ID: 1008286624

View in Genome Browser
Species Human (GRCh38)
Location 6:49660650-49660672
Sequence AAGGCTCAGGAAAGCTGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 707
Summary {0: 15, 1: 44, 2: 70, 3: 138, 4: 440}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008286624_1008286632 4 Left 1008286624 6:49660650-49660672 CCCAGGCAGCTTTCCTGAGCCTT 0: 15
1: 44
2: 70
3: 138
4: 440
Right 1008286632 6:49660677-49660699 CCTGGGTTGTAATGACTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008286624 Original CRISPR AAGGCTCAGGAAAGCTGCCT GGG (reversed) Intergenic
900436292 1:2632820-2632842 AAGGCCCAGGAAAGCAGGCCGGG + Intronic
902438980 1:16416904-16416926 AAGGCTCAGGAAAGCTGTCTGGG - Intronic
902700827 1:18170752-18170774 AAGGCTGAGGAAATCTCACTTGG + Intronic
902782233 1:18712099-18712121 AAGGCTCAGGGAAGCAGCCAAGG + Intronic
904092518 1:27955392-27955414 AAGGATTAGGAAAGCTTCATGGG + Intronic
904325012 1:29722677-29722699 CAGACTCAAGAAAGCTGCCCAGG + Intergenic
904937535 1:34142144-34142166 ATGGCTCAGAGAAGCTGCTTAGG - Intronic
905120183 1:35675834-35675856 AAGGCTCAGGAAAGCTGCCCAGG - Intergenic
905315167 1:37078056-37078078 AAGGCTGAGCAAAGCATCCTGGG - Intergenic
905407038 1:37740803-37740825 AGGGCTCAGAAAAGGTGTCTGGG + Intronic
905725948 1:40252166-40252188 AGCACTCAGGAAAGATGCCTAGG - Intergenic
905757412 1:40522905-40522927 AACACTCAGGAAAGCTACCCGGG + Intergenic
907890477 1:58631927-58631949 AGGGCTCAGAAGAGCTGACTTGG + Intergenic
908409289 1:63846894-63846916 CAGGCCCAGGACAGCGGCCTTGG + Intronic
909229209 1:73063393-73063415 ATGGTTCAGGAATTCTGCCTTGG + Intergenic
909419778 1:75450735-75450757 AAGTCCCTGGAAATCTGCCTGGG - Intronic
909728646 1:78867324-78867346 AAGGCTCAGGTGAGCTTCTTTGG - Intergenic
911579750 1:99621167-99621189 AGGTTTCAGTAAAGCTGCCTTGG + Intergenic
911708761 1:101044751-101044773 AAGGTTCAGGTAAGCTCCCCTGG - Intergenic
912101774 1:106216514-106216536 AAGTCTCAGGAAAGCTGGCTAGG - Intergenic
912265761 1:108156063-108156085 AAGGCTCAGGTGAGCTTCCCTGG + Intronic
912824003 1:112888756-112888778 AAGGGGCAGGGAGGCTGCCTAGG + Intergenic
913468193 1:119164596-119164618 AAAACTGAGGAAAGCTGGCTGGG + Intergenic
914349713 1:146830531-146830553 AAGGCTCAAGAAAGCTGCCTTGG + Intergenic
915114334 1:153586647-153586669 AAGGCTCAGAAAAGCTGCCCAGG + Intergenic
915336537 1:155146283-155146305 AAGGCGCAGGAAGGCTGCCTGGG - Intergenic
915590637 1:156868361-156868383 AAGGCTGGGGGAAACTGCCTGGG + Intronic
915743819 1:158140972-158140994 AAGGCTCAAGACAGCTGTCTGGG + Intergenic
915744684 1:158146820-158146842 AAGGCTCAAGGAAGCTTCCTGGG + Intergenic
915799500 1:158774447-158774469 ACAGCTCAGGAAAGCTGCCCAGG + Intergenic
916139705 1:161684991-161685013 CAGGCTCAACAAAGCTGTCTGGG - Intergenic
916350528 1:163844586-163844608 AAGGCTCAGATCAACTGCCTTGG + Intergenic
916849760 1:168691565-168691587 AAGGCTAAGGGAAGTTTCCTGGG + Intergenic
918811237 1:189123598-189123620 AAGGCTCAGAAAAGCTGCCCAGG + Intergenic
918825578 1:189319563-189319585 AAGGCTCAGGAGAGCTGCACAGG - Intergenic
918871763 1:189984103-189984125 AAGTGTCAAGAAAACTGCCTGGG + Intergenic
919030982 1:192242423-192242445 AAGGCTCAGGAAAGCTGCCTGGG + Intergenic
919309921 1:195894427-195894449 AAGGCTATGGAAAGCTGCCTGGG + Intergenic
919316130 1:195972063-195972085 AAGGTTATAGAAAGCTGCCTAGG - Intergenic
920117082 1:203628756-203628778 CAGGCCCAGGAAAGCAGCCTGGG + Intronic
921174124 1:212578986-212579008 AAGTCTCCAGAGAGCTGCCTGGG - Intronic
921634180 1:217473044-217473066 AAGGCTCAGGAAAGCTGCCTGGG - Intronic
921803935 1:219432975-219432997 AAGGCTCAGGAAAGCTGCCCAGG + Intergenic
921949766 1:220917353-220917375 TAAACTCAGGAAAGCTGCCCAGG - Intergenic
922339811 1:224646319-224646341 AAGGTTGAGGACAGCTGCCCGGG + Intronic
922485225 1:225968916-225968938 AGGGCTCAGTAAGGATGCCTCGG - Intergenic
922550187 1:226489004-226489026 GAGGCTCAGGAAAGTTGCCCGGG - Intergenic
922910120 1:229208816-229208838 AAAGCTCAGAAAAGCTGCCCAGG + Intergenic
922983054 1:229844727-229844749 CGGGTTCAGGAAAGCTGCCCAGG - Intergenic
922987831 1:229880048-229880070 AAGGTTCAGAAGAGCTACCTTGG + Intergenic
923921053 1:238564991-238565013 CAGACTCAGGAAAGCCTCCTGGG - Intergenic
924622610 1:245675217-245675239 AAGGCTCAGGTGAGCATCCTGGG - Intronic
924741884 1:246799003-246799025 AAGGTTCAGGAGAGCAGACTTGG + Intergenic
924809548 1:247389106-247389128 AAGGCCCAGCAATCCTGCCTGGG - Intergenic
1063285978 10:4688892-4688914 AAGGCTCAAGAAAGCTGCCGAGG - Intergenic
1064298305 10:14098949-14098971 AAGGCTTAGGAAAGCTACACAGG - Intronic
1064830317 10:19457441-19457463 AAGGCTCAAGAAAGCTGCCCAGG + Intronic
1064973895 10:21093822-21093844 AAGGCTAAGGAAACCAGTCTAGG - Intronic
1065784425 10:29200462-29200484 AATGCTCAGAAAAGCTTGCTTGG + Intergenic
1065856137 10:29831861-29831883 AAGGCTCAGGTGAGCATCCTCGG - Intergenic
1067018229 10:42773232-42773254 AAGGCTCAGGAAAGCTGCCCAGG - Intergenic
1068385947 10:56327528-56327550 AAGGCTCAGAAAAGCTGCTCTGG - Intergenic
1068797279 10:61097445-61097467 AAGGCTCAGGAAAACTACACGGG - Intergenic
1069874879 10:71555700-71555722 AAGGGTAAGGAAACTTGCCTTGG + Intronic
1069983805 10:72270500-72270522 AAGGCTCAGCAAATGTTCCTTGG - Intergenic
1070916544 10:80158670-80158692 CATGCTGAGGAAAGCTGGCTTGG - Intronic
1071389720 10:85160025-85160047 AAGGGTGAGGACAGCTTCCTAGG - Intergenic
1072436773 10:95421355-95421377 AAAGATCAGGAAAGCCACCTAGG + Intronic
1072707110 10:97688572-97688594 AATGCTCAGGAAAGGCTCCTGGG + Intergenic
1073428505 10:103471111-103471133 GAGGCTCAGGGAGGCTGCTTTGG - Intergenic
1075416646 10:122269258-122269280 CTGGCTCAGGAATGCAGCCTCGG + Intergenic
1075441205 10:122480499-122480521 AATGCCAGGGAAAGCTGCCTTGG + Intronic
1075477446 10:122748467-122748489 AAGGATAAGGAAAGCTGCCCAGG + Intergenic
1075583453 10:123639857-123639879 AAGGCTGTGGAAAGCTCTCTTGG + Intergenic
1075589299 10:123679847-123679869 AAGCCTCGGGAGATCTGCCTTGG - Intronic
1075784482 10:125039738-125039760 AAGGTTCAGGAAGGCGGCATCGG - Intronic
1076837178 10:133027058-133027080 CAGGCTCAGGAAAGCAGCCCAGG - Intergenic
1077030089 11:461614-461636 AAGGGCCAGCAAAGCTGACTGGG - Intronic
1077046619 11:549524-549546 AAGGGTCTGGAGTGCTGCCTGGG - Intronic
1077260452 11:1616210-1616232 AGGGCTCAGGATAGAAGCCTGGG - Intergenic
1077349616 11:2086406-2086428 AAGGCTCAGGATGCCTGGCTTGG - Intergenic
