ID: 1008284012

View in Genome Browser
Species Human (GRCh38)
Location 6:49627405-49627427
Sequence CAAAATGGTGATAGTGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 500
Summary {0: 1, 1: 0, 2: 47, 3: 101, 4: 351}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008284012_1008284016 4 Left 1008284012 6:49627405-49627427 CCCATCTCACTATCACCATTTTG 0: 1
1: 0
2: 47
3: 101
4: 351
Right 1008284016 6:49627432-49627454 AAGCCATTTAACAAGTCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008284012 Original CRISPR CAAAATGGTGATAGTGAGAT GGG (reversed) Intronic
902123411 1:14187519-14187541 CTAAAGGGTGATGGTGGGATTGG - Intergenic
904693155 1:32309968-32309990 CAAAATGGTGCTTGGCAGATTGG + Intronic
904724520 1:32537045-32537067 CAAAATGGTGCTTGGTAGATGGG - Intronic
904812010 1:33169528-33169550 CACAATGGGGAGAGTGAGAGGGG - Intronic
905518279 1:38578203-38578225 CAGGATGGAGAAAGTGAGATTGG + Intergenic
905893413 1:41530835-41530857 CCAAATGGAGAGAGAGAGATAGG + Intronic
907757915 1:57328708-57328730 CAAAGTGGTGATATAGAGAAAGG - Intronic
908018255 1:59870091-59870113 TAAAATGGTGAGACTGGGATTGG + Intronic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909236019 1:73153345-73153367 GAAAATGCTGATAGTGATAATGG - Intergenic
909752459 1:79179593-79179615 CAAAAGCCTGATAGTGATATGGG - Intergenic
910196023 1:84640387-84640409 CAAACTTTTGATAGTGAAATGGG - Intergenic
911174725 1:94807491-94807513 AAAAATGGTGATATTCAGCTGGG + Intergenic
911444082 1:97969317-97969339 CAAAATTGTGAAAATGAAATTGG - Intergenic
911753091 1:101521286-101521308 CAACACGGTGAGAGTGAGCTTGG + Intergenic
912121607 1:106478856-106478878 CAAAATGCTGATGATGATATGGG + Intergenic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
913665101 1:121040934-121040956 CAAGATGTTGATAGTGAGGGAGG + Intergenic
913938449 1:125079521-125079543 CAAAGTGGGGCTGGTGAGATTGG + Intergenic
913940211 1:125096335-125096357 CAAAGTGGGGCTGGTGAGATTGG + Intergenic
913944385 1:125144529-125144551 CAAAGTGGGGCTGGTGAGATTGG - Intergenic
913982639 1:143536124-143536146 CAAAGTGGGGCTGGTGAGATTGG - Intergenic
914016493 1:143824208-143824230 CAAGATGTTGATAGTGAGGGAGG + Intergenic
914161290 1:145136793-145136815 CAAGATGTTGATAGTGAGGGAGG - Intergenic
914655110 1:149732748-149732770 CAAGATGTTGATAGTGAGGGAGG + Intergenic
914974447 1:152347643-152347665 ATAAATGGTGATAGATAGATTGG + Intergenic
915440750 1:155944142-155944164 TAAAATGGAGACAGAGAGATGGG + Intergenic
916517212 1:165530477-165530499 CAAAATGTTAATAGTGATAATGG + Intergenic
916578438 1:166087356-166087378 CAAAATGGAGATGGTGGGCTGGG - Intronic
917661034 1:177177062-177177084 CAATATGTTGATAGTGTGGTGGG + Intronic
917688671 1:177444937-177444959 CCACAAGGAGATAGTGAGATTGG + Intergenic
918391898 1:184074113-184074135 CTAACTGGTTATAGTGGGATAGG + Exonic
918552653 1:185761206-185761228 CAAAAAGGAGATGGTGAAATGGG + Intronic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
920792598 1:209107172-209107194 CAACATGGAGATAGATAGATAGG - Intergenic
920927780 1:210358837-210358859 CAAAATGCTGAGAGTGAAAAGGG + Intronic
921274084 1:213500292-213500314 CAAAATGAAGATGGTGATATTGG - Intergenic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
1065142795 10:22735687-22735709 CAAACTGGTGGTCGTGATATAGG + Intergenic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1067181952 10:43994695-43994717 GATAATGGTGATGGTGATATTGG - Intergenic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1071849420 10:89553346-89553368 CAAAATGTTGATTGTCAGAGAGG - Intronic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073386958 10:103133805-103133827 AAAAATATTGATAGTGACATGGG + Intronic
1074918154 10:117979165-117979187 CAGAATGTTGATAGTGGGGTAGG + Intergenic
1077736923 11:4801083-4801105 CAAAATGCTGATAGAAATATGGG - Intronic
1078393275 11:10955140-10955162 CAAAATGCTGATAGGGATATGGG + Intergenic
1079279396 11:19073780-19073802 TAAAAAGGTGATAGTGATACAGG + Intergenic
1079707443 11:23638295-23638317 CAAATTGCTGATAGTGATATGGG - Intergenic
1079838742 11:25367547-25367569 CAAAATGGTGATAATTATATGGG - Intergenic
1080204986 11:29717886-29717908 CAAAATGCTGATAATAATATGGG - Intergenic
1080266840 11:30409897-30409919 CAAGTTTGTGATAGTGAGTTTGG - Intronic
1080997171 11:37618383-37618405 CAAAATACTGATAGTAACATGGG + Intergenic
