441493 GCTCCAGTTCCGGGTGGGCGTGG + Intergenic
1043709853 8:83402987-83403009 GCTGGAGTTCTGGGTGGGCGTGG + Intergenic
1043841687 8:85112425-85112447 GCTGAAGTCCAAGGTGGGCCAGG + Intronic
1043857136 8:85276111-85276133 GCACGAGTTCCGGGTGGGCGTGG + Intronic
1044075796 8:87820883-87820905 GCTGCAGTTCCGGGTGGGCGTGG + Intergenic
1044088462 8:87971196-87971218 GCACGAGTTCCGGGTGGGCGTGG + Intergenic
1044302902 8:90606408-90606430 GCGCGGGTTCCAGGTGGGCGCGG - Intergenic
1044441621 8:92230824-92230846 GCGCGAGTTCCAGGTGGGTGTGG + Intergenic
1044633503 8:94300645-94300667 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1044788655 8:95823687-95823709 GCTGGAGTTCCAGGTGGGCGTGG + Intergenic
1044853556 8:96452381-96452403 GCAAGAGTTCCGGGTGGGCGTGG + Intergenic
1044862175 8:96534121-96534143 GAGTGAGTTCCAGGTGGGCGTGG - Intronic
1044880689 8:96719397-96719419 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
1044963893 8:97556963-97556985 GCGCGAGTTCCGGGTGGGCGCGG + Intergenic
1044991202 8:97797421-97797443 GTTGTAATTCCAGCCGGGCGCGG - Intronic
1045232351 8:100317092-100317114 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
1045467789 8:102485823-102485845 GCTGGAGTTCCGAGTGGGCGTGG - Intergenic
1046158015 8:110319441-110319463 GTTGTAGCTCCAGCTGGGCTTGG + Intergenic
1046208917 8:111041149-111041171 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1046265418 8:111823594-111823616 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1046285065 8:112083246-112083268 GCTGGAGTTCTGGGTGGGCATGG - Intergenic
1046288878 8:112132741-112132763 GCTGGAGTTGCGGGCGGGCGTGG + Intergenic
1046445308 8:114311400-114311422 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1046450687 8:114386205-114386227 GCTGAAGTTCCGGGTGGGCGTGG + Intergenic
1046621194 8:116531136-116531158 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
1046661227 8:116950047-116950069 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
1047124711 8:121948085-121948107 GCTAGAGTTCCGGGTGGGCGTGG + Intergenic
1047283622 8:123467158-123467180 CCTGTAGTTCCAGCTGAGGGAGG - Intronic
1047631733 8:126714948-126714970 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1048373402 8:133800205-133800227 TATGTAGGTCCAGGTTGGCGTGG + Intergenic
1048757529 8:137755432-137755454 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1048789144 8:138084184-138084206 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1049087667 8:140490826-140490848 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1049500285 8:142959526-142959548 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1049785308 8:144448018-144448040 GCTCCAGTTCCCGGTGGCCGAGG + Intergenic
1050249932 9:3733861-3733883 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
1050920593 9:11196928-11196950 GCTGGAGTTCCAGGTGCGCGTGG + Intergenic
1051305118 9:15700353-15700375 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
1051314218 9:15810715-15810737 GCGCGAGTTCCGGGTGGGCGTGG - Intronic
1051383276 9:16480557-16480579 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
1051439833 9:17072654-17072676 GCTGGAGTTCTGGGTGGGCGTGG + Intergenic
1051459455 9:17295141-17295163 GCTAGAGTTCCGGGTGGGCGTGG - Intronic
1051463774 9:17353984-17354006 GCTGGAGTTTCGGGTGGGCGTGG + Intronic
1051549800 9:18315641-18315663 GCGCGAGTTCCAGGTGGGCGCGG - Intergenic
1051892670 9:21959300-21959322 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
1052075427 9:24135135-24135157 GCTGGAGTTCCAGATGGGCGTGG + Intergenic
1052313411 9:27092703-27092725 GCACGAGTTCCGGGTGGGCGTGG + Intergenic
1052979518 9:34437973-34437995 CCTGGAGTTCCGAGTGGGCGTGG + Intronic
1052985376 9:34483076-34483098 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
1053027314 9:34740548-34740570 GCTGGAGTTCCAGGTGGGCGTGG - Intergenic
