ID: 1008270519

View in Genome Browser
Species Human (GRCh38)
Location 6:49483745-49483767
Sequence TACAGCTGACCTGCAAGCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008270512_1008270519 4 Left 1008270512 6:49483718-49483740 CCTGCTAAACCCACGCCCACCTG 0: 1
1: 0
2: 62
3: 531
4: 708
Right 1008270519 6:49483745-49483767 TACAGCTGACCTGCAAGCACCGG No data
1008270515_1008270519 -6 Left 1008270515 6:49483728-49483750 CCACGCCCACCTGGAACTACAGC 0: 1
1: 56
2: 522
3: 455
4: 680
Right 1008270519 6:49483745-49483767 TACAGCTGACCTGCAAGCACCGG No data
1008270514_1008270519 -5 Left 1008270514 6:49483727-49483749 CCCACGCCCACCTGGAACTACAG 0: 1
1: 56
2: 503
3: 406
4: 652
Right 1008270519 6:49483745-49483767 TACAGCTGACCTGCAAGCACCGG No data
1008270511_1008270519 16 Left 1008270511 6:49483706-49483728 CCAAGTGTGGGGCCTGCTAAACC 0: 1
1: 0
2: 21
3: 139
4: 510
Right 1008270519 6:49483745-49483767 TACAGCTGACCTGCAAGCACCGG No data
1008270510_1008270519 25 Left 1008270510 6:49483697-49483719 CCAGCTGCTCCAAGTGTGGGGCC 0: 7
1: 82
2: 338
3: 434
4: 575
Right 1008270519 6:49483745-49483767 TACAGCTGACCTGCAAGCACCGG No data
1008270506_1008270519 29 Left 1008270506 6:49483693-49483715 CCAGCCAGCTGCTCCAAGTGTGG 0: 2
1: 18
2: 110
3: 320
4: 597
Right 1008270519 6:49483745-49483767 TACAGCTGACCTGCAAGCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008270519 Original CRISPR TACAGCTGACCTGCAAGCAC CGG Intronic
No off target data available for this crispr