ID: 1008286622

View in Genome Browser
Species Human (GRCh38)
Location 6:49660648-49660670
Sequence GGCTCAGGAAAGCTGCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008286622_1008286632 6 Left 1008286622 6:49660648-49660670 CCCCCAGGCAGCTTTCCTGAGCC No data
Right 1008286632 6:49660677-49660699 CCTGGGTTGTAATGACTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008286622 Original CRISPR GGCTCAGGAAAGCTGCCTGG GGG (reversed) Intergenic
No off target data available for this crispr