1081122757 11:39286521-39286543 CAAAATACTGATAGCGATATGGG - Intergenic
1081361628 11:42187279-42187301 GAAAATGATGGTAGTGTGATTGG - Intergenic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1083982449 11:66184021-66184043 CAAAATGATGGTCGTGAGGTAGG - Intronic
1084007172 11:66329475-66329497 TAAAATGGGGCTAGTGAGACTGG + Intergenic
1084913023 11:72406579-72406601 CAAAATGATGGAAGTGAGATAGG - Intronic
1085406245 11:76264144-76264166 CCTAATGGTGATAGATAGATAGG + Intergenic
1085580972 11:77650132-77650154 CAAAATGGTGTTTGTGTGACTGG + Intergenic
1085862316 11:80248730-80248752 TAAAATGGAGATAGAGAGAATGG - Intergenic
1086004349 11:82019317-82019339 CAAGATGGTGATAGTTAAAGAGG + Intergenic
1086992082 11:93314431-93314453 TAAAATGCTGATAGTGATATGGG - Intergenic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1088829433 11:113522711-113522733 CAAAATAGTGAAGGTGACATTGG + Intergenic
1088865923 11:113848013-113848035 GAAAATGGTGAAAGGCAGATGGG + Intronic
1090110277 11:123900080-123900102 TATCATGGTGATAGTGAGAGTGG + Intergenic
1090506603 11:127321514-127321536 TAAAATGCTGATAGTGTTATGGG - Intergenic
1091477651 12:792216-792238 TATAAAGGTGATAGAGAGATTGG + Intronic
1091669789 12:2444828-2444850 CAAAGTAGAGATAGTGGGATTGG - Intronic
1092278866 12:7084790-7084812 CATGATGGTGATAATGAGAGTGG + Intronic
1092486003 12:8902533-8902555 CAAAATGCTGATAGCGATATAGG - Intergenic
1094373937 12:29770018-29770040 AAAAATGGCAATAGTGAGAAAGG + Intronic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1094554197 12:31482036-31482058 CAAAATCTTGATGGTGGGATAGG + Intronic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1097343751 12:58468239-58468261 AAAAATGGTGATAGTGATATGGG - Intergenic
1098078667 12:66760147-66760169 AAAAATGCTGATAGTGTGCTGGG - Intronic
1099077371 12:78127428-78127450 CAAAATAGTGATATTCACATTGG - Intronic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099495611 12:83342710-83342732 CAAAATGCTGATAGTGGTATGGG + Intergenic
1099607848 12:84828251-84828273 CAAAATGCTAATACTGATATGGG + Intergenic
1099655168 12:85479921-85479943 CAAAATGCTGGTAGTGATATGGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1099746113 12:86707193-86707215 CAAAATTGTGGTAGTGACTTTGG + Intronic
1101094740 12:101326318-101326340 CATAATTGTGATATTGAGAAGGG - Intronic
1101190359 12:102326181-102326203 TAAAATGCTGATAGTGATATGGG + Intergenic
1101334365 12:103783192-103783214 GAAGAGGGTGACAGTGAGATAGG + Intronic
1101526465 12:105535651-105535673 CAAAATGCTGATAGGGATATGGG - Intergenic
1103113379 12:118302860-118302882 CAAAATGGTAGTCGTGATATTGG - Intronic
1103413693 12:120730297-120730319 GAAAATGCTGATGGTGAGAAAGG + Intronic
1104142609 12:126003367-126003389 CAAAATGCTGATAGTGATGTAGG + Intergenic
1104348325 12:128022647-128022669 GAAAATGGGGAGAGTGAGAAAGG - Intergenic
1105400214 13:20085360-20085382 CAACAAGGTAATAGTGAGATAGG - Intronic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1106052804 13:26207279-26207301 CTAAATGGTAAAAATGAGATTGG + Intronic
1107838645 13:44434021-44434043 CAAAATGGTGACAGGTAGCTGGG - Exonic
1108085300 13:46783184-46783206 AAAAGTGCTGATAGTGAGAGAGG - Intronic
1109171619 13:59105146-59105168 CAACAAGGGGAAAGTGAGATGGG - Intergenic
1109359703 13:61280214-61280236 CAAAATGCTAATAGTGATATTGG + Intergenic
1110007662 13:70293249-70293271 CAAAATGTTGATGGTGATATGGG + Intergenic
1110803567 13:79728703-79728725 AAAAATGTTGGTAGTGTGATAGG + Intergenic
1111217769 13:85166251-85166273 CAAAATGGTGGTGGTGGGTTGGG + Intergenic
1111221242 13:85207840-85207862 CAAAGTGCTGATAGTGATATGGG + Intergenic
1111703986 13:91725117-91725139 CAGAATGGTGGAAGTGATATGGG + Intronic
1112099225 13:96168916-96168938 CAAAAATGGGAGAGTGAGATGGG - Intronic
1112859015 13:103807793-103807815 CAAAATGCTGGTAGTTACATGGG + Intergenic
1112861455 13:103833063-103833085 CAAAATACTGATACTGATATTGG + Intergenic
1112965268 13:105183759-105183781 CCAAATTGTAATAGTGGGATTGG - Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114961278 14:27893089-27893111 CAAAATGTTGATAATCATATGGG + Intergenic
1115358841 14:32478797-32478819 GAAAATGGTTAGTGTGAGATAGG + Intronic
1115533355 14:34346783-34346805 CAAAATGATGGTAATGAGAGTGG - Intronic
1115813321 14:37134113-37134135 CAAAATGGAGAGAGGGAGGTGGG + Intronic