1077707909 11:4505819-4505841 AAGGCTCAGGAAAGCTGACCAGG - Intergenic
1078068709 11:8094557-8094579 AAGGATGGGGCAAGCTGCCTGGG - Intronic
1078727971 11:13949185-13949207 AAGGCTCAGGAAAGCTGCCAGGG + Intergenic
1079214150 11:18491422-18491444 AAGGCTCAGGTGAGCTACCTTGG + Intronic
1079216209 11:18514199-18514221 AAGGCTTTGGAAAGCTGTTTAGG - Intronic
1079268555 11:18959491-18959513 AAGGATGAGGGAAGCTCCCTGGG + Intergenic
1079346905 11:19660608-19660630 AAGGTTGAGGAACGCTGTCTAGG - Intronic
1079471043 11:20777795-20777817 AAGGCTGAGGCGGGCTGCCTTGG + Intronic
1079589847 11:22168838-22168860 AAGTATCAGGAAATCTTCCTAGG - Intergenic
1079903645 11:26219813-26219835 AAGGCTAAGGAAAGCTGCCTAGG + Intergenic
1080401455 11:31940261-31940283 AGGGCTCAGGAAAGCTGCCCAGG + Intronic
1080854005 11:36095919-36095941 AAGGGTTTGGAGAGCTGCCTTGG + Intronic
1080904867 11:36533286-36533308 AAGGCTCAGGAAAGTTGCCCAGG - Intronic
1081150444 11:39622822-39622844 ACAGCTCTGGAAAGCTGTCTGGG + Intergenic
1081406998 11:42709563-42709585 AAGGGAGAGGAATGCTGCCTTGG - Intergenic
1081469316 11:43355099-43355121 ATGGCTCAGGAAAGCTGCTTAGG - Intergenic
1081799149 11:45845847-45845869 AAGGGTCAGGTAAGCGGACTAGG + Intergenic
1083262597 11:61531307-61531329 AAGGGGCAGGCAAGCTGGCTGGG + Intronic
1083642024 11:64150776-64150798 TAGGCTCTGGAAAGCTGCCAGGG + Intronic
1083704585 11:64505290-64505312 AAGGCTCAGGCAAGCTGGCCAGG - Intergenic
1083769019 11:64856095-64856117 AAGGCTGGGAAAGGCTGCCTGGG + Intronic
1084216284 11:67648581-67648603 AAGGCCCAGGATCGATGCCTGGG - Intronic
1085010912 11:73141499-73141521 AAGGCTCTGCAAAGCTGCAGGGG + Intronic
1085482383 11:76833392-76833414 AAGGCTCAGGATAGTTGCCCAGG + Intergenic
1086023875 11:82266493-82266515 AAGGTTCAAGAAAGTTGCCTGGG - Intergenic
1086025465 11:82284937-82284959 AAAGCTCAGGAAAGCTGCCCAGG - Intergenic
1087409320 11:97770729-97770751 AAGGCTAAGGGGAGCTGGCTTGG + Intergenic
1087484296 11:98742637-98742659 AAGGCTCAGAAAAGCTGACTGGG - Intergenic
1087637202 11:100715449-100715471 AAGTGTCAGGAAAGCTGCCTGGG - Intronic
1087663116 11:101010755-101010777 AAGAGTCAGGAAACCTGACTTGG + Intergenic
1088188223 11:107197278-107197300 AAAGATCAGGAAAGCTTCCTGGG - Intergenic
1089017141 11:115175055-115175077 AAGGCTGAGGAAAGAGGCCAAGG + Exonic
1089048878 11:115528550-115528572 CAGGCTCAGGAAAGCTGCCGTGG - Intergenic
1089117920 11:116111292-116111314 AAGGCTCAGGTGAGCTTCCCTGG + Intergenic
1089320100 11:117619940-117619962 TAGGCTCAATAAAGCTCCCTGGG - Intronic
1090887568 11:130892848-130892870 CAGGCTCAGGATAACTACCTGGG - Intronic
1091379745 12:49388-49410 AGGTATCAGGAAAGCTGCCTAGG - Intergenic
1091830913 12:3550789-3550811 CAGGCTGGGCAAAGCTGCCTTGG - Intronic
1092176252 12:6409794-6409816 CAGGCTCAACAAAGCTGTCTGGG - Intergenic
1093342911 12:18000168-18000190 AAGACTGAGAAAAGCTTCCTGGG + Intergenic
1094107893 12:26833049-26833071 AAGGAACAGGAAACCTGCCGGGG - Exonic
1094168077 12:27463119-27463141 GTGGCTCAGGAAAGCTGTCAAGG + Intergenic
1094428838 12:30344244-30344266 AAGACTCAGGTCAGCTTCCTTGG - Intergenic
1094593390 12:31842139-31842161 CAGGCTCAAGGAAGCTGTCTGGG - Intergenic
1095229564 12:39723048-39723070 AAGGCTCAGGTGAGCTTCCCTGG + Intronic
1096442744 12:51659319-51659341 ATGGCTCATGAGAGCTGTCTGGG + Intronic
1096585859 12:52619127-52619149 GAGGAGCAGGAGAGCTGCCTGGG - Intergenic
1096773508 12:53950833-53950855 TAGGCTCAGGCAAGTAGCCTGGG - Intergenic
1098072316 12:66689077-66689099 AGGGCTCAGGCAGGCTGGCTGGG + Intronic
1098631812 12:72732493-72732515 AAGGCTCAGGAAAGCTGCCTGGG + Intergenic
1098702716 12:73648862-73648884 CAGGCTCAACAAAGCTGTCTGGG + Intergenic
1099834691 12:87894797-87894819 ATGCCTCAGCAAAGCTGGCTGGG + Intergenic
1100047443 12:90399826-90399848 AAGGCTCAGAAAAGCTGTCCAGG + Intergenic
1101253412 12:102956377-102956399 AAGGCCCAGGAAGGACGCCTGGG + Intronic
1101419275 12:104536183-104536205 AAGGCTGAGAAATGATGCCTTGG + Intronic
1102123427 12:110461185-110461207 CAGGCTCAACAAAGCTGTCTGGG + Intronic
1102322062 12:111944644-111944666 AATGCTCAGGAGAGCTGCAGAGG + Intronic
1103240853 12:119412192-119412214 AAGATTCAGGAGAGCTGCTTGGG - Intronic
1103365772 12:120382066-120382088 AAGGTTGAGAAAGGCTGCCTTGG + Intergenic
1103375240 12:120450590-120450612 CAGGCTCAACAAAGCTGTCTGGG - Intronic
1104548894 12:129737828-129737850 GAGGCCCAGGATAGCTGCCCAGG + Intronic
1104747292 12:131218714-131218736 CAGGCTCAGCCAAGCTGCCAGGG - Intergenic
1104895571 12:132162092-132162114 ATGGCTCATGACACCTGCCTCGG + Intergenic
1105701131 13:22936353-22936375 CAGGCTCAGCAGAGCTGCCCTGG + Intergenic
1105853962 13:24359401-24359423 CAGGCTCAGCAGAGCTGCCCTGG + Intergenic
1106130971 13:26939154-26939176 AAGGCTCAAGAAAGCTGTCCAGG + Intergenic
1107157506 13:37186551-37186573 AATGCTCATAAAAGCTGCATAGG + Intergenic
1107695930 13:42999750-42999772 AAGGCTCAAGAAAGCTGCCCAGG - Intergenic
1107987049 13:45784720-45784742 GAGGCTCTGGGAAGCTGCCCTGG - Intronic
1108829946 13:54464999-54465021 AAGGCTCAAGAAAGCTGTGCAGG + Intergenic
1109056302 13:57553315-57553337 AAGGCTCAGTAAAGCTGCCCAGG - Intergenic
1109289376 13:60455366-60455388 ATGTTTCAAGAAAGCTGCCTTGG - Intronic
1109397289 13:61776989-61777011 AAGGCTCAAAAAAACTGCCTGGG + Intergenic
1109498285 13:63204174-63204196 AATGCTCAGGAAAATTGCCAAGG - Intergenic
1109548109 13:63855681-63855703 AAAGTTCAGGAAAACTGCCTAGG - Intergenic
1109693142 13:65919486-65919508 AAGGCTCAGAAAAGCTAGGTGGG + Intergenic
1109955902 13:69565630-69565652 AAGACTCAAGTAAGCTCCCTAGG + Intergenic
1110155790 13:72314410-72314432 GAGGCTCAGGAAAGCCACCCAGG - Intergenic
1110350515 13:74502095-74502117 AAGGCTCAAGGAAGCTGTCTGGG + Intergenic
1110357858 13:74589195-74589217 ACTGCTTAGGAAAGCTGTCTTGG - Intergenic
1110443069 13:75547104-75547126 AAGGCACATGAAAGCCTCCTTGG + Intronic
1110721759 13:78769520-78769542 GAGGCTCAGGGAAGTTGCCCTGG - Intergenic
1111371795 13:87328804-87328826 GAGGCTCAGGGAAGCTGCCTGGG + Intergenic
1111541659 13:89675632-89675654 AGGGCTCAGGTAAGCTGCATAGG + Intergenic
1112298414 13:98209301-98209323 AAAACTCAGGAAAGTTGGCTGGG - Intronic
1112587074 13:100728268-100728290 CAAGCTCTGGAAAGCTGCCCAGG + Intergenic
1113009643 13:105749044-105749066 AATGCTAAGGACAGCTGCCTTGG + Intergenic
1114137008 14:19864494-19864516 AAGCCTTAGGAAAGCAACCTGGG - Intergenic
1114361881 14:21983222-21983244 AGGGCTCAGGAAAGCTGTCTAGG + Intergenic