1053393380 9:37751927-37751949 GCTAGAGTTCCGGGTGGGCGTGG + Intronic
1053436073 9:38075426-38075448 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
1053475221 9:38377627-38377649 GCGGGAGTTCCGGGTGGGCGTGG + Intergenic
1053547944 9:39042669-39042691 GCTGGAGTTCCGGGTGGGCATGG - Intergenic
1053812064 9:41862710-41862732 GCTGGAGTTCTGGGTGGGCATGG - Intergenic
1054618531 9:67324729-67324751 GCTGGAGTTCTGGGTGGGCATGG + Intergenic
1054722420 9:68617072-68617094 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1055049333 9:71963588-71963610 GCTGGAGTTCCGGGTGGGCGTGG + Intronic
1055102594 9:72480513-72480535 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
1055462088 9:76528833-76528855 GCACGGGTTCCAGGTGGGCGCGG - Intergenic
1055557606 9:77490694-77490716 GCTGGGGTTCCGGGTGGGCGTGG - Intronic
1055814193 9:80185608-80185630 GCTAGAGTTCCGGGTGGGCGTGG - Intergenic
1055925595 9:81507422-81507444 GCGCGAGTTCCAGGTGGGCGAGG + Intergenic
1056080993 9:83093618-83093640 GCTGGAGTTCCGGGTGGGCATGG - Intergenic
1056216247 9:84408528-84408550 GCTAGAGTTTCAAGTGGGCGTGG + Intergenic
1056305736 9:85289096-85289118 GCTAGAGTTCCGGGTGGGCATGG + Intergenic
1056377569 9:86029145-86029167 GGAGGAGTTCCAGCTGGGCGTGG - Intronic
1056677265 9:88686226-88686248 GCGCGAGTTCCAGGTAGGCGTGG - Intergenic
1056743721 9:89282474-89282496 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1056771424 9:89480730-89480752 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
1056913994 9:90729522-90729544 GCTAGAGTTCCAGGTGCGCGTGG + Intergenic
1057034208 9:91799887-91799909 GCTCTAGCCCCAGGTGTGCGTGG + Intronic
1057118144 9:92545320-92545342 GCTAGAGTTCTGGGTGGGCGTGG + Intronic
1057274987 9:93671425-93671447 GGTGTAGATGCAGGTGGGTGTGG + Intronic
1057383949 9:94591455-94591477 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
1057511109 9:95680379-95680401 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1057543887 9:96002031-96002053 GCTGGAGTTCCAGGTGGGCGTGG - Intronic
1057628665 9:96701229-96701251 GCTGCAGTTCCGGGTGGGCGGGG - Intergenic
1058174898 9:101724427-101724449 GCTGGAGTTCTGGGTGGGCGTGG - Intronic
1058235710 9:102487251-102487273 GCGTGAGTTCCGGGTGGGCGTGG - Intergenic
1058286539 9:103186961-103186983 GCTGGAGTTCCGCGTGGGCGTGG + Intergenic
1058365159 9:104200643-104200665 GCGCAAGTTCCAGGTGGGCGTGG + Intergenic
1058585394 9:106501603-106501625 GCGCGATTTCCAGGTGGGCGTGG - Intergenic
1058727496 9:107817842-107817864 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
1058786466 9:108393554-108393576 GCTGGAGTTCCGGATGGGCGTGG + Intergenic
1059810591 9:117852075-117852097 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1059991589 9:119870594-119870616 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1060594259 9:124839033-124839055 GCTGGAGTTCCGGATGGGTGTGG - Intergenic
1060938146 9:127527685-127527707 GCTGTAGCTGTAGGTGGGTGGGG - Intronic
1061259565 9:129472432-129472454 GCTGGAGTTCCATGAGGGCAGGG + Intergenic
1061483799 9:130910169-130910191 GCTGGAGTTCCAGGTGGGCATGG + Intronic
1061498403 9:130988983-130989005 GCTGGAATTCCAGGTGGCCCAGG - Intergenic
1062146237 9:134991343-134991365 GCTGGACTTCCGGGTGGGGGTGG - Intergenic
1203662900 Un_KI270753v1:61682-61704 GCGCGAGTTCCAGGTGGGCGTGG - Intergenic
1203670471 Un_KI270755v1:7015-7037 GCACGAGTTCCCGGTGGGCGTGG + Intergenic
1186116111 X:6306681-6306703 CCTGTAGTTCCAGGTACTCGGGG + Intergenic
1186152627 X:6690819-6690841 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1186282105 X:8003583-8003605 GCTAGAGTTCTGGGTGGGCGTGG - Intergenic
1186293163 X:8121637-8121659 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
1186323281 X:8452803-8452825 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1186896982 X:14013470-14013492 TCTGTGGTTCCAGGTGGACATGG - Intronic
1187005870 X:15232043-15232065 GCTGGAGTTCTGGGTGGGGGTGG - Intergenic