1115998964 14:39222770-39222792 CAATGTGGTGAAAGAGAGATTGG - Intergenic
1116147848 14:41098975-41098997 CAAAATGCTGATAGCAATATGGG + Intergenic
1116784036 14:49268240-49268262 CAAAATGCTGATAGTGATTTGGG + Intergenic
1116904509 14:50391948-50391970 CAAAGTGGAGATAATGATATGGG - Intronic
1118464072 14:66014921-66014943 CAGAATGGTGATTCTGTGATGGG - Intergenic
1120072723 14:80122036-80122058 CAAAATGCTGATAGAAATATGGG + Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1121987842 14:98525720-98525742 GAAAATGTTTATAGGGAGATTGG - Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1123395902 15:19935123-19935145 CAAAGTGGGGCTTGTGAGATTGG - Intergenic
1123810950 15:23925756-23925778 CAAAATGGTGACTGTGTAATGGG - Intergenic
1123827176 15:24093734-24093756 CACAATGCTGATAGTGACATGGG - Intergenic
1123841782 15:24254613-24254635 CACAATGCTGATAGTGACATGGG - Intergenic
1123861159 15:24468067-24468089 CACAATGCTGATAGTGACATGGG - Intergenic
1126229029 15:46303896-46303918 GGTAGTGGTGATAGTGAGATTGG + Intergenic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1127876011 15:63112018-63112040 CAAAATGGAGATAGTGATGCAGG - Intergenic
1128102751 15:65017233-65017255 CAAAATGTTGATAGGAACATGGG + Intronic
1128925561 15:71652097-71652119 CAAAAAGGCAATAGTGAGTTGGG - Intronic
1129937443 15:79462639-79462661 CAAAATGGTGAAAGAAAGAGGGG + Intronic
1130762233 15:86832664-86832686 CAAAATGCTGACAGTGATATGGG - Intronic
1131410101 15:92200401-92200423 CAAAATGCTGATAGAAATATGGG + Intergenic
1131763932 15:95654855-95654877 CAAAATGGTGATGGCCACATGGG + Intergenic
1133838031 16:9383855-9383877 CAAAATGGAGTTAGGAAGATGGG - Intergenic
1133967713 16:10543669-10543691 CAAAATGGAAATAGAGAGAAAGG + Intronic
1134312332 16:13086603-13086625 CAAAATGGTACTAGTGAAAATGG + Intronic
1134393265 16:13839445-13839467 TAAGATGGTGACAGTGGGATGGG - Intergenic
1134595955 16:15496119-15496141 GATAATGGTGATAGTGATAATGG + Intronic
1134611189 16:15609600-15609622 CAAAGTGGTGATGGTAAGAAGGG + Exonic
1134634141 16:15779435-15779457 TAAAATGGGGATAGTGGGCTGGG - Intronic
1135744850 16:25008149-25008171 CAAAATGGTGATAGGGATTGTGG - Intronic
1136597347 16:31260431-31260453 CAAAGTGGAGATGGTGAGAGGGG - Intronic
1136662808 16:31780059-31780081 CAAAATGCTGGTAGTGATATGGG + Intronic
1136698357 16:32107264-32107286 CAAAGTGGGGCTGGTGAGATTGG - Intergenic
1136769246 16:32820568-32820590 CAAAGTGGGGCTGGTGAGATTGG + Intergenic
1136798861 16:33050561-33050583 CAAAGTGGGGCTGGTGAGATTGG - Intergenic
1136935474 16:34459501-34459523 CAAAGTGGGGCTGGTGAGATTGG + Intergenic
1136938313 16:34497174-34497196 CAAAGTGGGGCTGGTGAGATTGG + Intergenic
1136939441 16:34508265-34508287 CAAAGTGGAGCTGGTGAGATTGG + Intergenic
1136946215 16:34654443-34654465 CAAAGTGGGGCTGGTGAGATTGG - Intergenic
1136949059 16:34693002-34693024 CAAAGTGGGGCTGGTGAGATTGG - Intergenic
1136956556 16:34793518-34793540 CAAAGTGGGGCTGGTGAGATTGG - Intergenic
1136960380 16:34840296-34840318 CAAAGTGGAGCTGGTGAGATTGG - Intergenic
1136961506 16:34851383-34851405 CAAAGTGGGGCTGGTGAGATTGG - Intergenic
1136964344 16:34889069-34889091 CAAAGTGGGGCTGGTGAGATTGG - Intergenic
1136968489 16:34943756-34943778 CAAAGTGGGGCTGGTGAGATTGG - Intergenic
1137088954 16:36164287-36164309 CAAAGTGGGGCTGGTGAGATTGG - Intergenic
1137462619 16:48679371-48679393 CAAATTGATGATACTGAGGTGGG + Intergenic
1138052837 16:53799431-53799453 CAAAATGGTGATCAAGACATAGG - Intronic
1139041240 16:63001518-63001540 CAAAATGCTGATAGTAATGTGGG + Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1139577448 16:67850792-67850814 AAAAATAGTGATAGGCAGATAGG - Intronic
1139909755 16:70390457-70390479 TAAGATGGTGAAAGTAAGATAGG + Intronic
1140277869 16:73527063-73527085 CAAAATGGTGAATGTGTGAGTGG - Intergenic
1141823621 16:86464171-86464193 GAAAATGGTGATAGTGATGGTGG + Intergenic
1142287318 16:89176749-89176771 GAAGATGGTGATATTAAGATGGG + Intronic
1203071662 16_KI270728v1_random:1082675-1082697 CAAAGTGGGGCTGGTGAGATTGG + Intergenic
1142909981 17:3080656-3080678 CAAAATGTTGAAAGTGATAATGG - Intergenic
1143090036 17:4444726-4444748 CAGGATGGTGAAGGTGAGATGGG - Intronic
1144160420 17:12552318-12552340 GATAATCGTGATAGTGATATTGG - Intergenic
1145092339 17:19996307-19996329 CAAAGTGGCAATATTGAGATGGG - Intergenic
1145304239 17:21663966-21663988 GAACATGGTGATGGTGAGAATGG + Intergenic