1114598588 14:23935257-23935279 AAGGCTTAGGGAGGCTGCCCAGG - Intergenic
1115810255 14:37099229-37099251 AAGGCTGAGAAATGCTCCCTGGG - Intronic
1116082952 14:40199438-40199460 AAGGCTCAGGAAAGCTGCCCAGG - Intergenic
1116150107 14:41129944-41129966 AAGGCTCAAGACAGCTTCCCAGG + Intergenic
1116322632 14:43490444-43490466 AAGCCCCAGGAGAGCTGCCAAGG + Intergenic
1117735787 14:58767143-58767165 AAAGGTCAGGAAGGCTTCCTGGG + Intergenic
1117738885 14:58794849-58794871 CAGGCTCAACAAAGCTGTCTGGG + Intergenic
1118091465 14:62484969-62484991 GAAGCTCAGAAAAGCTGCCCAGG + Intergenic
1118145109 14:63126446-63126468 AAGGCTCAGGTAAGCTCCTCTGG + Intergenic
1118145130 14:63126621-63126643 AAGGCTCAGGTAAGCTCCCCTGG - Intergenic
1118968670 14:70612813-70612835 AGGTCTCAGCAAAGGTGCCTGGG + Intergenic
1119306339 14:73610965-73610987 AAGGCTCAGGAATGCTGCCTGGG - Intronic
1119678255 14:76572577-76572599 AAGGCTCAAGAGAGCTGGCTGGG + Intergenic
1120400628 14:84025944-84025966 AAAGCTCAGAAAACCTGCCAGGG - Intergenic
1120696755 14:87653606-87653628 AAGGCTCAGGAAATTGGCCTGGG + Intergenic
1121375005 14:93400464-93400486 ATGGTTCAGGAAAGCATCCTGGG + Intronic
1121401468 14:93681571-93681593 AAGGCACAGGGAAGCTGAATGGG - Intronic
1121523895 14:94605037-94605059 AAGGCTCAGGAAAGCTGCCCCGG - Intronic
1121530323 14:94648230-94648252 AAGGCTCAGGAAAGCTGCCTGGG + Intergenic
1121838051 14:97109514-97109536 AAGGCTCAGGTAAGCTGCCAGGG - Intergenic
1122097447 14:99381945-99381967 AAGGCACAGAAAGGCTCCCTTGG - Intergenic
1122623326 14:103071871-103071893 CAGCCTCGGGAAAGATGCCTCGG - Intergenic
1122861202 14:104583082-104583104 AGGGCTCAGGGAGGCTGTCTGGG + Intronic
1122861234 14:104583222-104583244 AGGGCTCAGGGAGGCTGCCTGGG + Intronic
1202841719 14_GL000009v2_random:126913-126935 AAGGCTCAGGGATGGTACCTGGG + Intergenic
1202911107 14_GL000194v1_random:117145-117167 AAGGCTCAGGGATGGTACCTGGG + Intergenic
1123702091 15:22922334-22922356 AAGGCTCTGGGGAGCTGCCCTGG + Intronic
1123800255 15:23811597-23811619 TAGGATCAGGAAAGGGGCCTAGG + Intergenic
1123933970 15:25185222-25185244 TAGGCTCAGGCAAGATGCCGAGG - Intergenic
1123941094 15:25217010-25217032 CTGGCTCAGGCAAGATGCCTAGG - Intergenic
1123944812 15:25233862-25233884 CTGGCTCAGGCAAGATGCCTGGG - Intergenic
1123947324 15:25245089-25245111 TGGGCTCAGGCAAGATGCCTGGG - Intergenic
1124605875 15:31170103-31170125 AAGGCTCAGGAAGGCTGCACAGG + Intergenic
1124610751 15:31206826-31206848 AAGGCTCAGGAATGCTCCCACGG + Intergenic
1124618637 15:31261347-31261369 AAGGCGAAGGAGAGCTGCATTGG - Intergenic
1124822815 15:33064422-33064444 AACTCTCTGGAAACCTGCCTAGG - Intronic
1125250668 15:37698988-37699010 AAGGCTCAGGTGAGCTTCCTTGG + Intergenic
1126259565 15:46672508-46672530 AGGGTTGAGGACAGCTGCCTGGG - Intergenic
1128349902 15:66881723-66881745 AAGGCTCAGGGCAGGTGCCCAGG - Intergenic
1128991029 15:72260520-72260542 AGGGCACAGGAGACCTGCCTGGG + Exonic
1129224207 15:74157219-74157241 AAGGCCCAGCGAAGCTGCCGGGG - Intergenic
1129703569 15:77781950-77781972 AAGGCAGAGGGAAGCAGCCTGGG + Intronic
1129972017 15:79787165-79787187 CAAGCTTAGAAAAGCTGCCTGGG + Intergenic
1130120855 15:81046420-81046442 AAGGCTCAGGAAATCTGCCCAGG + Intronic
1130294738 15:82637667-82637689 AAGGCTCAGGAAATGTCCATAGG - Intronic
1130580459 15:85133289-85133311 ACTGCTCAGGAAAGCTGCAGGGG - Intronic
1130982440 15:88822049-88822071 AAGGCTCAGGTGAGCTTCCCTGG - Intronic
1131110576 15:89762020-89762042 AAGGCTGAAGAAAACTTCCTTGG - Intronic
1131699788 15:94921944-94921966 AAAGCTCAAGTAAGCTTCCTTGG - Intergenic
1131737385 15:95348240-95348262 GAGGCACAGCCAAGCTGCCTTGG - Intergenic
1131861654 15:96660490-96660512 CAGACTCAGGAAAGCTGCTCAGG + Intergenic
1131867169 15:96723496-96723518 AAAGCTGAGGAAAGCTACCGTGG + Intergenic
1131968668 15:97871342-97871364 AATTCCCAGGAAAGCTGCCTGGG + Intergenic
1134030163 16:10985577-10985599 AAGCCTGAGGATAGCTGCCGTGG + Intronic
1134114010 16:11534496-11534518 AAGGCTCTGGTGAGCTTCCTTGG + Intergenic
1134319412 16:13149272-13149294 CAGGCTCAGGACATCAGCCTGGG - Intronic
1134342714 16:13359922-13359944 AAGACTCAAGAAAGCTGCCCAGG + Intergenic
1135680234 16:24450260-24450282 AAGTCTCAGGGAAGCTGCCTAGG + Intergenic
1135767343 16:25189041-25189063 CAGTCTCAGGAAAGCTTCCTCGG - Intergenic
1135884393 16:26292368-26292390 AAGGCTCAGGTGAGCTCCCCTGG + Intergenic
1138241121 16:55427922-55427944 CAGGCTCAGGAAGGCTGGCTGGG + Intronic
1138951393 16:61917543-61917565 AAGGCTCAGTAATGCTGCACAGG - Intronic
1138989713 16:62376447-62376469 AAGGTTGAGAACAGCTGCCTGGG - Intergenic
1139336952 16:66239424-66239446 AAGGCTCAGGAGAGCTTCCCAGG + Intergenic
1139984322 16:70885015-70885037 AAGGCTCAAGAAAGCTGCCTCGG - Intronic
1140423062 16:74836508-74836530 GAGGCTCAGGAGAGCTTCCTGGG - Intergenic
1140975403 16:80055442-80055464 AAGGTTCAAGAAAGCAGCCCAGG + Intergenic
1142914488 17:3124793-3124815 AAGGCTCAGAAAAGCTGCACAGG - Intergenic
1143286076 17:5790286-5790308 TAGGCTCTGCAGAGCTGCCTTGG + Intronic
1144221972 17:13107849-13107871 AGGGCTGAAGAAAGCTTCCTGGG - Intergenic
1144409638 17:14988109-14988131 AGGGATCAGGAAGTCTGCCTGGG + Intergenic
1144726347 17:17504456-17504478 AAGGCTCAGGAATGCGGCCCGGG + Intergenic
1145949186 17:28802642-28802664 CAGGCTCAACAAAGCTGTCTGGG + Intronic
1146163287 17:30571171-30571193 TAGGTTCTGGAAACCTGCCTTGG - Intergenic
1148023600 17:44569695-44569717 GAGGCTCACAAAAGCTGCCTGGG + Intergenic
1148332387 17:46820249-46820271 AAGGGTCGGGAGAGCCGCCTGGG + Intronic
1148838055 17:50476812-50476834 ACGGCTCAGGAAAGCTGCTGAGG + Intergenic
1149367253 17:55958195-55958217 CAGGCTGAGGAAATCTGCCTTGG + Intergenic
1149467022 17:56888069-56888091 AAAGCTCAGCATAGCTTCCTGGG - Exonic
1149994120 17:61397969-61397991 CCGGCTAAGGAAAGCTGCCCTGG + Intergenic
1150332862 17:64308471-64308493 CAGGCTCAACAAAGCTGTCTGGG - Intergenic
1151840427 17:76613580-76613602 AAGTCTTAGGAAAGCCGCCCTGG - Intergenic
1152253440 17:79223742-79223764 ACGGCCCAGGACAGCTGCCCAGG - Intronic
1152487357 17:80602707-80602729 CAGGCTCAACAAAGCTGTCTGGG - Intronic
1153948973 18:10041444-10041466 AAGGCTCAGGAAAGCTGCCCAGG - Intergenic
1154058146 18:11031663-11031685 AAGCCTCCGGAATGCTGCCCTGG - Intronic
1155106840 18:22675292-22675314 AAGGCTCAGAAAAGCTGCCTGGG - Intergenic
1155737969 18:29247745-29247767 GAAGCTCAGGAAAGATGTCTTGG - Intergenic
