ID: 1008276620

View in Genome Browser
Species Human (GRCh38)
Location 6:49550702-49550724
Sequence TGCAGCAGAGGCCACACCCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 336}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008276616_1008276620 -4 Left 1008276616 6:49550683-49550705 CCGGCTGGGAGTCCGGAGCTGCA 0: 1
1: 0
2: 0
3: 26
4: 158
Right 1008276620 6:49550702-49550724 TGCAGCAGAGGCCACACCCAGGG 0: 1
1: 0
2: 2
3: 31
4: 336
1008276611_1008276620 25 Left 1008276611 6:49550654-49550676 CCTGGGGCTGATCTAGTCTTCAG 0: 1
1: 0
2: 0
3: 9
4: 106
Right 1008276620 6:49550702-49550724 TGCAGCAGAGGCCACACCCAGGG 0: 1
1: 0
2: 2
3: 31
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008276620 Original CRISPR TGCAGCAGAGGCCACACCCA GGG Exonic