1145692518 17:26757532-26757554 CAAAGTGGGGCTGGTGAGATTGG - Intergenic
1146114857 17:30126020-30126042 GAACATGGTGACAGTGAGACCGG - Intronic
1146640906 17:34540684-34540706 CAAAATGGTGATAGGGAAGCTGG - Intergenic
1149025004 17:52017343-52017365 CAAAATGCTGATAGAAACATTGG + Intronic
1149045477 17:52239832-52239854 ACAAATGGTAATAGTGAGACAGG + Intergenic
1203184047 17_KI270729v1_random:95084-95106 CAAAGTGGGGCTGGTGAGATTGG - Intergenic
1155382780 18:25242758-25242780 CAAAATGGAGAGAGTGGGAGAGG + Intronic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156799567 18:41093072-41093094 TAAAATGGGGATAGTGAGAATGG - Intergenic
1161435140 19:4258548-4258570 CACAAGGGAGAAAGTGAGATGGG - Intronic
1166017420 19:39993266-39993288 TAAAATGCTGATAGTGATAACGG + Intronic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
1202672174 1_KI270709v1_random:65609-65631 CAAAGTGGGGCTGGTGAGATTGG - Intergenic
1202682520 1_KI270712v1_random:20448-20470 CAAAGTGGGGCTGGTGAGATTGG - Intergenic
925638535 2:5965658-5965680 CAAAATGCCGATAGTGATATGGG - Intergenic
927222197 2:20723304-20723326 GAAAATGGAGTAAGTGAGATGGG + Intronic
928346613 2:30503325-30503347 ATAAATGTTCATAGTGAGATAGG - Intronic
929081501 2:38126948-38126970 CAAAATGCTCATAGTGATATGGG + Intergenic
929612688 2:43283485-43283507 CAAAATGCTGACAGTGATATGGG + Intronic
929725928 2:44427808-44427830 TAAAAATGTGATAGTGAAATGGG + Intronic
929876850 2:45804000-45804022 CAAGATGGTGAATCTGAGATTGG - Intronic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
930952243 2:57156868-57156890 AAAAATGCTGATAGAGATATGGG - Intergenic
933046104 2:77539308-77539330 CAAAATGCTGATTGTGATATGGG + Intronic
934249277 2:90334724-90334746 CAAAGTGGGGCTGGTGAGATTGG + Intergenic
934260302 2:91468746-91468768 CAAAGTGGGGCTGGTGAGATTGG - Intergenic
934762333 2:96863618-96863640 CCAGATGGAGAGAGTGAGATGGG + Intronic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
937268779 2:120633784-120633806 CAAAATGGTGATGAGGAGAGGGG + Intergenic
937659697 2:124416691-124416713 TAAAATGGTGATAATGATAATGG + Intronic
939482770 2:142770371-142770393 CAAAATGCTGATAGTGACATGGG + Intergenic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940514021 2:154656994-154657016 CAAAACGGTGTTAGTTAGAGTGG - Intergenic
940621644 2:156120989-156121011 CAAAATGCTAATAGTGATATGGG + Intergenic
940956403 2:159732861-159732883 TGAAATGGTGATAGTGATAGCGG + Intronic
941439098 2:165511294-165511316 AATTAGGGTGATAGTGAGATGGG + Intronic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
941614735 2:167706544-167706566 CTCAATGGTGATAGTGAGATGGG + Intergenic
943154761 2:184160496-184160518 CAAAATGGTGTGAGTAGGATTGG + Intergenic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
945601917 2:211878255-211878277 GAAAATGGTTATAATGAGAGTGG - Intronic
946672090 2:222115729-222115751 CCTAATGGTGATAGTGAACTGGG + Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
947808202 2:232982840-232982862 CAAAGTGGGGAGAGTGAGACAGG + Intronic
948330939 2:237164708-237164730 AAAATTGTTGAAAGTGAGATTGG + Intergenic
1170046231 20:12088363-12088385 CAAAATGTTGGTTGTGAGAAAGG - Intergenic
1170725164 20:18919682-18919704 CACAATGCTGATAGTGATATGGG + Intergenic
1170956095 20:20980739-20980761 CAAAAGGGTGAGAGTGGGAGGGG - Intergenic
1173211094 20:41032359-41032381 TAAAATGTTGACAGTGAGTTAGG + Intronic
1173323519 20:42010746-42010768 CAAAATGCTGACAGTGATAATGG - Intergenic
1176586011 21:8586358-8586380 CAAAGTGGGGCTTGTGAGATTGG - Intergenic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1177244837 21:18509920-18509942 CAATATGTTGACAGTGAAATGGG + Intergenic
1177394180 21:20511550-20511572 TAAAATGCTGATAGTGATATGGG - Intergenic
1177474789 21:21606058-21606080 CAAAAGGGTCATAATCAGATGGG - Intergenic
1177604557 21:23360804-23360826 CAAAACGCTGATAGTGATACGGG - Intergenic
1177605689 21:23375309-23375331 AAAAATGTTCATAGTGAGTTGGG - Intergenic
1177614664 21:23501168-23501190 CAAAATGCTGGTAGTGATATGGG + Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1178143882 21:29716492-29716514 CAAAATGCTGATAGTAATGTGGG + Intronic
1178149665 21:29779842-29779864 CAAAATGTAGATAGTGAGATTGG + Intronic
1179306333 21:40156710-40156732 CACAATGGTGGTAGTGATATAGG + Intronic
1180268819 22:10563264-10563286 CAAAGTGGGGCTTGTGAGATTGG - Intergenic
1180525596 22:16256511-16256533 CAAAGTGGGGCTGGTGAGATTGG - Intergenic
1180527181 22:16303250-16303272 CAAAGTGGGGCTGGTGAGATTGG - Intergenic
1180685776 22:17665327-17665349 CAAAATGCTGACAGTGATATGGG - Intronic
1181363168 22:22354354-22354376 GAAAAAGGTGACATTGAGATGGG - Intergenic
1203322774 22_KI270737v1_random:84403-84425 CAAAGTGGGGCTGGTGAGATTGG + Intergenic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951682235 3:25306806-25306828 AAACATGCTGATAGTGGGATGGG + Intronic
952177067 3:30875903-30875925 CCAAACTGTGATAGTGAAATGGG - Intronic
953596701 3:44321931-44321953 CAAAGTAGTAATAGGGAGATTGG + Intronic
955091335 3:55753517-55753539 CCAAATGGTGATGGTGCAATTGG + Intronic
955573971 3:60338737-60338759 CATAATGGTGGTACTGTGATGGG + Intronic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958551524 3:95620010-95620032 CAAAATGGTGATTCTGAAATTGG + Intergenic
958662574 3:97089794-97089816 CAAAATGGTTAGAGTTTGATGGG - Intronic
959225365 3:103575304-103575326 AAAAATGGTGATAGTCATTTAGG + Intergenic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
960024033 3:112988214-112988236 CAACATGGTGATAGGGAAGTGGG - Intergenic
962123390 3:132588112-132588134 CAAAATTTGGAAAGTGAGATGGG - Intronic
962139564 3:132774272-132774294 CAATATCTTGATAGTGATATGGG - Intergenic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
962949297 3:140203347-140203369 TAAAAAGGTGATAGTGAGGCAGG + Intronic
963433805 3:145242550-145242572 CAACATGCTGATAGTGATAAGGG - Intergenic
963539566 3:146567790-146567812 CAAAATGATGATAGTGATATGGG - Intergenic
964219445 3:154326967-154326989 GAAAATGGTGAGAGTGTTATGGG + Intergenic
964398267 3:156271280-156271302 TAAAAAGGAGATAGAGAGATAGG - Intronic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
964747826 3:160028284-160028306 CAAAATGATGACAGTTAGAAGGG - Intronic
965083774 3:164067871-164067893 CAGAATTGTGTTGGTGAGATGGG - Intergenic
965167715 3:165217780-165217802 TAAGGTGGTGATAGTGGGATAGG + Intergenic
965265854 3:166542359-166542381 TAAAATGGTGATAATGAAAAAGG + Intergenic
965326460 3:167310228-167310250 CAAAATGCTTATAGTGATAATGG - Intronic
965349305 3:167594280-167594302 CAAAATGTTCATAGTGATATGGG + Intronic
965387673 3:168064057-168064079 CAAGATGGTAAAGGTGAGATTGG + Intronic
966019467 3:175190000-175190022 ATAAATGGTGATGGAGAGATTGG + Intronic
966075783 3:175935602-175935624 CAAAATGCAGGTAGTGATATGGG + Intergenic
966088363 3:176099049-176099071 CAAAAAAGTGATTGTGAGAGGGG + Intergenic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
967130831 3:186469320-186469342 CAAAAAGGTCAGAGTGAGACCGG - Intergenic
967243672 3:187465862-187465884 TAAAATGGTGATATTGAAACTGG - Intergenic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
969541764 4:7795753-7795775 TGAAATGGTTATAGTGACATAGG - Intronic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
971546205 4:27890522-27890544 CAAAATGTTGATAGTGATATGGG + Intergenic
972527569 4:39930733-39930755 CAAAAGTGTGATAGTAAGACTGG + Intronic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
974637921 4:64589675-64589697 CAGAATGCTGATAGTGATATGGG + Intergenic
975819658 4:78257024-78257046 CAAAATGGTGGTAGTGATGGTGG - Intronic
975969545 4:80016884-80016906 CAAATTGGAGATGGTGAGAAGGG - Intronic
976374557 4:84329634-84329656 CAACAGGGTGATTGTGTGATGGG - Intergenic
977338212 4:95724652-95724674 AAGAATGGTGATAGGGAGAAAGG - Intergenic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
977734327 4:100394664-100394686 CAAACTGTTTACAGTGAGATAGG + Intergenic
979060987 4:116059935-116059957 CAAAGTGCTGATAGTGATGTGGG - Intergenic
979125708 4:116969397-116969419 CAAAATGCTAATAGTGCTATTGG - Intergenic
981343249 4:143647051-143647073 TAAAATGTTGATAGTGATATGGG + Intronic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981503193 4:145474189-145474211 CAAAATGCTAATAGTGATATGGG - Intergenic
981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG + Intergenic
981888067 4:149701737-149701759 GAAAATGGTTAGAGTCAGATGGG + Intergenic
982210281 4:153029194-153029216 CAAAATGCTGATAGAAATATGGG - Intergenic
983320427 4:166190070-166190092 GAAAATGCTGATAATGATATGGG + Intergenic
983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG + Intronic