1155844433 18:30687784-30687806 AGGGCTCAGGAAAGCTGCCCAGG - Intergenic
1156751680 18:40465206-40465228 AAGGCTGAGACAAGCTTCCTTGG + Intergenic
1157439238 18:47697336-47697358 AAGGCTGAAGAAAGAGGCCTGGG - Intergenic
1158993659 18:62895194-62895216 AAGCCCCAGGGAAGCTGCATTGG + Intronic
1159499397 18:69250643-69250665 GAGGCTCAGGAAAGATGCCTGGG + Intergenic
1159715010 18:71810739-71810761 GAGGCTTAGGCAAGCTGCCCAGG - Intergenic
1161137635 19:2629439-2629461 ACGGGTCAGGTAAGTTGCCTGGG + Intronic
1161901493 19:7122865-7122887 GAGGCTGAGGTAAGCTGCTTCGG - Exonic
1162145943 19:8611985-8612007 AAGGCTCTGGCCAGCTCCCTGGG - Intergenic
1162202808 19:9033376-9033398 TGGGCTCAGGCAATCTGCCTTGG + Intergenic
1162820198 19:13218406-13218428 AAGGCTCAGGTGAGCTTCCCTGG + Intronic
1163144282 19:15370107-15370129 AAGACACAGGAAAGCTGCAAGGG + Intronic
1163638252 19:18447562-18447584 CAGGAGCAGGACAGCTGCCTGGG - Intronic
1164638742 19:29810443-29810465 AAGGCTCTGGAATGCTCCCAGGG - Intergenic
1164727119 19:30473449-30473471 AAGGCTCAAGAAAGCTTCCTGGG - Intronic
1165007702 19:32819967-32819989 AGGGCTCAGGAAAGCAGCTGGGG + Intronic
1165253985 19:34561959-34561981 AAGGGTCAAGACAGCTGTCTGGG + Intergenic
1165584485 19:36901939-36901961 CAGGCTCAACAAAGCTGTCTGGG + Intronic
1166814157 19:45532170-45532192 AAGGCTCAGGTAGGCTTCCCTGG + Intronic
1167170959 19:47831613-47831635 AAGGTTGAGGACTGCTGCCTTGG + Intronic
1167567204 19:50264227-50264249 AAGGCTCAGGTGAGCTTCCCTGG - Intronic
1167857414 19:52253854-52253876 ACGGCTCAGGAAAGCAGCCAGGG + Intergenic
1167955859 19:53063234-53063256 AAGGCTCAGGAAAACTGCTTGGG - Intergenic
1168017082 19:53582196-53582218 AAGGCACAGGAAGACAGCCTGGG + Intergenic
1168192618 19:54750804-54750826 AAGGCTCAGAAAAGCTACTCGGG + Intronic
1168194701 19:54765632-54765654 AAGGCTCAGAAAAGCTGCTCGGG + Intronic
1168196954 19:54782080-54782102 AAGGCTCAGAAAAGCTCCTCGGG + Intronic
1168200546 19:54812284-54812306 AAGGCTCAGAAAAACTGCTCAGG + Intronic
1168205317 19:54846339-54846361 AAGGCTCAGAAAAGCTGCTCGGG + Intronic
1168207546 19:54862544-54862566 AAGGCTCAGAAAAGCTGCTCGGG + Intronic
1168262158 19:55201755-55201777 AAAGCTCAGGTAACATGCCTTGG + Intronic
1168262624 19:55205047-55205069 AAAGCTCAGGTAACATGCCTTGG + Intronic
1168265755 19:55223236-55223258 AAGGCTTAGGAAAGTGGCCTAGG - Intergenic
1202657128 1_KI270708v1_random:34614-34636 AAGGCTCAGGGATGGTACCTGGG - Intergenic
925154598 2:1639735-1639757 GAGGCTCAGGCACTCTGCCTCGG + Intronic
925475643 2:4211212-4211234 AGGGCTCAGTTAAGCTGCTTAGG - Intergenic
926232025 2:11011572-11011594 GAGGCTCGGGAAAGCTGCCTGGG - Intergenic
926575499 2:14576037-14576059 AAGGCTCAGGAAAGCTGCCCAGG + Intergenic
926580378 2:14628208-14628230 AAGACTCATGAATGCTCCCTGGG - Intergenic
926756483 2:16240469-16240491 AAGACTCAGGGAAGCTGCCTGGG + Intergenic
927497619 2:23561386-23561408 GAGGCTCAGGAGAGCTGTGTGGG + Intronic
928695684 2:33847667-33847689 AAGGCTCAGGTGAACTTCCTTGG + Intergenic
930084851 2:47489030-47489052 AAGCCTCGGGAGAGCAGCCTTGG - Intronic
931019949 2:58032825-58032847 AAGGCTCAGGAAAGCTGGCTGGG - Intronic
931792395 2:65676285-65676307 AAGGCTCAGGAAAGCTGCCCAGG + Intergenic
932576689 2:72966137-72966159 ATGGCTCGAGAAAGCTGCCCAGG - Intronic
932671621 2:73742122-73742144 AAGGCTCAAGAAAGCTACCGAGG + Intergenic
932895058 2:75631423-75631445 AGGTCCCAGGTAAGCTGCCTTGG - Intergenic
932947721 2:76256847-76256869 AAGGCTCAAGAAAGTTGCACAGG + Intergenic
933038822 2:77434358-77434380 AAGGCCCATGAAAGGTGGCTGGG - Intronic
933167992 2:79096136-79096158 TAGGCTCATGAGAGCTGCTTGGG + Intergenic
933420367 2:82037836-82037858 AAGGCTGAAGAAATTTGCCTAGG - Intergenic
933512144 2:83254449-83254471 GAGGCACAGATAAGCTGCCTAGG + Intergenic
933656649 2:84894162-84894184 AAGGGTCAGGAAAGCAGGCAAGG + Intronic
933660724 2:84925439-84925461 GAGGCTCTGGAAGGCTCCCTCGG - Intergenic
933897707 2:86825999-86826021 AAGGCTCAGGGAGGCTGTCATGG - Intronic
934150963 2:89147161-89147183 AAGGCTCAGGAAAGCTGCCTGGG + Intergenic
934216310 2:90034864-90034886 AAGGCTCAGGAAAGCTGCCTGGG - Intergenic
934768205 2:96892345-96892367 AAGGCTTCTGAGAGCTGCCTGGG + Intronic
935220021 2:101004248-101004270 CAGGCTCAACAAAGCTGTCTGGG + Exonic
935577180 2:104723165-104723187 AAGGCTTTGGAAAGGTCCCTCGG - Intergenic
936564119 2:113569453-113569475 AGGTATCAGGAAAGCTGCCTAGG + Intergenic
936615487 2:114043583-114043605 AGAGCTCAGGAAAACTGCCCAGG - Intergenic
936675345 2:114708180-114708202 GAGTCTCAGGAAAGTTGCCCAGG + Intronic
937822227 2:126323448-126323470 AAGCTTCAGGAAAGCTACCCAGG + Intergenic
937840519 2:126519827-126519849 AAGGCTCAGGTGAGCTTCCCTGG + Intergenic
938556772 2:132431584-132431606 AAGACTCTGAGAAGCTGCCTTGG - Intronic
938564964 2:132510342-132510364 CAGGCTCGGGAAAGCTGTCTGGG + Intronic
938690916 2:133788306-133788328 AAGGCTCAAGAAGGCTTCCAGGG + Intergenic
938798450 2:134738349-134738371 AGGGTTCAGGAATGCTGCCAAGG + Intergenic
939633646 2:144555388-144555410 AAGTATCAGGAAAGCTATCTGGG + Intergenic
939905207 2:147905172-147905194 AAGGCTAAAGAAAGGTGCCAAGG - Intronic
940083134 2:149827708-149827730 AAGCCTCAGGAAAGCTACCTGGG + Intergenic
940204958 2:151192702-151192724 AAGGCTCAAGAAAGCTGCCCAGG + Intergenic
940382883 2:153036218-153036240 AAGACTCAAGAAAGCTGCCATGG + Intergenic
941090309 2:161167528-161167550 AAGGTTGACGACAGCTGCCTTGG + Intronic
942242875 2:173979813-173979835 AAGACTCATGTGAGCTGCCTGGG - Intergenic
942302156 2:174572345-174572367 AAGGCACAGGAAACCTCCCTGGG + Exonic
942535185 2:176955893-176955915 AAGGCTCAGGAAAGCAACCCAGG + Intergenic
942903746 2:181156303-181156325 AAGGCTCAGACAAGCTTCCCTGG - Intergenic
943313854 2:186361057-186361079 AAGGGGCAGGAAAGTTCCCTGGG - Intergenic
943464273 2:188209349-188209371 AAAGCTCAGGAGAGCTGGCATGG - Intergenic
944333771 2:198504265-198504287 AATGCTCAGAAAAGCTGCCTAGG + Intronic
944768101 2:202885204-202885226 AAGGCTCAAGAAAGCTGCCAGGG - Intronic
944928059 2:204485556-204485578 AAGGTTCAGGAACCCTGTCTTGG + Intergenic
945322130 2:208436576-208436598 ACGGTTCGGGAAAGCTGCCTGGG + Intronic
945552341 2:211235849-211235871 AAGGCTCATGAAAGCTGCCCAGG - Intergenic
945930345 2:215848812-215848834 AGGGCTCAGGAAAGCTGCCTGGG + Intergenic
946732966 2:222726654-222726676 CAGGCTCAACAAAGCTGTCTGGG + Intergenic
947398013 2:229705672-229705694 ATGGCTAAGGAAACCTACCTGGG - Intronic
