ID: 1008286632

View in Genome Browser
Species Human (GRCh38)
Location 6:49660677-49660699
Sequence CCTGGGTTGTAATGACTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008286625_1008286632 3 Left 1008286625 6:49660651-49660673 CCAGGCAGCTTTCCTGAGCCTTG 0: 13
1: 27
2: 41
3: 87
4: 358
Right 1008286632 6:49660677-49660699 CCTGGGTTGTAATGACTCCCAGG No data
1008286623_1008286632 5 Left 1008286623 6:49660649-49660671 CCCCAGGCAGCTTTCCTGAGCCT No data
Right 1008286632 6:49660677-49660699 CCTGGGTTGTAATGACTCCCAGG No data
1008286624_1008286632 4 Left 1008286624 6:49660650-49660672 CCCAGGCAGCTTTCCTGAGCCTT 0: 15
1: 44
2: 70
3: 138
4: 440
Right 1008286632 6:49660677-49660699 CCTGGGTTGTAATGACTCCCAGG No data
1008286629_1008286632 -9 Left 1008286629 6:49660663-49660685 CCTGAGCCTTGGAGCCTGGGTTG No data
Right 1008286632 6:49660677-49660699 CCTGGGTTGTAATGACTCCCAGG No data
1008286621_1008286632 13 Left 1008286621 6:49660641-49660663 CCATCTTCCCCCAGGCAGCTTTC No data
Right 1008286632 6:49660677-49660699 CCTGGGTTGTAATGACTCCCAGG No data
1008286622_1008286632 6 Left 1008286622 6:49660648-49660670 CCCCCAGGCAGCTTTCCTGAGCC No data
Right 1008286632 6:49660677-49660699 CCTGGGTTGTAATGACTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008286632 Original CRISPR CCTGGGTTGTAATGACTCCC AGG Intergenic
No off target data available for this crispr