983660360 4:170125563-170125585 TAAAATGCTGATAATGATATTGG + Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
984131358 4:175879139-175879161 CAAAATGCTAATAATGATATGGG - Intronic
984213292 4:176877074-176877096 GAAAATGTTCTTAGTGAGATGGG + Intergenic
984273910 4:177584175-177584197 CAGAATGGTGAGATTGACATAGG - Intergenic
984512358 4:180694017-180694039 CAAAATACTAATAGTGATATAGG - Intergenic
985047339 4:185953381-185953403 CAAAATGATGCCAGTGAGAGAGG - Intronic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
985631098 5:1014510-1014532 CAGCAAGGTGATGGTGAGATTGG + Intronic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
986911693 5:12565592-12565614 CAAAATGTCGATAATGATATTGG - Intergenic
987533209 5:19148797-19148819 CAAAATGCTGATAGTGACGAGGG - Intergenic
987841796 5:23231864-23231886 CAAAATGGTGGAACTGAGAGTGG - Intergenic
987918647 5:24249435-24249457 CAAAATGCTGACAGTGACATGGG - Intergenic
987926644 5:24350707-24350729 TAAATTGATGTTAGTGAGATGGG + Intergenic
988009510 5:25464379-25464401 CATAATGCTGATAGTAATATGGG + Intergenic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988076760 5:26363821-26363843 CAATATGCTGATAGTGATAAGGG + Intergenic
988262111 5:28900971-28900993 CAAAATGGTGCTGGTAAAATGGG + Intergenic
988456307 5:31390007-31390029 CAAAATGCTAATAGTGATATGGG - Intergenic
988876866 5:35456644-35456666 CAAAATGCTGATGGTGATAGGGG + Intergenic
989677025 5:43984164-43984186 CAAAATGCTGACAGTGACATGGG - Intergenic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
991126587 5:63076555-63076577 CACAATGGTAAAAGTGAGTTTGG + Intergenic
991186487 5:63814842-63814864 CAAAATGCTGATAGTGACATGGG + Intergenic
992226002 5:74620352-74620374 CTACATGGAGATAGTGAGACAGG + Intergenic
992426342 5:76661920-76661942 CAAAAGGGCAATACTGAGATGGG + Intronic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993792625 5:92225203-92225225 CAAAATACTGATAGTGAGATGGG - Intergenic
994232472 5:97323879-97323901 CAGAATGGGGACAGTGAGGTAGG - Intergenic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994735031 5:103542455-103542477 TAAAATGGTGATTCTAAGATTGG - Intergenic
994800996 5:104375453-104375475 CAAAATGGAAATAGTGAAAGAGG + Intergenic
994849569 5:105036671-105036693 CAAAACCCTGATAGTGATATGGG - Intergenic
995211964 5:109550959-109550981 CAAAATGCTGATAGCCATATGGG + Intergenic
995239338 5:109868544-109868566 CTAAATGGTGAAAGAGAAATTGG - Intronic
995591386 5:113703947-113703969 CAAAATGAAGATATTGAAATGGG - Intergenic
995595342 5:113742043-113742065 TAGAATGGTGACAGTGAGAAAGG - Intergenic
995779893 5:115763660-115763682 CAAAATGGTTTTAGTGATATGGG - Intergenic
996960777 5:129246590-129246612 CAAATTGGGGATCTTGAGATAGG + Intergenic
997898631 5:137742758-137742780 TAAAATGGAGACAGTAAGATAGG - Intergenic
997944448 5:138187122-138187144 CAACATGGTGCTAGTGAAACTGG + Exonic
998481004 5:142462886-142462908 CCAAATGGGGACAGTGGGATTGG + Intergenic
999556402 5:152747353-152747375 AGAAATGGTGATATTCAGATAGG - Intergenic
999689078 5:154129934-154129956 CAAAATTGTGAATGTGAGACTGG + Intronic
1000043507 5:157502771-157502793 CACAATGGTGCTAGTGGGAGGGG - Intronic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000768416 5:165319765-165319787 CAAAAAGCTGATAGTGATATGGG - Intergenic
1003798236 6:9630197-9630219 CCAAATGCTGATAGTGACATGGG + Intronic
1004809427 6:19243347-19243369 CAAAATGGTGCTAGTGAAACTGG + Intergenic
1005199540 6:23327573-23327595 CAAGATGGTGATAGTGATGGTGG - Intergenic
1006003626 6:30986058-30986080 CAAAATGTTGATACTGGGCTGGG - Intronic
1006344060 6:33465786-33465808 CAAAATGCTGATAGCAATATGGG + Intergenic
1006362637 6:33595312-33595334 CACAATGGTCACAGTGAGAGAGG + Intergenic
1006748349 6:36360893-36360915 CAAAGTGGTGCTAGTGAATTCGG - Intronic
1007707559 6:43799995-43800017 GAAAATGGAGATGGTGAGAGAGG + Intergenic
1008284012 6:49627405-49627427 CAAAATGGTGATAGTGAGATGGG - Intronic
1008445664 6:51587080-51587102 CAAAATGTTGATAGTGAATATGG - Intergenic
1009635004 6:66253751-66253773 CCAAATGCTGATAATGATATGGG - Intergenic
1010061145 6:71624658-71624680 CAAAATTGTGAAAGTGACTTTGG + Intergenic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1011907730 6:92392732-92392754 AAAAATGGTGACAGTGAAACAGG - Intergenic
1012120993 6:95366685-95366707 CAAAATACTGATAGTGATATGGG - Intergenic