947597596 2:231423264-231423286 CAGGCTCAGGCCAGCTGCCCAGG - Intergenic
1169040787 20:2493645-2493667 AAGGCTCAGAAGAGCTGCTCAGG - Intronic
1169271480 20:4202708-4202730 AAGGCTCAGGAAAGCAGCCTGGG - Intergenic
1169271655 20:4204216-4204238 AAGGCTCAGGAAAGCTGCCTGGG + Intergenic
1170494778 20:16914528-16914550 ACGGCCCAGGAAAGCTGCCCAGG - Intergenic
1170965296 20:21063367-21063389 AAGGCTCAGGAAAGCTGCCCAGG + Intergenic
1170992343 20:21314939-21314961 ATGGCTCAGGAAACATGCCCGGG + Intronic
1171444142 20:25191776-25191798 GAGGCTCAGGAAATCTGCTCAGG + Intergenic
1172282285 20:33716421-33716443 AAGGCTGAGGGAAGGTGGCTGGG - Intronic
1172599910 20:36176419-36176441 AAGGGCCACGAATGCTGCCTCGG - Intronic
1172869686 20:38128359-38128381 GAGGCTCAGGAAAGACTCCTAGG + Exonic
1173049665 20:39546976-39546998 ATGGGCCAGGAAAGCAGCCTGGG + Intergenic
1173091461 20:39975985-39976007 AAGGGCCAGGACAGCTGCCATGG + Intergenic
1173291039 20:41715512-41715534 AAGGTTCAGGAAAGCTGCCTGGG + Intergenic
1173410212 20:42803381-42803403 GAGGCTCAGGCAACCTGTCTGGG - Intronic
1173572848 20:44088627-44088649 CAGGCTCAGGAAATCTGCCCGGG - Intergenic
1174600009 20:51716847-51716869 GAGGCTCAGAAAAGTAGCCTTGG + Intronic
1175011775 20:55744964-55744986 AAGGCTCAGGAAAGCTGCTCCGG + Intergenic
1175116901 20:56689213-56689235 GAGGATCAGGAAAGTTTCCTGGG + Intergenic
1175986264 20:62765533-62765555 AAGGCTCTGGTAATCTGCCAAGG + Intergenic
1176630462 21:9131842-9131864 AAGGCTCAGGGATGGTACCTGGG + Intergenic
1176686351 21:9851627-9851649 AAGACTCGAGAAAGCTGTCTAGG + Intergenic
1177493023 21:21853258-21853280 AAGGCTCAGGAGAACTTCCCAGG + Intergenic
1177496318 21:21896226-21896248 CAAGCTCAGGGAAGCTGCCCAGG - Intergenic
1177511948 21:22098636-22098658 ATGGATCAGGAAAGCTGCCCAGG - Intergenic
1177626795 21:23672502-23672524 AGGACTCAGGATAGCTGCCCCGG - Intergenic
1177707954 21:24733699-24733721 AAGGCTCAAGGAAGCTGTCTGGG - Intergenic
1177752033 21:25296511-25296533 AAGGCTCAGGAAAGCTGCCTGGG - Intergenic
1177860953 21:26453430-26453452 GAGTCTCAGGAAAGCTGCTTGGG - Intergenic
1178370916 21:32027000-32027022 AAGGCTCAGGAGAGCCTCCGTGG + Intronic
1178990563 21:37351893-37351915 AGTGCTCAGGAAAGATGCCCAGG - Intergenic
1179054892 21:37922198-37922220 AAGACTCAGGAAAGCTGCCCCGG + Intergenic
1179216403 21:39370793-39370815 AAGCCTCAAGAAAGGTGCATAGG - Intergenic
1179623592 21:42634261-42634283 AAGGGTCAGGAAAGCCTCCAGGG - Intergenic
1179881637 21:44295532-44295554 CAGTTGCAGGAAAGCTGCCTGGG - Intronic
1180376129 22:12095819-12095841 AAGGCTCAGGGATGGTACCTGGG - Intergenic
1181840768 22:25658424-25658446 AAGGCTCAGCTAGGCTGCTTAGG + Intronic
1184480853 22:44746045-44746067 AGGGGTCAGGGAACCTGCCTGGG + Intronic
1184690042 22:46113387-46113409 CCTGCTCAGGAAAGGTGCCTTGG - Intronic
1184750515 22:46483725-46483747 AAGGCTCAGGAACTGTGCCCAGG + Intronic
1185288549 22:50013079-50013101 AGGGCCCTGGAAAGCTGGCTGGG + Intergenic
950547152 3:13645309-13645331 AAGGCTCAGATAAACTTCCTTGG - Intergenic
950555696 3:13694702-13694724 CAGGCTCGGGAAAGCTGCCCTGG + Intergenic
950993337 3:17465330-17465352 CAGGCTCAACAAAGCTGTCTGGG + Intronic
951066762 3:18276014-18276036 AAGGGGCAGGACAGCTCCCTAGG - Intronic
951946215 3:28139599-28139621 AAGGCTCAGGAAAGCTGCCCAGG - Intergenic
952348171 3:32508152-32508174 CAGGCTCAACAAAGCTGTCTGGG + Intergenic
952511139 3:34057367-34057389 AAGACTCACGAAAGCTGCCTGGG - Intergenic
953078979 3:39597786-39597808 AAGGCTCAGGAAAGCTGCCCAGG + Intergenic
953129360 3:40123683-40123705 AAGGCTCAGCAAAGCTGCCTGGG + Intronic
953891420 3:46754315-46754337 AAGGATCAGGTAGGCTGCCCAGG + Intronic
953896903 3:46809983-46810005 AAGGATCAGGTAGGCTGCCCAGG + Intronic
954291256 3:49651165-49651187 TAGGCTCAGGACAGGTGCCTTGG + Intronic
954425778 3:50442408-50442430 GGGGCTCAGGGAAGCTGCTTGGG - Intronic
954751715 3:52817755-52817777 AAGGGTCAGGGGAGCTGCCTGGG - Intronic
954789928 3:53124590-53124612 CAATCTCAGGAAGGCTGCCTGGG + Intronic
955040562 3:55313752-55313774 ATGGCTCAGGAAGGCTGCTCAGG - Intergenic
955639528 3:61067484-61067506 AAGGCTCAGGTGAGCTTCTTGGG - Intronic
956010947 3:64831085-64831107 TACAGTCAGGAAAGCTGCCTAGG - Intergenic
956078884 3:65536316-65536338 AGGTCTCAGGAAACCTGCATGGG + Intronic
957097270 3:75787671-75787693 AAGGCTCAGGGATGATACCTGGG + Intergenic
957161536 3:76616710-76616732 AAGGCTTAGAAGAGCTTCCTTGG - Intronic
957639578 3:82834383-82834405 AAGGCTTAGGAAAGCGGCCCAGG - Intergenic
958491290 3:94777197-94777219 AAAGCTCAAGAAATCTGCCTGGG + Intergenic
958973686 3:100641165-100641187 AAGTTTAAGGACAGCTGCCTGGG + Intronic
959213823 3:103424061-103424083 AAAGCTCAGGAAAGCTGCCTGGG - Intergenic
959313580 3:104773127-104773149 AAGGCTCAGGAAAGCTGCCTAGG - Intergenic
959461247 3:106628638-106628660 TAGGCTCAGGAAAGCTGCCTGGG + Intergenic
959668657 3:108949397-108949419 AAGGTCCAGCAAAGCTGCCAGGG + Intronic
960434619 3:117610432-117610454 AAGTCTCAGGAAGGCTGCCCGGG - Intergenic
960496191 3:118377859-118377881 AAGGCTCAGGAAAGCATCTCTGG + Intergenic
960612675 3:119569437-119569459 AAGAGTCAGGAAAGCTTCTTGGG - Intergenic
961196225 3:125003700-125003722 AAGGCTCTGGAGAGCTTCCGTGG + Intronic
961680369 3:128595995-128596017 AAAAATCAGAAAAGCTGCCTGGG + Intergenic
961773457 3:129267146-129267168 AAGACAAAGGAAAGCTGCTTGGG - Intronic
962361064 3:134743138-134743160 AAGGCTCAGGAATGCTGCCCAGG - Intronic
962444218 3:135450458-135450480 AAGAAACAGGACAGCTGCCTGGG + Intergenic
962521978 3:136205696-136205718 CAGGCTCAACAAAGCTGTCTGGG - Intergenic
963810404 3:149771255-149771277 AAGGCTGAGGAAAGATCCCTGGG - Intronic
963915167 3:150852531-150852553 AAGGCTCAGGAAAGCTGCCTGGG - Intergenic
967141681 3:186567039-186567061 AAGCCCCAGGACAGCCGCCTTGG - Intronic
967218772 3:187231869-187231891 AAGGCTTAGGGAAGATGCATGGG + Intronic
967603082 3:191412841-191412863 AAAGATCAGGAAAACTGCCTTGG + Intergenic
968129147 3:196182324-196182346 GAGGCTCAGGTAAGCTGCTCAGG - Intergenic
969430933 4:7153917-7153939 AGGTCTCAGGGTAGCTGCCTCGG + Intergenic
970021642 4:11575756-11575778 AAGGCTCAGGAAAGATGCCAGGG + Intergenic
970052147 4:11926465-11926487 GAGGCACAGGAGAGATGCCTGGG - Intergenic
970359803 4:15297547-15297569 AAGGATCAGGAAACCAGCCCAGG + Intergenic
970483479 4:16501234-16501256 AAGACTCAGAAAAGCTGCCCAGG - Intergenic
971022190 4:22548133-22548155 AAGGCTCCAGAAAGTTGCATAGG - Intergenic
