ID: 1008288132

View in Genome Browser
Species Human (GRCh38)
Location 6:49679592-49679614
Sequence CCTTCCATATTCCATGCCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008288129_1008288132 16 Left 1008288129 6:49679553-49679575 CCTAATGACTGCACTGGAGTCTG No data
Right 1008288132 6:49679592-49679614 CCTTCCATATTCCATGCCTTAGG No data
1008288127_1008288132 18 Left 1008288127 6:49679551-49679573 CCCCTAATGACTGCACTGGAGTC No data
Right 1008288132 6:49679592-49679614 CCTTCCATATTCCATGCCTTAGG No data
1008288128_1008288132 17 Left 1008288128 6:49679552-49679574 CCCTAATGACTGCACTGGAGTCT No data
Right 1008288132 6:49679592-49679614 CCTTCCATATTCCATGCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008288132 Original CRISPR CCTTCCATATTCCATGCCTT AGG Intergenic
No off target data available for this crispr