1187139018 X:16575502-16575524 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1187304580 X:18083851-18083873 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1187308005 X:18114685-18114707 GCTGTAGTTCCAGCTGGGATTGG + Intergenic
1187557604 X:20367162-20367184 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1187903988 X:24049740-24049762 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1188111984 X:26204851-26204873 GCGCGAGTTCCGGGTGGGCGTGG + Intergenic
1188166980 X:26873972-26873994 GCGTGAGTTCCAGGTGGGCGTGG - Intergenic
1188171338 X:26931729-26931751 CCTGAAGTTCCTGGTGGGGGTGG - Intergenic
1188189501 X:27157053-27157075 GCTGGAGTTCCGGGTGGGCATGG + Intergenic
1189209812 X:39275665-39275687 GTGCAAGTTCCAGGTGGGCGTGG + Intergenic
1189896860 X:45665080-45665102 GCGCCAGTTCCAGGTGGGTGTGG - Intergenic
1190045900 X:47111316-47111338 GCTGGAGTTCTGGGTGGGCGTGG - Intergenic
1190099227 X:47508315-47508337 GCTGTGGTTCCAGGAAGGTGGGG - Intergenic
1190413996 X:50163642-50163664 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1191053933 X:56222864-56222886 GCTAGAATTCCGGGTGGGCGTGG - Intergenic
1191618664 X:63192882-63192904 CCTGGAGTTCCGGATGGGCGTGG - Intergenic
1192186737 X:68952209-68952231 GCTGGAGTTCCAGGTGGACGTGG + Intergenic
1192869688 X:75173910-75173932 GCTGGAGTTCCGGGTAGGCGTGG - Intergenic
1192870594 X:75179830-75179852 GCTGGAGTTCCGGGTAGGTGTGG - Intergenic
1193271037 X:79530622-79530644 GCTAGAGTTCCGGGTGAGCGTGG + Intergenic
1193538188 X:82738516-82738538 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1193708989 X:84856915-84856937 ACGGTAGTTCCAGGTGGGTGTGG - Intergenic
1193719961 X:84974942-84974964 GGGCAAGTTCCAGGTGGGCGTGG + Intergenic
1193804075 X:85972670-85972692 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
1194025611 X:88746638-88746660 GCACGAGTTCCGGGTGGGCGTGG - Intergenic
1194071625 X:89331342-89331364 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1194118059 X:89926847-89926869 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1194121232 X:89965958-89965980 GCTGGAGTTCCGGGTAGGCGTGG - Intergenic
1194166316 X:90521383-90521405 GCTGGAGTTCCGGGTGGGCATGG + Intergenic
1194650853 X:96512564-96512586 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1195256291 X:103094162-103094184 GCTGGAGTTCTGGGTGGGCGTGG + Intergenic
1195258059 X:103107662-103107684 GCTGGAGTTCCAGGTGGGCGTGG - Intergenic
1195259383 X:103117371-103117393 GCTGGAGTTCTGGGTGGGCGTGG - Intergenic
1195896395 X:109749631-109749653 GCTGGAGTTCCAGGTGGGCGTGG - Intergenic
1195909625 X:109876161-109876183 GCGCGAGTTCCAGGTGGGCGTGG - Intergenic
1196319563 X:114270872-114270894 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1196433379 X:115652021-115652043 GCTGAAGTTACAGGTGTGTGGGG - Intergenic
1196582664 X:117394729-117394751 GCTGGAGTTCCGAGTGGGCGTGG + Intergenic
1196705946 X:118717252-118717274 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1196707628 X:118729233-118729255 GCTGTTGTTTCAGGTGTGTGTGG - Intronic
1196714583 X:118799004-118799026 GCTGGAGTTCCGGGTGGGCATGG + Intergenic
1196728963 X:118922297-118922319 GCTGGAGTTCTGGGTGGGCGTGG - Intergenic
1196741490 X:119029562-119029584 GCTGGAGTTCCCGGTGGGCGTGG + Intergenic
1196762007 X:119208785-119208807 GCTGGAGTTCCCCGTGGGCGTGG - Intergenic
1196762374 X:119211192-119211214 GCTGGAGTTCCCCGTGGGCGTGG - Intergenic
1196775175 X:119331922-119331944 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1196775476 X:119333643-119333665 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1196781493 X:119387897-119387919 GCTGGAGTTCCAGGTGGGCGTGG - Intergenic
1196794011 X:119488176-119488198 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1196827307 X:119751141-119751163 GCTGGAGTTCTGGGTGGGCGTGG - Intergenic