971152099 4:24044219-24044241 AATGCTCAGGAAAGCTGAAAAGG - Intergenic
971569904 4:28198091-28198113 AAGGCTCGGGAAAGCTGCTTGGG + Intergenic
971575385 4:28266392-28266414 AAGGCTCAGGTGAGCTTCCTTGG + Intergenic
971996239 4:33968370-33968392 CAGGCTCAACAAAGCTGTCTGGG + Intergenic
972123490 4:35735303-35735325 AAATATCAGGAAAGCTGTCTGGG + Intergenic
972671696 4:41218496-41218518 AAGCTCCAGGAAAACTGCCTGGG - Intergenic
972771642 4:42202956-42202978 AAGGCTTAGGAAATCTGCAGAGG + Intergenic
973036802 4:45417045-45417067 AAAGTTCAGGAAAGCTGCCTGGG - Intergenic
973770674 4:54203682-54203704 AAGGCTTCAGAAAGCTCCCTGGG - Intronic
973770939 4:54205847-54205869 AAGGCTTCAGAAAGCTTCCTGGG - Intronic
974566477 4:63583234-63583256 CAAGCTCAGGAAAGATGCCCAGG + Intergenic
974721043 4:65738129-65738151 AAGGCTCAGATATGCTGGCTGGG + Intergenic
974776723 4:66492831-66492853 AATGCTCAGGAAAGCTGCCTGGG - Intergenic
974960112 4:68688311-68688333 ACAACTCAGGAAAGCTCCCTGGG - Intergenic
975393871 4:73853119-73853141 AAGGCTGGGGGCAGCTGCCTTGG - Intergenic
975405360 4:73982243-73982265 AAGGCTCTGGGCAGCTGCCTTGG + Intergenic
975885205 4:78956886-78956908 AAGGCTCAGGAAAGCTGCCTGGG - Intergenic
975906249 4:79215575-79215597 AAGGCTCAGGAAAACTACCTGGG - Intergenic
975946906 4:79718018-79718040 AAGGCTCAAGAAAGCTACTTAGG - Intergenic
976115628 4:81722871-81722893 TAGTCGCAGGAAAGCTGCTTCGG + Intronic
976757423 4:88513329-88513351 AAGATACAGGAAAGCTGGCTGGG - Intergenic
977708055 4:100093512-100093534 AGGCCTCAGGAAAACTACCTGGG - Intergenic
978550374 4:109918959-109918981 GAGGCCCAGGAAAGCGGCCAAGG - Intronic
978663664 4:111156041-111156063 AAGGCTCAAGACAGCTGCTTAGG - Intergenic
979013562 4:115401652-115401674 AAGGCTCAGAAAATCTGTCTGGG - Intergenic
979525122 4:121708193-121708215 AAGGATCAGAAAATCTGGCTTGG + Intergenic
979612140 4:122700492-122700514 AAGGCCCAAGAAAGCTGGCCAGG - Intergenic
979647681 4:123090980-123091002 AAGGTTCAGGAAAACTGCCCTGG + Intronic
979871507 4:125828626-125828648 AAGGCTTAGCAAAGCTGCCCAGG - Intergenic
980349802 4:131670103-131670125 AAGACTCAGGAAAGCTGTCTAGG + Intergenic
980585292 4:134805859-134805881 AAGGATCAGGAAAGCTGCCCAGG + Intergenic
980832491 4:138148975-138148997 AAGGCTCAGGAACACTGCCCAGG - Intergenic
980844858 4:138312472-138312494 AAGGCTCAAGAAATTTGCCCAGG + Intergenic
981620482 4:146692543-146692565 AAGGCTCAGGAAATCTTCCAGGG + Intergenic
981683389 4:147426132-147426154 CAGGCTCAACAAAGCTGTCTGGG - Intergenic
981909828 4:149966244-149966266 CTGGCTTAGGAAAGCTGCTTGGG + Intergenic
981940650 4:150278449-150278471 CAGGCTCAGGGAAGGTGCCGAGG - Intronic
982411485 4:155082659-155082681 AAAGTTCAAGAAAGCTGCCTGGG + Intergenic
983197412 4:164822866-164822888 AAGGCTGTGGAAATCTCCCTTGG + Intergenic
983475668 4:168208838-168208860 AAGGCTCAGGAAAGCTGGCAAGG - Intergenic
983751977 4:171285153-171285175 AAGGCTCAGGAAAGCTTCCTGGG - Intergenic
983801437 4:171934970-171934992 AAGGGTCAGGAGAGCTCTCTAGG - Intronic
984073527 4:175147035-175147057 AAGGCTCACGAGAGCGTCCTCGG + Intergenic
984352608 4:178614568-178614590 AAGGCTCAGGACAGCTGCCCAGG + Intergenic
984575104 4:181438700-181438722 AAGGCTCATGAAAGCTGCCTGGG + Intergenic
984635731 4:182107264-182107286 AAGGCTCTGGAAAGCTGCCCAGG + Intergenic
984762521 4:183375353-183375375 AAGGCTCAGGCAAGCTGGCCTGG + Intergenic
1202757726 4_GL000008v2_random:81259-81281 AAGGCTCAGGGATGGTACCTGGG - Intergenic
985636431 5:1038021-1038043 AGGGCTCCGGGAAGCCGCCTGGG + Exonic
985922182 5:2986024-2986046 AAGGGTCAGGACAGCTGTCTGGG - Intergenic
986759730 5:10868874-10868896 AAGCCCCAGGAAAGCTCCATTGG - Intergenic
986934826 5:12870266-12870288 AAGAATCAGGAAAGCTGCCCAGG - Intergenic
987441428 5:17961489-17961511 ATTACTCAGGAAAGCTACCTGGG - Intergenic
987512467 5:18857371-18857393 AGGGCTCAGGAAAGTTGCCTAGG - Intergenic
987520391 5:18974993-18975015 AAGGCTCAGAAAAGCTGGCCAGG + Intergenic
987656949 5:20819454-20819476 GAGGCTCAGAAAAGCTGCTTGGG + Intergenic
987873661 5:23651583-23651605 AAGGCTCAGGAAAGCTTTCTAGG + Intergenic
988162138 5:27532283-27532305 AAGTTTCAGGAAAGCTGCTCAGG + Intergenic
988300373 5:29417711-29417733 ATGGCTCAGGAAAGCTGCACAGG + Intergenic
988403428 5:30793100-30793122 AAGGCTCAAGAAAGCTGCCTGGG + Intergenic
988766604 5:34384494-34384516 GAGGCTCAGAAAAGCTGCCTGGG - Intergenic
989215823 5:38903275-38903297 AAGGCTGCGGAGAGCTGCCCAGG + Intronic
989375348 5:40755416-40755438 AACGCTCAGAAAGGCTGCCCCGG + Intronic
989954711 5:50344079-50344101 AAGGCTCAGGAAAGGTTCCCAGG - Intergenic
990058072 5:51610805-51610827 AAGGCCCAGGAAAGCTGCCTGGG - Intergenic
990348059 5:54888478-54888500 AAGGCACATGAAAGATGCCCTGG + Intergenic
990460565 5:56027621-56027643 AAGGTTGAGGACAGGTGCCTGGG + Intergenic
990870795 5:60430058-60430080 CAGGCTCAACAAAGCTGTCTGGG - Intronic
990975817 5:61560684-61560706 AAGGCTCAGTATCACTGCCTGGG + Intergenic
991725659 5:69533286-69533308 AAGGTTGAGAACAGCTGCCTGGG + Intronic
993123267 5:83801365-83801387 AAGGCTCAGGAAAGCTGCCCAGG + Intergenic
993521726 5:88911099-88911121 AAGGCTGAGGAAAGAAGCATCGG - Intergenic
993744710 5:91583040-91583062 AAGGCTCAGGAAAGCTGCCCAGG - Intergenic
993829734 5:92739965-92739987 AAGGCTCAGGAAAGCTGCTCAGG - Intergenic
994131757 5:96236926-96236948 AAGGATCAGGAAAGAGGCCACGG - Intergenic
994647281 5:102485570-102485592 AAGGCTCACGTAAGCTTCCCTGG + Intronic
994789250 5:104203864-104203886 AAGGCTCAGGAAAGTTGCCCTGG + Intergenic
994968056 5:106699356-106699378 AAGGCTCAATAAAGCTGCCTCGG + Intergenic
995466706 5:112457151-112457173 AAGGCTGAGGAAAGTTTCCTTGG + Intergenic
996659964 5:125990036-125990058 ATGGCTCAGGAAAGCAGCCAAGG - Intergenic
997372058 5:133368304-133368326 AAGGCTCAGGCAAGCTTCCCTGG + Intronic
997562800 5:134863239-134863261 CAGGCTCAACAAAGCTGTCTCGG - Intergenic
998257165 5:140596815-140596837 AAGGCTCAGGAAAGTTACCAAGG - Intergenic
998487407 5:142515066-142515088 AAGGCTCAGGAAAACTGTCCGGG + Intergenic
998992102 5:147828814-147828836 AAAGCTCAGGAACTCTGACTAGG - Intronic
999739352 5:154538307-154538329 AGGGTTCAGGTAAGCTGCCCAGG + Intergenic
1000351949 5:160359109-160359131 AGGGCTCAGGTAAGCTTCATAGG - Intronic
1000535531 5:162473332-162473354 AAGGCTCAGGAAAGCTGCCCAGG - Intergenic
1000572294 5:162930012-162930034 AAGGCTCAGGAAAGCTGCTTGGG + Intergenic
1000980023 5:167806931-167806953 AAGACTCAGGAAAGATACCACGG - Intronic
