ID: 1008279622

View in Genome Browser
Species Human (GRCh38)
Location 6:49580704-49580726
Sequence CTTGAGAACATGTATCTAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008279620_1008279622 7 Left 1008279620 6:49580674-49580696 CCTCTTATTTAAGGACTAGTTTT No data
Right 1008279622 6:49580704-49580726 CTTGAGAACATGTATCTAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008279622 Original CRISPR CTTGAGAACATGTATCTAAT GGG Intergenic