1196845028 X:119890639-119890661 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1196860890 X:120026098-120026120 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
1197000318 X:121431841-121431863 GCTGGAGTTTCGGGTGGGCGTGG - Intergenic
1197340021 X:125255695-125255717 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1197376831 X:125690892-125690914 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1197533800 X:127663282-127663304 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
1197607896 X:128606653-128606675 GCGAGAGTTCCGGGTGGGCGTGG + Intergenic
1198060889 X:133044425-133044447 GCTAGAGTTCCGGGTGGGCATGG + Intronic
1198256106 X:134925691-134925713 GGCTGAGTTCCAGGTGGGCGTGG + Intergenic
1198664340 X:139004338-139004360 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
1198972622 X:142298558-142298580 GCTGGAGTTCCGGGTGGACGTGG - Intergenic
1199009971 X:142746036-142746058 GCTGGAGTTCCGGGTGGGCATGG - Intergenic
1199028827 X:142972449-142972471 GCTGGAGTTACGGGTGGGCGTGG - Intergenic
1199050257 X:143229003-143229025 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1199134192 X:144231522-144231544 GCGCGAGTTCCGGGTGGGCGTGG - Intergenic
1199175511 X:144783681-144783703 GCTGGAGTTCCAGGTGGGCGTGG + Intergenic
1199356278 X:146867194-146867216 GCTGGAGTTCCAGGTGGGCGTGG - Intergenic
1199831314 X:151551500-151551522 GCTGGAGTTCCGGGTGGGCATGG - Intergenic
1199949730 X:152698552-152698574 GCTGTAGATCCTGGTGGGGTCGG - Intergenic
1199951917 X:152714411-152714433 GCTGTAGATCCTGGTGGGGTCGG - Intergenic
1199954562 X:152733589-152733611 GCTGTAGATCCTGGTGGGGTTGG - Intronic
1199957766 X:152754037-152754059 GCTGTAGATCCTGGTGGGGTCGG + Intergenic
1199959944 X:152769909-152769931 GCTGTAGATCCTGGTGGGGTCGG + Intergenic
1200303956 X:155006554-155006576 CCTGTGGTTCCTGTTGGGCGCGG - Intronic
1200317430 X:155148352-155148374 CCTGTGGTTCCTGTTGGGCGCGG + Intergenic
1200423592 Y:2998688-2998710 GCTGGAGTTCCGGGTGGGCATGG - Intergenic
1200470938 Y:3584416-3584438 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1200474089 Y:3623409-3623431 GCTGGAGTTCCCGGTAGGCGTGG - Intergenic
1200512585 Y:4099164-4099186 GCTGGAGTTCCGGGTGGGCATGG + Intergenic
1200725866 Y:6667071-6667093 GCTGGAGTTCCGGGTGGGTGGGG - Intergenic
1200824327 Y:7622529-7622551 GCTGGGGTTCCGGGTGGGCGTGG - Intergenic
1200888651 Y:8298665-8298687 GCTGGAGTTCTGGGTGGGCGTGG + Intergenic
1201423073 Y:13820517-13820539 GCTGGAGTTCCGGGTGGGTGTGG - Intergenic
1201468317 Y:14309335-14309357 GCATGAGTTCCAGGTGGGCGTGG + Intergenic
1201479905 Y:14428138-14428160 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1201487043 Y:14505699-14505721 GCTGAAGTTTCCGGTGGGCGTGG + Intergenic
1201488132 Y:14512862-14512884 GCTGGAATTCCAGGTGAGCGTGG + Intergenic
1201495718 Y:14590096-14590118 GCTGGAGTTCCGGGTGGGCGTGG - Intronic
1201496962 Y:14598509-14598531 GCTGGAGTTCTGGGTGGGCGTGG - Intronic
1201573004 Y:15433892-15433914 GCTGGAGTTCTGGGTGGGTGTGG + Intergenic
1201715775 Y:17043155-17043177 GCTGGAGTTCCGGGTGGGCGTGG + Intergenic
1201885759 Y:18880223-18880245 GCAGGAGTTCTGGGTGGGCGTGG + Intergenic
1201982649 Y:19924028-19924050 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1202109812 Y:21407249-21407271 GCTGGAGTTCCAGGTGGGCGTGG + Intergenic
1202137126 Y:21676975-21676997 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1202235728 Y:22708558-22708580 GCTGGGGTTCCGGGTGGGCGTGG + Intergenic
1202272685 Y:23086075-23086097 GCTTGAGTTCCGGGTGGGTGTGG - Intergenic
1202293341 Y:23334607-23334629 GCTTGAGTTCCGGGTGGGTGTGG + Intergenic
1202307435 Y:23487610-23487632 GCTGGAGTTCCGGGTGGGCGTGG - Intergenic
1202425682 Y:24719819-24719841 GCTTGAGTTCCGGGTGGGTGTGG - Intergenic
1202445107 Y:24950266-24950288 GCTTGAGTTCCGGGTGGGTGTGG + Intergenic
1202563370 Y:26182976-26182998 GCTGGGGTTCCGGGTGGGCGTGG + Intergenic