1012321033 6:97846078-97846100 TAAAATGGTGCAAGTGAAATGGG - Intergenic
1012569001 6:100699691-100699713 CAAAATGCTGATAATGATTTGGG + Intronic
1012765499 6:103362467-103362489 CAAAATGCTCATAGTGATATGGG + Intergenic
1012848413 6:104418628-104418650 CAAAATGGAGAAAGTGAGTAAGG - Intergenic
1013269565 6:108533615-108533637 CAAAGTGGTGATGGTAAGGTGGG - Intergenic
1013863756 6:114668496-114668518 CAGAATGTTGATAGTGGGAGAGG - Intergenic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1015936415 6:138409424-138409446 CACAATGGTGATAGAGAGGAGGG - Intronic
1016482497 6:144496976-144496998 GAACATGGTGCTAGGGAGATAGG + Intronic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1020484716 7:8706895-8706917 CAGAATGGTGAGAGTGAGAAGGG + Intronic
1020933269 7:14427337-14427359 CAAACTGCTGATAGTGATATGGG - Intronic
1021817382 7:24460831-24460853 GAATATGGTGGAAGTGAGATTGG - Intergenic
1023686300 7:42738950-42738972 CATAATTGTGATAAAGAGATTGG - Intergenic
1024383614 7:48726149-48726171 CAATATGCTGATAATGATATGGG - Intergenic
1024389214 7:48787656-48787678 CAAACTGGTTATACTGGGATTGG + Intergenic
1025282246 7:57636562-57636584 GAACATGGTGATAGTGAGAATGG + Intergenic
1025302484 7:57828957-57828979 GAACATGGTGATAGTGAGAATGG - Intergenic
1025307604 7:57877703-57877725 CAAAGTGGGGCTGGTGAGATTGG + Intergenic
1025321779 7:58102136-58102158 CAAAGTGGGGCTGGTGAGATTGG - Intergenic
1025474926 7:60907418-60907440 CAAAGTGGGGCTGGTGAGATTGG - Intergenic
1025481064 7:60983455-60983477 CAAAGTGGGGCTGGTGAGATTGG - Intergenic
1025512077 7:61582456-61582478 CAAAGTGGGGCTGGTGAGATTGG + Intergenic
1025556632 7:62317487-62317509 CAAAGTGGGGCTGGTGAGATGGG + Intergenic
1025563292 7:62398784-62398806 CAAAGTGGGGCTGGTGAGATTGG - Intergenic
1025566009 7:62434898-62434920 CAAAGTGGGGCTGGTGAGATTGG - Intergenic
1026532980 7:71215845-71215867 CAAAATGCTTGTATTGAGATAGG + Intronic
1027748738 7:82113461-82113483 AAAAATGGAGATTTTGAGATGGG + Intronic
1027753558 7:82182346-82182368 CAACAATCTGATAGTGAGATGGG - Intronic
1027768335 7:82374897-82374919 CAAAATGATTTTATTGAGATAGG - Intronic
1028123205 7:87080905-87080927 CTGAATGGTGACAGTGACATAGG - Intergenic
1029997673 7:105024058-105024080 CAAAATGTTGGTAGTGAATTTGG + Intronic
1030726494 7:112932218-112932240 AAAAATGGTAATAGTGAGCTGGG - Intronic
1030728237 7:112952368-112952390 TAAAAAGGTGGAAGTGAGATAGG - Intergenic
1030771653 7:113483194-113483216 CAAAATGGGGATAGGAAGGTAGG - Intergenic
1030827699 7:114181033-114181055 AAAAATGATGATAGAGAGACAGG - Intronic
1031261928 7:119532438-119532460 CAAAATTCTGATAGTGATGTGGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1032553446 7:132806992-132807014 CAAAATGAGGCTGGTGAGATGGG + Intronic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1036893878 8:12615122-12615144 CAAAATGCTGATGGTTATATGGG - Intergenic
1037160445 8:15764944-15764966 CAAAATGGATATAGTGGGTTAGG - Intronic
1038051995 8:23822545-23822567 CAGAATGGGGCTGGTGAGATGGG + Intergenic
1038880541 8:31606076-31606098 CAAAATGCTGATAGTAATAAGGG - Intergenic
1040540120 8:48346346-48346368 CAAAATGCTGATGGTGATAGGGG + Intergenic
1042441032 8:68826965-68826987 CTAAAATGTGATACTGAGATAGG + Intergenic
1043127073 8:76412361-76412383 AAAAATGGTGATAGTGCATTGGG - Intergenic
1043694665 8:83203887-83203909 CAAAATGCTGATGGTGATATGGG + Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044127104 8:88472209-88472231 CAAAATGCTGAGAGTGATATGGG - Intergenic
1044326821 8:90868437-90868459 CAAAATGTCCATAGTGATATGGG + Intronic
1045096740 8:98805797-98805819 GAAAATGGTGATATAGAGGTAGG - Intronic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1046057883 8:109099972-109099994 CACAATTGTGAGAGTGAGAGAGG + Intronic
1046134129 8:110004471-110004493 CAAAATGCTGATAGTGATGTGGG - Intergenic
1046668917 8:117036246-117036268 CAAAATGCTGACAGTGATATGGG - Intronic
1046728638 8:117701210-117701232 CAAAGGAGTGATAGGGAGATAGG - Intergenic
1046978493 8:120310894-120310916 CAACATGGTGAAAATGAGATGGG - Intronic
1047573360 8:126126795-126126817 TAAAATAGAGATAGTGAGAGTGG - Intergenic
1048699932 8:137077441-137077463 CAAAATGTTGATAATGATATGGG + Intergenic
1048726231 8:137388068-137388090 CACAATGCTGATAGTGATATGGG - Intergenic
1048806452 8:138245905-138245927 CAAATTGCTGATAGTGATATGGG + Intronic
1048852185 8:138655842-138655864 GAAAATGGTGATGGCGGGATTGG - Intronic