1000981163 5:167818652-167818674 AAGTCTCAGCAAAGATCCCTTGG - Intronic
1001161875 5:169325394-169325416 AGGGCTCAGGAAAGCAGTCAGGG + Intergenic
1001599262 5:172918589-172918611 CAGGCTCAGGAAGGCAGGCTTGG + Intronic
1002077744 5:176719125-176719147 AGGGTCCAGGAAAGCTGCCTTGG - Intergenic
1003053589 6:2800688-2800710 AAGGCTCAGGAAAGCTGCCCGGG + Intergenic
1003219561 6:4146805-4146827 AAGGCTCAGGAAAGCTGCCCTGG + Intergenic
1003792919 6:9567154-9567176 ACAGCTCAGGAAAGCTGCCCAGG + Intergenic
1003847671 6:10190148-10190170 AGGGCTCAGGAAAACTGCCTAGG + Intronic
1004072105 6:12309204-12309226 AAGGCTCAGGGAAGCTGTCTTGG - Intergenic
1004171236 6:13297039-13297061 TGGGCTCAAGAAACCTGCCTTGG - Intronic
1004290268 6:14360680-14360702 ATGGCTAAAGAAAGCTGCCGAGG - Intergenic
1005491955 6:26355330-26355352 AAGGCTTATGAAAGCTGCCTTGG + Intergenic
1006087677 6:31608127-31608149 GATGCTCAGAAAAACTGCCTGGG - Intergenic
1006241432 6:32682945-32682967 AAAGCTCAAGAAAGTTGTCTGGG + Intergenic
1006249579 6:32770391-32770413 AAAGCTCAAGAAAGCTGCCCAGG + Intergenic
1006578270 6:35061544-35061566 AAGCCTCAGGCCAGCTCCCTGGG - Intronic
1007273220 6:40654203-40654225 AAGGGTGAGGGAAGCTGCCTAGG + Intergenic
1007429948 6:41770930-41770952 GTGGCACAGGAAAGCTGCCGTGG + Exonic
1008286624 6:49660650-49660672 AAGGCTCAGGAAAGCTGCCTGGG - Intergenic
1008509656 6:52264396-52264418 ATGGGTCATGAAAGCTGCCATGG - Exonic
1009771960 6:68154555-68154577 AAGGCTCAAGAATGCTGCCCAGG - Intergenic
1010339576 6:74732536-74732558 AAGGGTCAAGAGAGCTGTCTGGG - Intergenic
1011239673 6:85257525-85257547 CAGGCTCAACAAAGCTGTCTGGG + Intergenic
1012127126 6:95444154-95444176 AAGGCTCAGGAAAGCTGCCTAGG + Intergenic
1012711137 6:102606916-102606938 AAGGCTCAGGAAAGTTGTCCAGG - Intergenic
1013649864 6:112183569-112183591 AAGGATCAGGAATTCTGCCTGGG + Intronic
1014003071 6:116386566-116386588 AAGGCTCAGGTGAGCTTCCCTGG - Intronic
1014015932 6:116529837-116529859 TAGGCTCAGAAATGCAGCCTGGG - Intronic
1014230471 6:118896612-118896634 AATGCTCAGTAATGGTGCCTAGG - Intronic
1014358993 6:120451840-120451862 AAAGCTCAAGAAAGCTGCCTTGG + Intergenic
1014676853 6:124378307-124378329 AAGGCTCAGGAAAGCTACCCAGG + Intronic
1016032857 6:139356068-139356090 AGGACTTAGGAAAGCTACCTAGG + Intergenic
1016157086 6:140823722-140823744 ATGGCTCAGGAAAGCTACCCAGG - Intergenic
1016897231 6:149065513-149065535 CAGGCTCATGAAAGCTGCCCTGG + Intronic
1017768354 6:157625266-157625288 CGGGGTCAGGAAAGATGCCTGGG + Intronic
1017971170 6:159314137-159314159 AAGGCTCAGCAGAGCTGGGTGGG - Intergenic
1018446081 6:163860036-163860058 AAGGCTTAGGTTAGCTGCTTGGG + Intergenic
1018492988 6:164315877-164315899 AAGTCCCAGGAAAGCTGCCCAGG + Intergenic
1018784642 6:167098603-167098625 AAGGCCCGGGAAAGCTTCCCAGG + Intergenic
1018898059 6:168035042-168035064 AAGGCTCAGGCAAGAGCCCTGGG + Intronic
1018898067 6:168035085-168035107 AAGGCTCAGGCAAGAGCCCTGGG + Intronic
1020179786 7:5913501-5913523 AAGGCTCAGAAATGATGCCGTGG + Intronic
1020303150 7:6811383-6811405 AAGGCTCAGAAATGATGCCGTGG - Intronic
1021228710 7:18059449-18059471 AAGGCTCATGGAAGCAGGCTGGG - Intergenic
1021246957 7:18275011-18275033 GAAGTTCAGGAAAGCTGCCTGGG - Intronic
1021308572 7:19062733-19062755 AAGGCTCAGGAAAGCTGCCTGGG - Intronic
1021989181 7:26125759-26125781 AGGGCTCAGGAAAGCTGCCCAGG + Intergenic
1022520736 7:31005324-31005346 CAGGCTCAGGAACCCAGCCTGGG + Intergenic
1022613080 7:31896496-31896518 AAGGCTAAAGAAAGCTTTCTGGG - Intronic
1023199617 7:37681952-37681974 AAGGCTTCAGAAAGCTGCCCAGG - Intergenic
1023209174 7:37784682-37784704 GATGCTCAGAAATGCTGCCTTGG + Intronic
1023909847 7:44545972-44545994 ATTGCTCAGAAAAGATGCCTGGG + Intergenic
1024029776 7:45449318-45449340 ATGGCTCAGGAAAACTGCCCAGG - Intergenic
1024216042 7:47248855-47248877 AGAACTCAGGAAAGGTGCCTGGG + Intergenic
1024378216 7:48663598-48663620 AAAGCTCAGGAAAGCCTCGTAGG + Intergenic
1024836478 7:53525722-53525744 AAGGCTCAGTAAAGCTGCTCGGG - Intergenic
1024929629 7:54656554-54656576 CAGGCTCAACAAAGCTGTCTGGG + Intergenic
1025606570 7:63044033-63044055 AAAGCCCAGGAATGCAGCCTTGG - Intergenic
1026047221 7:66914778-66914800 CAGGCTCAACAAAGCTGTCTGGG + Intergenic
1026094171 7:67328588-67328610 AAGGCTGAGGAAAGAAGCATCGG + Intergenic
1027437076 7:78175431-78175453 AAGGCTCAGGAAAGCTGCCTAGG - Intronic
1028713313 7:93935859-93935881 AAGGCTCAGGTGAGCTTCCTTGG + Intergenic
1029004136 7:97189484-97189506 AAGGCTGAGGAAAGCTGCCTAGG - Intergenic
1029175763 7:98663297-98663319 AGGGCTCAGGAAAGTTCTCTGGG - Intergenic
1029198687 7:98824379-98824401 AAGGCTCAGGTGAGCTGCCCTGG + Intergenic
1032385525 7:131520330-131520352 CAGGCTCATCAAAGCTGTCTGGG + Intronic
1032598933 7:133272250-133272272 CAGGCAGAGTAAAGCTGCCTGGG - Intronic
1032712717 7:134475235-134475257 AAGGTTGAGGACAACTGCCTGGG + Intergenic
1032963622 7:137069853-137069875 AAGGCTCAGAAAAACTCCCCAGG - Intergenic
1033283821 7:140024066-140024088 AAGCCACAGCAGAGCTGCCTGGG + Exonic
1033374492 7:140744274-140744296 AAGGCTCAGGTGAGCTTCCCTGG + Intronic
1033528835 7:142243554-142243576 GAGGCTCAGGAAAGCTGGGGTGG + Intergenic
1033581582 7:142741986-142742008 TAGGCTCAGGAAAGCTGCCCAGG + Intergenic
1033995192 7:147337233-147337255 AAGGCACAGGAAAACTGCCAAGG + Intronic
1034375631 7:150641552-150641574 AAGATTCAGGAAAGCTGCCTGGG + Intergenic
1035908798 8:3542917-3542939 AAGTCTCAGGAGAGCTGCCTGGG - Intronic
1036185611 8:6620186-6620208 AAGGCACATGAAAGCTGCTGAGG + Intronic
1036778370 8:11628931-11628953 AAAGCCCAGGAATGCAGCCTTGG + Intergenic
1036779255 8:11634482-11634504 GAGGATCAGGAAAGATGACTTGG - Intergenic
1037127809 8:15371677-15371699 GAGGCTCAGGAAAGCTGCTGGGG - Intergenic
1037167513 8:15848518-15848540 CCAGCTCAAGAAAGCTGCCTGGG - Intergenic
1037278833 8:17212563-17212585 TAGGACCAGGAAAGCTGCCTTGG - Intronic
1037693343 8:21202444-21202466 AAAGCTCAGGAAACTTGCCCAGG - Intergenic
1037710248 8:21349605-21349627 AAGGCTTAGGAAAGCTGCCTGGG - Intergenic
1038424344 8:27454676-27454698 GAGGCTCATGATGGCTGCCTGGG + Intronic
1039135688 8:34320629-34320651 AAAACTCAGGAAAGCTACCTAGG - Intergenic
1040044866 8:42952405-42952427 AAGGCTCAGGTAAGCTTCTCTGG - Intronic
1040431123 8:47343558-47343580 AAAGCTGAGGAAAGCTGCCTGGG + Intronic
1040610063 8:48975451-48975473 CAGGCTCAAGAAAGCTGCTTAGG + Intergenic
