ID: 1008279620

View in Genome Browser
Species Human (GRCh38)
Location 6:49580674-49580696
Sequence AAAACTAGTCCTTAAATAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008279620_1008279621 6 Left 1008279620 6:49580674-49580696 CCTCTTATTTAAGGACTAGTTTT No data
Right 1008279621 6:49580703-49580725 TCTTGAGAACATGTATCTAATGG No data
1008279620_1008279623 21 Left 1008279620 6:49580674-49580696 CCTCTTATTTAAGGACTAGTTTT No data
Right 1008279623 6:49580718-49580740 TCTAATGGGTTGCATCTGATTGG No data
1008279620_1008279622 7 Left 1008279620 6:49580674-49580696 CCTCTTATTTAAGGACTAGTTTT No data
Right 1008279622 6:49580704-49580726 CTTGAGAACATGTATCTAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008279620 Original CRISPR AAAACTAGTCCTTAAATAAG AGG (reversed) Intergenic
No off target data available for this crispr