1050589641 9:7148610-7148632 CCAAATGGTGGGAGTGAAATGGG - Intergenic
1050660210 9:7876197-7876219 CAAAATGCTTATAGTAATATGGG + Intronic
1050890625 9:10819845-10819867 AAAAATGCTGAGAGTGATATGGG - Intergenic
1050895025 9:10875987-10876009 AAAAATGGTGACAGTGATAAAGG + Intergenic
1050897368 9:10900201-10900223 CAAAATGATGATAGTGATATGGG - Intergenic
1051283515 9:15468486-15468508 CAAAATGGTGAAAATCTGATGGG - Intronic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1052220715 9:26018288-26018310 TAAAATGCTGATAATGATATGGG - Intergenic
1052531036 9:29684143-29684165 CAAAATAGGGATAGTCATATGGG + Intergenic
1053698276 9:40660038-40660060 CAAAGTGGGGCTGGTGAGATTGG + Intergenic
1053944281 9:43290253-43290275 CAAAGTGGGGCTGGTGAGATTGG + Intergenic
1053946515 9:43314538-43314560 CAAAGTGGGGCTGGTGAGATTGG - Intergenic
1054309567 9:63459446-63459468 CAAAGTGGGGCTGGTGAGATTGG + Intergenic
1054408357 9:64783583-64783605 CAAAGTGGGGCTGGTGAGATTGG + Intergenic
1054441507 9:65267395-65267417 CAAAGTGGGGCTGGTGAGATTGG + Intergenic
1054488771 9:65754094-65754116 CAAAGTGGGGCTGGTGAGATTGG - Intergenic
1055174510 9:73300395-73300417 CAAAATGCTGATAATGATACGGG - Intergenic
1055596102 9:77865819-77865841 CAAAATGGTAATACAGAGTTGGG + Intronic
1056950400 9:91036685-91036707 GGAAATGGTGTGAGTGAGATGGG - Intergenic
1057285435 9:93749742-93749764 CAAACTGCTGATAGTGATATGGG - Intergenic
1058722156 9:107773933-107773955 CAAAATGCTGACAGTTATATGGG - Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059582435 9:115566408-115566430 CAAAATGCTGATAATGATACAGG + Intergenic
1059797903 9:117719463-117719485 CAAAATTATAATGGTGAGATAGG - Intergenic
1059917171 9:119116958-119116980 CAAAATGTTGATAGAAATATGGG + Intergenic
1202780639 9_KI270717v1_random:33229-33251 CAAAGTGGGGCTGGTGAGATTGG + Intergenic
1203581888 Un_KI270746v1:14770-14792 CAAAGTGGGGCTGGTGAGATTGG - Intergenic
1203587417 Un_KI270747v1:18831-18853 CAAAGTGGGGCTGGTGAGATTGG + Intergenic
1203589645 Un_KI270747v1:43096-43118 CAAAGTGGGGCTGGTGAGATTGG - Intergenic
1203615913 Un_KI270749v1:63876-63898 CAAAGTGGGGCTGGTGAGATTGG - Intergenic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1186465198 X:9779397-9779419 GAAAAGGGTGATAGTGAGCCAGG - Intronic
1187212169 X:17242471-17242493 CAACTTGGTAATAGTGACATAGG - Intergenic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1188369197 X:29348259-29348281 CATAAAGGTGAAAATGAGATGGG + Intronic
1188749163 X:33884559-33884581 CAAAATGCTGATGGTTATATGGG + Intergenic
1189071390 X:37867288-37867310 CAGAATGCTGATAGTGATATGGG - Intronic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1189783332 X:44536738-44536760 AAAAATGGGGGTAGTGAGAGAGG + Intronic
1190888557 X:54550175-54550197 AAAAGTGGTGATACTGAGAATGG + Intronic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191752080 X:64553777-64553799 CAAATTGGTGGTATTGAGAATGG + Intergenic
1191760806 X:64646452-64646474 CAAAATGTTGATAGTAATATGGG + Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1192934990 X:75849954-75849976 AAAAATGCTGATAATGATATGGG - Intergenic
1192960010 X:76119420-76119442 TAAAATGGAGATGGTGAGGTAGG + Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193568759 X:83114609-83114631 GAAAATGGAGAGAGTGAGAAAGG - Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194093148 X:89602742-89602764 CAAAATGTTGATAGTGGGTTGGG + Intergenic
1194270731 X:91811427-91811449 TAAAATGTTAACAGTGAGATTGG + Intronic
1194418948 X:93649034-93649056 CCAAATGGTGATGGTGATATGGG + Intergenic
1194625503 X:96222003-96222025 GAAAGTAGTGATAGAGAGATTGG - Intergenic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1197623697 X:128780369-128780391 CAAAATGGTGAAAGGGAGACAGG + Intergenic
1198569189 X:137937314-137937336 CAAAATGCTGATAGAAATATGGG + Intergenic
1198588470 X:138149197-138149219 CAAAATGCTGATAGAAATATGGG + Intergenic
1199156840 X:144559771-144559793 CTAAATGGTGTTATTGATATGGG - Intergenic
1200445779 Y:3258845-3258867 CAAAATGTTGATAGTGGGTTGGG + Intergenic
1200587964 Y:5032860-5032882 TAAAATGTTAACAGTGAGATTGG + Intronic
1200677416 Y:6166302-6166324 CAGGATGTTGATAGTGAGAGAGG - Intergenic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic
1201317307 Y:12660431-12660453 TAAAATGGTGGTAGTAACATCGG + Intergenic