1040638435 8:49303013-49303035 AAGTCTAAGGAAAGAAGCCTAGG + Intergenic
1041042940 8:53865114-53865136 CAGGCCCAGGAAGGCTGCCTGGG - Intronic
1041329935 8:56713908-56713930 GAGGGGCAGGAAAGCTGTCTGGG - Intergenic
1041477393 8:58281761-58281783 AAGGCTCAGGAAGACTGCCCTGG + Intergenic
1041833231 8:62180548-62180570 AGGGCGCAGGAAAGGTGCCAGGG + Intergenic
1042090668 8:65155599-65155621 CAGGCTCAACAAAGCTGCCTGGG + Intergenic
1042788980 8:72582200-72582222 AAGGCTCAGGAAAGCTGCCCAGG + Intronic
1042796419 8:72668203-72668225 AAGGCTCAGGGCAGCTTCCCTGG - Intronic
1043175535 8:77019643-77019665 CAGGCTCAGCAAAGCTGCTAAGG - Intergenic
1043346098 8:79299689-79299711 AAGGCTCAGAAAAGCTGCCTTGG + Intergenic
1043515313 8:80990180-80990202 AGGGCCCAGGAAAGCTGCGAAGG + Intronic
1043728869 8:83649846-83649868 AAGGATCAGTAAAACTTCCTAGG + Intergenic
1044063851 8:87674015-87674037 AAGGACCTGGGAAGCTGCCTTGG - Intergenic
1044657713 8:94565536-94565558 CAGGCTCAACAAAGCTGTCTGGG + Intergenic
1046350890 8:113010110-113010132 AAGACTCAGAAAAGGTGTCTTGG + Intronic
1046482225 8:114837298-114837320 AGGGCTCAAGAAAGCTGCCCTGG + Intergenic
1046993633 8:120489740-120489762 AAGGCTCACGAAAGCTTCCCAGG + Intronic
1047508827 8:125500607-125500629 AAGGCTCACCAAAGCTGGCTGGG - Intergenic
1047831748 8:128639728-128639750 AAGACTCAGGAAAGCTTACCTGG + Intergenic
1047918986 8:129613364-129613386 GATCCTTAGGAAAGCTGCCTAGG - Intergenic
1047997507 8:130350667-130350689 AAGGCTCATGAAAGCTGTGATGG - Intronic
1048108772 8:131443102-131443124 AAGGCTTAGAAAAGCTGGCTGGG + Intergenic
1048225309 8:132579363-132579385 GGGGCTCAGGGAAGCTGCCTGGG + Intronic
1048268424 8:133008182-133008204 AAGGTTCAAGAAAGCTTCATTGG - Intronic
1048349140 8:133601889-133601911 AAAGCGCAGGAAAGCTCTCTGGG + Intergenic
1048865685 8:138760146-138760168 CAGGCTCAGGGAAGGGGCCTGGG - Intronic
1049095862 8:140547734-140547756 AAAGCTCAGCACAGCTGCCATGG - Intronic
1049254148 8:141605019-141605041 AAGCCTCAGGACACCGGCCTGGG - Intergenic
1049320517 8:141993771-141993793 CAGCCTCACGAAAGCTGCCATGG - Intergenic
1049445366 8:142628000-142628022 GAGGCTCAGCAAAGCAGCCTGGG - Intergenic
1049888409 9:44663-44685 AGGTATCAGGAATGCTGCCTAGG - Intergenic
1050052356 9:1616425-1616447 AAGGCTCAGGAAAGCTGCCCAGG + Intergenic
1050545793 9:6707674-6707696 AAGGGTCAAGAAAGCTGCCCAGG - Intergenic
1050937426 9:11415386-11415408 AAGGCTCAGGAAAGCTGCTCGGG - Intergenic
1051140241 9:13970743-13970765 AAGGCTGAGAAAAGCTGCCCAGG - Intergenic
1051957250 9:22711385-22711407 AAGTCTCAGGAAAGCTGCCCAGG - Intergenic
1052641254 9:31167828-31167850 AAGGCTCACGAAAGCTGCACAGG + Intergenic
1052900293 9:33787948-33787970 TAGGCTCAGGAAAGCTGTCCAGG + Intronic
1053017558 9:34671411-34671433 AAGGCTCAGGAAAGCTGCCCAGG + Intergenic
1053465736 9:38307026-38307048 AAGGCTCAAGATAACTGCATGGG - Intergenic
1053556161 9:39139205-39139227 AAGGCTCAGAAAAGTTGGTTAGG - Intronic
1053782967 9:41629969-41629991 AAGACTCAAGAAAGCTGTCTAGG - Intergenic
1053820277 9:41959455-41959477 AAGGCTCAGAAAAGTTGGTTAGG - Intronic
1054110552 9:61103144-61103166 AAGGCTCAGAAAAGTTGGTTAGG - Intergenic
1054170920 9:61840111-61840133 AAGACTCAAGAAAGCTGTCTAGG - Intergenic
1054610305 9:67227981-67228003 AAGGCTCAGAAAAGTTGGTTAGG + Intergenic
1054666616 9:67740701-67740723 AAGACTCAAGAAAGCTGTCTAGG + Intergenic
1055303589 9:74906054-74906076 ACGGCTCAGGTAAGCTCCCATGG + Intergenic
1055315735 9:75032061-75032083 GAGACTCAGGAAAGTTGCCCCGG + Intergenic
1056775857 9:89512199-89512221 AAGGCTGAGGGAGGCTGTCTTGG - Intergenic
1057067847 9:92072270-92072292 ACGGATCGGGTAAGCTGCCTCGG + Intronic
1057497516 9:95572525-95572547 AAGGCTCAAGAGAGGCGCCTTGG + Intergenic
1057744876 9:97742870-97742892 AAGGCTCCGGAAAGCTGTCCAGG - Intergenic
1057962836 9:99473523-99473545 AAGGATCCGGAAAGCAGCCTAGG + Intergenic
1058357755 9:104104378-104104400 AAGGCTCAGAAAAGCTGCCTAGG + Intronic
1059133807 9:111783853-111783875 AAGGCTCAGGAAAGCTGCCCAGG + Intronic
1061007281 9:127935297-127935319 CAGGGTAAGGAAAGCTGCCTTGG + Exonic
1061884357 9:133584099-133584121 AAAGTTCAGGAAGGCTTCCTGGG - Intronic
1061939580 9:133876793-133876815 AAGGCTGATCAAGGCTGCCTGGG + Intronic
1062002767 9:134225119-134225141 AGGGCTCAGGACAGCTGTCTAGG - Intergenic
1062667161 9:137680914-137680936 AAGGCTCAGGCAAGTGGCCAGGG + Intronic
1062694858 9:137868428-137868450 AAGGTTCAGGAAAGCTGCCAGGG + Intronic
1203753290 Un_GL000218v1:99527-99549 AAGGCTCAGGGATGGTACCTAGG + Intergenic
1203538518 Un_KI270743v1:66123-66145 AAGGCTCAGGGATGGTACCTGGG - Intergenic
1185921836 X:4102039-4102061 AAAGCTTGGGAAAGCTGCCTGGG + Intergenic
1185922953 X:4114350-4114372 ATGGCTCAGGAAAGCTGCTCAGG - Intergenic
1186171275 X:6879743-6879765 AAGGCTCAGAAAAGCTGCCCCGG + Intergenic
1187060974 X:15787046-15787068 AGGGCTCAAGAAAGCTGCCCAGG + Exonic
1187276635 X:17821735-17821757 AAGGCTCAGAAAAGGTGACTTGG + Intronic
1187963817 X:24591253-24591275 AGATCTTAGGAAAGCTGCCTTGG - Intronic
1188956821 X:36443292-36443314 AAGGCTCAGGAAAGCTTCCCAGG + Intergenic
1188970641 X:36611463-36611485 AAGGCTCAAGAAAGCTGCCAGGG + Intergenic
1189064928 X:37797145-37797167 AAGGGTGGGGAAAGCTGCATTGG + Intronic
1189236321 X:39489918-39489940 AAGGCTCAGGAAAGCTGCTCAGG + Intergenic
1189802607 X:44705854-44705876 AAGGCTCAGGTGAGCTTCCCTGG - Intergenic
1189954021 X:46260202-46260224 AAGGTTCAGGGAAGCTCCCAAGG + Intergenic
1190252027 X:48734117-48734139 AAGGCTGAGGAACCCTGCCCTGG + Intergenic
1190880323 X:54487395-54487417 AAAGTTCAGGAAAGAGGCCTGGG - Intronic
1192150603 X:68710013-68710035 AAGGAGCAGGAAAACAGCCTGGG + Intronic
1194149762 X:90309633-90309655 CCAGCTCAGGAAAGCAGCCTTGG - Intergenic
1195540158 X:106054385-106054407 AAGGCTGAGGACAGGTGCCCAGG - Intergenic
1196351284 X:114733521-114733543 AAGACTCAAGAAAGCAGCCTTGG + Intronic
1196747823 X:119087328-119087350 AAGGCCTGGGAAAGCTGCCTGGG + Exonic
1197106536 X:122723200-122723222 AAAGCTCAGGAAAGAAGTCTGGG - Intergenic
1198018442 X:132634923-132634945 AAGACTCAAGAAAGCTGCCTGGG - Intronic
1199254203 X:145699942-145699964 AAGGCTCATGAAAACAGACTTGG - Intergenic
1199599429 X:149533177-149533199 AATGCTCAGAAAAGGTGCCCTGG - Exonic
1200391272 X:155949319-155949341 AAGGTTCAGGAAAGCTGCTCAGG - Intergenic
1200496140 Y:3886368-3886390 CCAGCTCAGGAAAGCAGCCTTGG - Intergenic
1201166938 Y:11217096-11217118 AAGGCTCAGGGATGGTACCTGGG + Intergenic