ID: 1008286621

View in Genome Browser
Species Human (GRCh38)
Location 6:49660641-49660663
Sequence GAAAGCTGCCTGGGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008286621_1008286632 13 Left 1008286621 6:49660641-49660663 CCATCTTCCCCCAGGCAGCTTTC No data
Right 1008286632 6:49660677-49660699 CCTGGGTTGTAATGACTCCCAGG No data
1008286621_1008286628 -4 Left 1008286621 6:49660641-49660663 CCATCTTCCCCCAGGCAGCTTTC No data
Right 1008286628 6:49660660-49660682 TTTCCTGAGCCTTGGAGCCTGGG No data
1008286621_1008286627 -5 Left 1008286621 6:49660641-49660663 CCATCTTCCCCCAGGCAGCTTTC No data
Right 1008286627 6:49660659-49660681 CTTTCCTGAGCCTTGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008286621 Original CRISPR GAAAGCTGCCTGGGGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr