ID: 1008270571

View in Genome Browser
Species Human (GRCh38)
Location 6:49483974-49483996
Sequence AAAATAGGACTGCTACTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 1, 2: 2, 3: 9, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008270571_1008270573 30 Left 1008270571 6:49483974-49483996 CCTGTCAGTAGCAGTCCTATTTT 0: 1
1: 1
2: 2
3: 9
4: 108
Right 1008270573 6:49484027-49484049 ATTTTTAATTATCAATTTAGAGG 0: 1
1: 0
2: 3
3: 88
4: 995

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008270571 Original CRISPR AAAATAGGACTGCTACTGAC AGG (reversed) Intronic
901184430 1:7363649-7363671 AAAATAGACCTGCTAATCACGGG - Intronic
902673899 1:17994939-17994961 AAAAGAGGACTGCTCAAGACTGG - Intergenic
906638515 1:47426841-47426863 AAAAGAGGACTGCTGTTGAAAGG - Intergenic
907656522 1:56348253-56348275 AAAATAGAACTACTACCGGCCGG + Intergenic
911987335 1:104644459-104644481 AAAATAGAACTGTTGCTGACAGG + Intergenic
916003916 1:160642203-160642225 AAAATAGGACTTTGACTGATGGG - Intronic
916992154 1:170255702-170255724 ATAATAAAAATGCTACTGACTGG - Intergenic
918673884 1:187257558-187257580 AAACTAGGAGTGCCACGGACAGG - Intergenic
919667646 1:200307636-200307658 AAAATGGGGCTGCTACAGGCTGG + Intergenic
921639823 1:217539552-217539574 ATCATAGGTCTGCTACTGAGGGG - Intronic
922574869 1:226654870-226654892 AAAAAAGGACTGCTGGGGACAGG + Intronic
1064379076 10:14824307-14824329 AAAATAGGACATCTCCTGGCCGG + Intronic
1067148824 10:43712907-43712929 AAATGAGGACTGTTACAGACTGG - Intergenic
1067151600 10:43739627-43739649 AAAAGAGGTAAGCTACTGACTGG - Intergenic
1069503786 10:68978190-68978212 AAAATATGAGTGGTCCTGACTGG + Intronic
1071586758 10:86830420-86830442 AAAATGGCACAGCTACTTACAGG - Intronic
1073868659 10:107835051-107835073 AGAAGAGGACTGCTTTTGACAGG + Intergenic
1074176271 10:111006706-111006728 AAAATAATACTGCCACTGAGAGG + Intronic
1075274986 10:121085356-121085378 AAAATGGGAATGCTACTTCCTGG - Intergenic
1077872716 11:6276353-6276375 AAAATAGGAATCCTATTAACTGG - Intergenic
1082834449 11:57641241-57641263 AACATTGCACTGCTAGTGACAGG - Intergenic
1087010384 11:93508540-93508562 CAAATAGAACTGCAACTGAATGG + Intronic
1091807138 12:3364918-3364940 AAAATGGGACTGATAATCACTGG - Intergenic
1093693614 12:22136049-22136071 AAAATAAATCTGCTACTGAAAGG + Intronic
1095556805 12:43516309-43516331 AAAATAGGGCTGCTTCTGAATGG + Intronic
1104143188 12:126007552-126007574 AATATAGGACTGATACAGAAGGG - Intergenic
1109154055 13:58882511-58882533 AAAATTGGGTTGCTACTGATTGG - Intergenic
1110067161 13:71122974-71122996 AAAATAAGACTGCTATTTAAGGG - Intergenic
1113095834 13:106663005-106663027 AACCCAGGACTGCTATTGACGGG - Intergenic
1115143542 14:30200705-30200727 AAAATAAGTCTGCTCCTGATAGG - Intergenic
1119314134 14:73677264-73677286 AAAATATGAATACTACTGGCTGG - Intronic
1120990242 14:90369483-90369505 ACAATAGGACTGATACAGATTGG - Intergenic
1122202923 14:100133359-100133381 ATAAAAAGACTCCTACTGACAGG + Intronic
1124514522 15:30355161-30355183 GAAAGAGGAATGCTGCTGACAGG + Intergenic
1124728398 15:32175604-32175626 GAAAGAGGAATGCTGCTGACAGG - Intergenic
1125250712 15:37699544-37699566 AAAATAAGACTGCTAATGAATGG - Intergenic
1127518067 15:59715383-59715405 AAAGGAGGACTGCAGCTGACTGG - Intergenic
1130608887 15:85342604-85342626 AAAATATGACTGCTTCAGGCTGG + Intergenic
1131186610 15:90279540-90279562 AAAATAGGAGTGATAATCACAGG + Intronic
1131200376 15:90390319-90390341 AAAATAGGAGTGATAATCACAGG + Intronic
1134864323 16:17591162-17591184 AAAATAAGACTGAGACTTACTGG + Intergenic
1138217775 16:55219828-55219850 AAAATAAGACTGCTTGTGACAGG + Intergenic
1157929575 18:51806633-51806655 AAAATCTGACTTCTACTGGCTGG - Intergenic
1158559762 18:58504134-58504156 AAAATAGGAATGATCCTGGCAGG + Exonic
1160123465 18:76150420-76150442 AAAATAGGGGTGCTACAGAAGGG + Intergenic
1163999764 19:21086718-21086740 AAAATAGGGCTGAGACTGACTGG - Intronic
1164005716 19:21146805-21146827 AAAATAGGACTGAGACTGACTGG - Intronic
1164870039 19:31635366-31635388 AAAATACTACTGTTACTCACTGG + Intergenic
926492333 2:13539807-13539829 GAAATAGGACTGATCCTGTCTGG + Intergenic
926790738 2:16569022-16569044 AAAATAAGACTGTTTCTGATAGG + Intronic
927967519 2:27280645-27280667 AAATTGGGACTGCAACTGAAAGG - Exonic
928260482 2:29762277-29762299 ACAATGGGCCTGCTTCTGACAGG - Intronic
930303615 2:49649554-49649576 AAAGTAGCACTGCTAATAACAGG - Intergenic
937768448 2:125689435-125689457 AAAAAAAGACTGGTACTGAATGG + Intergenic
938670200 2:133579214-133579236 AAAATTGCACAGCTACTGAGTGG + Intergenic
938973515 2:136453791-136453813 AAAATAGGACCTATACTCACTGG - Intergenic
939799808 2:146695483-146695505 AAAATGGAATTGCTACTGCCAGG - Intergenic
946445138 2:219732842-219732864 TAAATAGAACTCCTACTGTCTGG + Intergenic
1169645500 20:7804882-7804904 TAAATAGGAGTGCCATTGACTGG + Intergenic
1172276813 20:33684598-33684620 AAAAAGGGACTGCTGCTGATGGG + Intronic
1178737191 21:35162893-35162915 AAAAGAAAACTGGTACTGACAGG - Intronic
1178779098 21:35582788-35582810 AAAATAGGATTGTTACTCCCAGG + Intronic
1181086887 22:20444217-20444239 GAAATGGGACTGCAACTGCCAGG + Intronic
1182583554 22:31329454-31329476 AAAATAGAACATCTCCTGACAGG - Intronic
1182898257 22:33876220-33876242 AAAACAGGACTGAAACTAACTGG + Intronic
958491188 3:94775868-94775890 AAAATAGGTCTGTTGCTAACAGG + Intergenic
960121314 3:113950902-113950924 AAGAAAGGAGTGTTACTGACAGG + Intronic
962255859 3:133869686-133869708 AAAATAGCACAGCTTCTGCCTGG + Intronic
963240857 3:143001218-143001240 AAAATAGGACTGGAGCTGACTGG - Intronic
965428557 3:168558587-168558609 AAAAAAAGACTGCTACTGACAGG - Intergenic
966977171 3:185094894-185094916 GAAAAAGGACGGCTGCTGACAGG + Intronic
967712071 3:192720720-192720742 ACTATAGGACTTCTACTGCCTGG - Intronic
970410601 4:15803826-15803848 AAAATAGGAATGCTAGGCACTGG - Intronic
970957316 4:21829312-21829334 AAAATAGCACTGACACTGAAAGG + Intronic
974863097 4:67547306-67547328 AAAATAGGATTGCTAATTAATGG + Intergenic
975358863 4:73442233-73442255 AAAATAGGACTACTACTGCTTGG - Intronic
975392054 4:73831975-73831997 AAAATAGGATTGATTTTGACAGG + Intergenic
977054618 4:92175628-92175650 CAAGTAGGACTGATACAGACAGG - Intergenic
