ID: 1008286629

View in Genome Browser
Species Human (GRCh38)
Location 6:49660663-49660685
Sequence CAACCCAGGCTCCAAGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008286629_1008286632 -9 Left 1008286629 6:49660663-49660685 CCTGAGCCTTGGAGCCTGGGTTG No data
Right 1008286632 6:49660677-49660699 CCTGGGTTGTAATGACTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008286629 Original CRISPR CAACCCAGGCTCCAAGGCTC AGG (reversed) Intergenic
No off target data available for this crispr