977851081 4:101830574-101830596 AACCTTGAACTGCTACTGACTGG - Intronic
979725372 4:123954694-123954716 AAAATAAGACTGAGACTTACTGG - Intergenic
980757218 4:137180540-137180562 AAAATACGACCCCTACTGCCTGG - Intergenic
982570153 4:157039079-157039101 AAAATAGCACTGCTAGTGAAAGG - Intergenic
982600523 4:157443570-157443592 AACACAGAACTGCCACTGACTGG + Intergenic
984645333 4:182213127-182213149 ATAATAGGACTGCCAGTTACTGG - Intronic
986525625 5:8671426-8671448 AAAAAAGGATTACTACTCACAGG + Intergenic
986739395 5:10692817-10692839 CAAATAGGACTGCTACTGACAGG + Intronic
989735029 5:44693783-44693805 AAAGTGGGATTGATACTGACAGG + Intergenic
998398423 5:141834743-141834765 AAAACAGGACTTCTGCTGTCTGG + Intergenic
999546761 5:152637603-152637625 CAAATAGCACTGCTTCTGAAAGG - Intergenic
999651702 5:153774351-153774373 AAAATTGGACTTCTTCTGCCAGG - Intronic
1001994724 5:176147238-176147260 AAAATAGGACTGGAAATGAGTGG + Intergenic
1002629077 5:180556964-180556986 AAAAAAAGAATGCTACTGAATGG + Intronic
1004722695 6:18281644-18281666 AAACTAGTACTACTACTGCCAGG - Intergenic
1008270571 6:49483974-49483996 AAAATAGGACTGCTACTGACAGG - Intronic
1011912276 6:92455564-92455586 AAAAGAGAACAACTACTGACAGG - Intergenic
1013657089 6:112257146-112257168 AAAATAGGACTGAGACCTACTGG + Intergenic
1014085514 6:117338384-117338406 AAAATAGAACTGCTGATGTCAGG + Intronic
1014519095 6:122417044-122417066 AAAATAGGGTTGTGACTGACAGG + Intronic
1019806532 7:3130452-3130474 AGCATAGGACTGATACTGATAGG - Intergenic
1022181077 7:27921062-27921084 AAAATCTGACTACTACTAACCGG + Intronic
1022455272 7:30553178-30553200 AAATTAAGGCTGCTATTGACAGG - Intergenic
1030987232 7:116256230-116256252 AAAATGTGGCTGCTACTCACTGG - Intronic
1033548503 7:142424116-142424138 ACAATAGCAGTGCTATTGACTGG + Intergenic
1038152348 8:24953988-24954010 AAAACAGGACTCCTAATTACAGG + Intronic
1040696096 8:50000824-50000846 CAAATTTGTCTGCTACTGACAGG - Intronic
1041638943 8:60176021-60176043 AAAATTGCACTGGTCCTGACTGG + Intergenic
1042348602 8:67752302-67752324 AAATTACTACTGCTAGTGACAGG + Intergenic
1043642026 8:82465981-82466003 AAAAGTAGACTGCTTCTGACTGG + Intergenic
1046033468 8:108811838-108811860 ATAATAGTATTGCTACCGACTGG + Intergenic
1046560786 8:115834745-115834767 AAACTAGGACTGCTGCCCACAGG + Intergenic
1046779232 8:118197371-118197393 AAAACAGGACTTCTAGTGAAGGG + Intronic
1049007340 8:139863808-139863830 AAAATAGATCTGCCACTGAGGGG + Intronic
1051859597 9:21609361-21609383 AAAATGGGGCTGATACTTACTGG + Intergenic
1052123647 9:24749863-24749885 AAAATAGAAATGCTACTGTCTGG + Intergenic
1052610055 9:30759713-30759735 AAAATAAGATTTCAACTGACTGG - Intergenic
1055056480 9:72028894-72028916 AAAATAAGGCTGAGACTGACTGG + Intergenic
1057975241 9:99598638-99598660 AAAAAAGAATTTCTACTGACAGG + Intergenic
1187531084 X:20097590-20097612 TAAAAAGGAATGCTACTGGCTGG + Intronic
1188994717 X:36869667-36869689 AAAGTAATACTGCTTCTGACTGG + Intergenic
1193497837 X:82236505-82236527 AAAATATGACTGCAACTGTGAGG - Intergenic
1199433984 X:147792558-147792580 AAAATAGCACTGCTACCTAGAGG + Intergenic